Homologs in group_2107

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15475 FBDBKF_15475 98.1 Morganella morganii S1 atpF F0F1 ATP synthase subunit B
EHELCC_15835 EHELCC_15835 98.1 Morganella morganii S2 atpF F0F1 ATP synthase subunit B
NLDBIP_16535 NLDBIP_16535 98.1 Morganella morganii S4 atpF F0F1 ATP synthase subunit B
LHKJJB_16270 LHKJJB_16270 98.1 Morganella morganii S3 atpF F0F1 ATP synthase subunit B
HKOGLL_16040 HKOGLL_16040 98.1 Morganella morganii S5 atpF F0F1 ATP synthase subunit B
PMI_RS15155 PMI_RS15155 86.5 Proteus mirabilis HI4320 atpF F0F1 ATP synthase subunit B

Distribution of the homologs in the orthogroup group_2107

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2107

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A7MMX3 6.82e-96 276 90 0 156 3 atpF ATP synthase subunit b Cronobacter sakazakii (strain ATCC BAA-894)
A1JTD1 1.17e-95 276 89 0 156 3 atpF ATP synthase subunit b Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q7NA90 1.49e-95 275 89 0 156 3 atpF ATP synthase subunit b Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A4WGF1 1.87e-95 275 89 0 156 3 atpF ATP synthase subunit b Enterobacter sp. (strain 638)
B1JRM8 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q663Q4 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSI9 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pestis (strain Pestoides F)
Q1CCH1 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Nepal516)
A9R5U3 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Angola)
Q7CFM4 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pestis
B2K843 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C091 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pestis bv. Antiqua (strain Antiqua)
A7FPE4 6.05e-95 274 89 0 156 3 atpF ATP synthase subunit b Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XZM0 7.78e-95 273 88 0 156 3 atpF ATP synthase subunit b Klebsiella pneumoniae (strain 342)
A8ACP2 8.98e-95 273 89 0 156 3 atpF ATP synthase subunit b Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YVP0 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella sonnei (strain Ss046)
P0ABA3 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella flexneri
Q0SYU0 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella flexneri serotype 5b (strain 8401)
Q329S5 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella dysenteriae serotype 1 (strain Sd197)
Q31UN6 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella boydii serotype 4 (strain Sb227)
B2TUN9 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK81 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1R4J6 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain UTI89 / UPEC)
B1LL63 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain SMS-3-5 / SECEC)
B6I3X3 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain SE11)
P0ABA0 3.42e-94 272 88 0 156 1 atpF ATP synthase subunit b Escherichia coli (strain K12)
B1IX02 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0ABA1 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAX3 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A6J9 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O9:H4 (strain HS)
B1X9W4 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli (strain K12 / DH10B)
B5YXE0 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ABA2 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O157:H7
A7ZTU8 3.42e-94 272 88 0 156 3 atpF ATP synthase subunit b Escherichia coli O139:H28 (strain E24377A / ETEC)
A6TG40 6.05e-93 269 88 0 154 3 atpF ATP synthase subunit b Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q7CPE4 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGD7 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella typhi
B4TN35 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella schwarzengrund (strain CVM19633)
B5BIP0 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi A (strain AKU_12601)
A9MXB0 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PKW8 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYD5 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella newport (strain SL254)
B4TAX6 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella heidelberg (strain SL476)
B5QVD6 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella enteritidis PT4 (strain P125109)
B5FN37 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella dublin (strain CT_02021853)
Q57HX5 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella choleraesuis (strain SC-B67)
A9MJR5 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5EZ00 8.15e-93 268 87 0 156 3 atpF ATP synthase subunit b Salmonella agona (strain SL483)
A8G7M4 9.19e-93 268 87 0 156 3 atpF ATP synthase subunit b Serratia proteamaculans (strain 568)
B5RFV9 3.58e-92 267 86 0 156 3 atpF ATP synthase subunit b Salmonella gallinarum (strain 287/91 / NCTC 13346)
B2VCA8 3.87e-91 264 85 0 156 3 atpF ATP synthase subunit b Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q6CYJ1 3.96e-87 254 87 0 156 3 atpF ATP synthase subunit b Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4F0E3 2.64e-85 249 86 0 156 3 atpF ATP synthase subunit b Proteus mirabilis (strain HI4320)
Q2NQ90 5.82e-85 249 83 0 156 3 atpF ATP synthase subunit b Sodalis glossinidius (strain morsitans)
A0KQY2 2.67e-80 237 75 0 156 3 atpF ATP synthase subunit b Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4STP7 2.12e-78 232 73 0 156 3 atpF ATP synthase subunit b Aeromonas salmonicida (strain A449)
B1KQ38 5.8e-78 231 71 0 156 3 atpF ATP synthase subunit b Shewanella woodyi (strain ATCC 51908 / MS32)
A8G1W9 3.7e-77 229 70 0 156 3 atpF ATP synthase subunit b Shewanella sediminis (strain HAW-EB3)
A3QJR4 7.96e-76 226 69 0 156 3 atpF ATP synthase subunit b Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8HAG7 2.09e-75 224 69 0 156 3 atpF ATP synthase subunit b Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q9KNH1 2.43e-74 222 68 0 156 3 atpF ATP synthase subunit b Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F475 2.43e-74 222 68 0 156 3 atpF ATP synthase subunit b Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B0TQF8 2.51e-74 222 69 0 156 3 atpF ATP synthase subunit b Shewanella halifaxensis (strain HAW-EB4)
Q12HP7 8.86e-74 220 67 0 156 3 atpF ATP synthase subunit b Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9KX10 3.09e-73 219 66 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS195)
A6WUJ4 3.09e-73 219 66 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS185)
A3DAR8 3.93e-73 219 66 0 156 3 atpF ATP synthase subunit b Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q7MGH6 4.89e-73 218 66 0 156 3 atpF ATP synthase subunit b Vibrio vulnificus (strain YJ016)
Q8DDH2 4.89e-73 218 66 0 156 3 atpF ATP synthase subunit b Vibrio vulnificus (strain CMCP6)
Q8E8B6 6.16e-73 218 66 0 156 3 atpF ATP synthase subunit b Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q07VU0 1.92e-72 217 66 0 156 3 atpF ATP synthase subunit b Shewanella frigidimarina (strain NCIMB 400)
Q6LLG4 1.65e-71 214 66 0 156 3 atpF ATP synthase subunit b Photobacterium profundum (strain SS9)
B5FCZ5 5.81e-71 213 67 0 154 3 atpF ATP synthase subunit b Aliivibrio fischeri (strain MJ11)
Q5E1N3 5.81e-71 213 67 0 154 3 atpF ATP synthase subunit b Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1T0Z3 7.72e-71 213 64 0 156 3 atpF ATP synthase subunit b Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B6EHU1 1.44e-70 212 66 0 156 3 atpF ATP synthase subunit b Aliivibrio salmonicida (strain LFI1238)
A7N0Y5 2.21e-69 209 70 0 156 3 atpF1 ATP synthase subunit b 1 Vibrio campbellii (strain ATCC BAA-1116)
Q15MU0 4.07e-69 209 64 0 156 3 atpF2 ATP synthase subunit b 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q87KA4 3.85e-68 206 69 0 156 3 atpF ATP synthase subunit b Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0L2T2 5.57e-67 203 67 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain ANA-3)
Q48AW4 7.82e-67 203 60 0 156 3 atpF ATP synthase subunit b Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P12989 1.46e-66 202 67 0 156 3 atpF ATP synthase subunit b Vibrio alginolyticus
A1SBU4 2.26e-66 202 66 0 156 3 atpF ATP synthase subunit b Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0HPF7 2.78e-66 201 67 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain MR-7)
Q0HD75 2.78e-66 201 67 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain MR-4)
A1RQB4 5.63e-64 196 66 0 156 3 atpF ATP synthase subunit b Shewanella sp. (strain W3-18-1)
A4YCI2 5.63e-64 196 66 0 156 3 atpF ATP synthase subunit b Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q5QZI2 3.51e-63 194 60 0 156 3 atpF ATP synthase subunit b Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3IK46 5.86e-63 193 59 0 156 3 atpF ATP synthase subunit b Pseudoalteromonas translucida (strain TAC 125)
B0BRX6 5.3e-60 186 59 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2P7 5.3e-60 186 59 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q7VPP4 1.91e-59 184 59 0 156 3 atpF ATP synthase subunit b Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q65Q03 2.25e-59 184 60 0 156 3 atpF ATP synthase subunit b Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1U7H8 2.86e-59 184 59 0 156 3 atpF ATP synthase subunit b Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A3N2U8 1.51e-58 182 58 0 156 3 atpF ATP synthase subunit b Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q1QSC6 5.4e-57 178 53 0 156 3 atpF ATP synthase subunit b Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q2S6N7 1.34e-56 177 53 0 156 3 atpF ATP synthase subunit b Hahella chejuensis (strain KCTC 2396)
Q4K3A5 5.55e-56 175 53 0 156 3 atpF ATP synthase subunit b Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZL20 1.3e-55 174 53 0 156 3 atpF ATP synthase subunit b Pseudomonas syringae pv. syringae (strain B728a)
Q88BX0 1.79e-55 174 52 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1I2I3 2.37e-55 174 51 0 156 3 atpF ATP synthase subunit b Pseudomonas entomophila (strain L48)
A6VL61 2.51e-55 174 60 0 156 3 atpF ATP synthase subunit b Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q48BG1 3.97e-55 173 53 0 156 3 atpF ATP synthase subunit b Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A5WBA7 9.63e-55 172 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q9CKW4 1.32e-54 172 60 0 156 3 atpF ATP synthase subunit b Pasteurella multocida (strain Pm70)
B1JFU5 1.43e-54 172 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain W619)
B0KRB2 1.43e-54 172 51 0 156 3 atpF ATP synthase subunit b Pseudomonas putida (strain GB-1)
Q1LTV0 1.66e-54 172 54 0 156 3 atpF ATP synthase subunit b Baumannia cicadellinicola subsp. Homalodisca coagulata
Q87TT0 1.86e-54 171 52 0 156 3 atpF ATP synthase subunit b Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q3K437 2.94e-54 171 51 0 156 3 atpF ATP synthase subunit b Pseudomonas fluorescens (strain Pf0-1)
A5UGZ3 2.97e-54 171 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain PittGG)
A5UA07 4.6e-54 171 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain PittEE)
P43720 7.6e-54 170 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN60 7.6e-54 170 60 0 156 3 atpF ATP synthase subunit b Haemophilus influenzae (strain 86-028NP)
A6VF36 3.88e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain PA7)
B3PIT1 4.57e-53 168 51 0 156 3 atpF ATP synthase subunit b Cellvibrio japonicus (strain Ueda107)
Q9HT16 4.67e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DF0 4.67e-53 168 51 0 156 3 atpF ATP synthase subunit b Pseudomonas aeruginosa (strain UCBPP-PA14)
Q0VKX0 1.25e-52 167 51 0 156 3 atpF ATP synthase subunit b Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A4Y191 1.3e-52 167 52 0 156 3 atpF ATP synthase subunit b Pseudomonas mendocina (strain ymp)
Q3SF62 2.3e-52 166 55 0 156 3 atpF ATP synthase subunit b Thiobacillus denitrificans (strain ATCC 25259)
A6W3T2 3.72e-52 166 52 0 156 3 atpF2 ATP synthase subunit b 2 Marinomonas sp. (strain MWYL1)
B0UWG9 9.53e-52 164 56 0 156 3 atpF ATP synthase subunit b Histophilus somni (strain 2336)
Q0I5W9 9.53e-52 164 56 0 156 3 atpF ATP synthase subunit b Histophilus somni (strain 129Pt)
Q494C7 2.1e-51 164 50 0 156 3 atpF ATP synthase subunit b Blochmanniella pennsylvanica (strain BPEN)
A4VS66 2.84e-51 163 52 0 156 3 atpF ATP synthase subunit b Stutzerimonas stutzeri (strain A1501)
Q1Q895 4.86e-51 163 52 0 156 3 atpF ATP synthase subunit b Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FQ33 1.05e-50 162 52 0 156 3 atpF ATP synthase subunit b Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6FFK4 3.15e-50 160 52 0 156 3 atpF ATP synthase subunit b Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1WZT5 7.98e-49 157 50 0 156 3 atpF ATP synthase subunit b Halorhodospira halophila (strain DSM 244 / SL1)
Q21DK4 4.54e-47 153 51 0 156 3 atpF ATP synthase subunit b Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A5WBV7 4.74e-47 152 51 0 156 3 atpF ATP synthase subunit b Psychrobacter sp. (strain PRwf-1)
Q0A4M4 1.37e-46 151 46 0 156 3 atpF ATP synthase subunit b Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1GXM6 6.1e-46 150 48 0 156 3 atpF ATP synthase subunit b Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q60CR8 1.2e-45 149 45 0 156 3 atpF1 ATP synthase subunit b 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q82XQ2 1.59e-45 149 50 0 156 3 atpF ATP synthase subunit b Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P57120 2.57e-44 146 44 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q0AJB4 7.32e-44 145 49 0 156 3 atpF ATP synthase subunit b Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
A7N2U5 1.41e-43 144 41 0 156 3 atpF2 ATP synthase subunit b 2 Vibrio campbellii (strain ATCC BAA-1116)
Q83AF9 2.33e-43 143 43 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NBC6 2.33e-43 143 43 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KBG1 2.33e-43 143 43 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain Dugway 5J108-111)
B6J2D6 2.33e-43 143 43 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain CbuG_Q212)
B6J959 2.33e-43 143 43 0 156 3 atpF ATP synthase subunit b Coxiella burnetii (strain CbuK_Q154)
Q477Z5 1.28e-42 141 45 0 156 3 atpF ATP synthase subunit b Dechloromonas aromatica (strain RCB)
B0VBP7 1.41e-42 141 53 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AYE)
A3M140 1.41e-42 141 53 0 156 1 atpF ATP synthase subunit b Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I0Z8 1.41e-42 141 53 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain ACICU)
B7I1W0 1.41e-42 141 53 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AB0057)
B7H298 1.41e-42 141 53 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain AB307-0294)
Q31DL6 2.3e-42 141 48 0 153 3 atpF ATP synthase subunit b Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B0VNK0 6.56e-42 140 52 0 156 3 atpF ATP synthase subunit b Acinetobacter baumannii (strain SDF)
Q5WSG4 2.13e-41 138 48 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Lens)
Q5ZR97 2.13e-41 138 48 0 156 3 atpF ATP synthase subunit b Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5III7 2.13e-41 138 48 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Corby)
Q5X0N9 2.13e-41 138 48 0 156 3 atpF ATP synthase subunit b Legionella pneumophila (strain Paris)
Q2YCA7 2.56e-41 138 50 0 156 3 atpF1 ATP synthase subunit b 1 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B2JJK3 2.74e-41 138 45 0 156 3 atpF ATP synthase subunit b Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q89B43 6.26e-41 137 42 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B4SJS3 7.87e-41 137 46 0 156 3 atpF ATP synthase subunit b Stenotrophomonas maltophilia (strain R551-3)
Q7VQW0 9.76e-41 137 42 0 156 3 atpF ATP synthase subunit b Blochmanniella floridana
B2FHZ2 1.06e-40 137 46 0 156 3 atpF ATP synthase subunit b Stenotrophomonas maltophilia (strain K279a)
B2T7K4 2.67e-40 135 44 0 156 3 atpF ATP synthase subunit b Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q13SP8 4.5e-40 135 43 0 156 3 atpF ATP synthase subunit b Paraburkholderia xenovorans (strain LB400)
Q3BP11 7.16e-39 132 45 0 156 3 atpF ATP synthase subunit b Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PGG3 7.16e-39 132 45 0 156 3 atpF ATP synthase subunit b Xanthomonas axonopodis pv. citri (strain 306)
Q5H4Y8 7.32e-39 132 45 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SQB4 7.32e-39 132 45 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P7Q8 7.32e-39 132 45 0 156 3 atpF ATP synthase subunit b Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q12GQ4 7.65e-39 132 42 0 156 3 atpF ATP synthase subunit b Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8PCZ9 1.36e-38 131 45 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWC6 1.36e-38 131 45 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain B100)
Q4UQF0 1.36e-38 131 45 0 156 3 atpF ATP synthase subunit b Xanthomonas campestris pv. campestris (strain 8004)
A4JA31 2.56e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q1BRA6 4.09e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia orbicola (strain AU 1054)
B1JSV3 4.09e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia orbicola (strain MC0-3)
B4EEY5 4.09e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0K2X9 4.09e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia cenocepacia (strain HI2424)
Q0BJL9 4.46e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YQL0 4.46e-38 130 43 0 156 3 atpF ATP synthase subunit b Burkholderia ambifaria (strain MC40-6)
Q39KY0 8.39e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2STE5 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63PH6 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain K96243)
A3NF44 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 668)
Q3JXV4 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 1710b)
A3P0Z4 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia pseudomallei (strain 1106a)
A1V8T5 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain SAVP1)
Q62FR9 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain ATCC 23344)
A2S6K2 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain NCTC 10229)
A3MQJ5 9.26e-38 129 42 0 156 3 atpF ATP synthase subunit b Burkholderia mallei (strain NCTC 10247)
A9AJG0 2.44e-37 128 42 0 156 3 atpF ATP synthase subunit b Burkholderia multivorans (strain ATCC 17616 / 249)
O51876 3.33e-37 128 41 0 156 3 atpF ATP synthase subunit b Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1LHK6 2.2e-36 125 43 2 157 3 atpF ATP synthase subunit b Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0K5M3 2.35e-36 125 43 2 157 3 atpF ATP synthase subunit b Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B3R7L9 3.62e-36 125 43 2 157 3 atpF ATP synthase subunit b Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46VX6 3.79e-36 125 43 2 157 3 atpF ATP synthase subunit b Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q223D2 8.02e-36 124 41 0 156 3 atpF1 ATP synthase subunit b 1 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q3J6M7 1.27e-35 124 44 0 156 3 atpF ATP synthase subunit b Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B2UGV3 1.4e-35 124 41 0 156 3 atpF ATP synthase subunit b Ralstonia pickettii (strain 12J)
Q8XU72 6.54e-35 122 41 0 156 3 atpF ATP synthase subunit b 1 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8D3J7 8.42e-35 122 35 0 156 3 atpF ATP synthase subunit b Wigglesworthia glossinidia brevipalpis
A4SUT0 1.03e-34 121 42 0 156 3 atpF ATP synthase subunit b Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B0U5A2 1.82e-34 120 42 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain M12)
A2SC66 1.86e-34 120 42 0 156 3 atpF ATP synthase subunit b Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
B5ER46 2.38e-34 120 37 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JB88 2.38e-34 120 37 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A9BPU3 3.69e-34 120 44 0 156 3 atpF ATP synthase subunit b Delftia acidovorans (strain DSM 14801 / SPH-1)
P41172 4.29e-34 120 37 0 156 3 atpF ATP synthase subunit b Acidithiobacillus ferridurans
Q9PE81 4.73e-34 120 42 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain 9a5c)
A1KW15 4.84e-34 120 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7DD66 4.84e-34 120 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1IPX1 4.84e-34 120 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A9M119 4.84e-34 120 42 0 156 3 atpF ATP synthase subunit b Neisseria meningitidis serogroup C (strain 053442)
B4RJF6 6.21e-34 119 43 0 156 3 atpF ATP synthase subunit b Neisseria gonorrhoeae (strain NCCP11945)
Q5F4Z4 6.21e-34 119 43 0 156 3 atpF ATP synthase subunit b Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B0TWS3 6.35e-34 119 40 0 153 3 atpF ATP synthase subunit b Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A4GAH3 1.01e-33 119 46 0 156 3 atpF ATP synthase subunit b Herminiimonas arsenicoxydans
A1WF54 3.89e-33 117 43 0 156 3 atpF ATP synthase subunit b Verminephrobacter eiseniae (strain EF01-2)
Q7W3A6 4.2e-33 117 49 0 156 3 atpF ATP synthase subunit b Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEM5 4.2e-33 117 49 0 156 3 atpF ATP synthase subunit b Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1W2T3 5e-33 117 44 0 156 3 atpF ATP synthase subunit b Acidovorax sp. (strain JS42)
Q7VU48 8.24e-33 116 49 0 156 3 atpF ATP synthase subunit b Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A1VIU8 1.07e-32 116 41 0 156 3 atpF ATP synthase subunit b Polaromonas naphthalenivorans (strain CJ2)
A1TJ37 2.29e-32 115 42 0 156 3 atpF ATP synthase subunit b Paracidovorax citrulli (strain AAC00-1)
B1XSD0 6.92e-32 114 41 0 156 3 atpF ATP synthase subunit b Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A1AXU6 1.28e-31 114 36 0 156 3 atpF ATP synthase subunit b Ruthia magnifica subsp. Calyptogena magnifica
A9HY36 1.48e-31 113 48 0 156 3 atpF ATP synthase subunit b Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A5CVF9 2.39e-30 110 37 0 152 3 atpF ATP synthase subunit b Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A6T474 2.29e-29 108 44 0 156 3 atpF ATP synthase subunit b Janthinobacterium sp. (strain Marseille)
A4IW20 1.18e-28 106 40 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIK7 2.16e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
A0Q8E3 2.16e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. novicida (strain U112)
B2SEX7 2.16e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. mediasiatica (strain FSC147)
Q14K10 2.16e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BK80 3.48e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1H8 3.48e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain LVS)
A7NEH8 3.48e-28 105 39 0 153 3 atpF ATP synthase subunit b Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q87E86 8.19e-28 103 42 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I864 8.19e-28 103 42 0 156 3 atpF ATP synthase subunit b Xylella fastidiosa (strain M23)
A5EXJ9 1.3e-27 103 34 0 153 3 atpF ATP synthase subunit b Dichelobacter nodosus (strain VCS1703A)
Q5P4E6 1.56e-26 100 44 0 156 3 atpF ATP synthase subunit b Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1K1R8 9.39e-26 99 44 0 156 3 atpF ATP synthase subunit b Azoarcus sp. (strain BH72)
B4SH38 1.06e-21 89 38 2 154 3 atpF ATP synthase subunit b Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A0M6G6 4.74e-21 87 34 0 136 3 atpF ATP synthase subunit b Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
B4S6E4 1.37e-20 85 35 2 154 3 atpF2 ATP synthase subunit b 2 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B3EQ96 2.25e-20 85 32 0 150 3 atpF ATP synthase subunit b Chlorobium phaeobacteroides (strain BS1)
A4SGZ0 2.91e-20 85 35 2 156 3 atpF ATP synthase subunit b Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q3B143 1.34e-18 80 35 2 154 3 atpF2 ATP synthase subunit b 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3ANW4 1.76e-18 80 36 3 154 3 atpF ATP synthase subunit b Chlorobium chlorochromatii (strain CaD3)
B3QLV1 2.13e-18 80 32 0 150 3 atpF ATP synthase subunit b Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B3EIJ6 2.24e-18 80 32 0 152 3 atpF ATP synthase subunit b Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B2A3G6 3.61e-18 79 32 1 155 3 atpF ATP synthase subunit b Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q24MN7 1.81e-17 77 31 0 156 3 atpF ATP synthase subunit b Desulfitobacterium hafniense (strain Y51)
A6H2D9 2.13e-17 77 33 1 147 3 atpF ATP synthase subunit b Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B0TI54 2.59e-17 77 30 0 156 3 atpF ATP synthase subunit b Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A1A3C9 4.46e-17 77 31 1 151 3 atpF ATP synthase subunit b Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A4ITJ3 6.2e-17 76 29 2 157 3 atpF ATP synthase subunit b Geobacillus thermodenitrificans (strain NG80-2)
Q8KGE9 6.27e-17 76 33 3 161 3 atpF ATP synthase subunit b Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q5KUI9 2.17e-16 75 33 3 154 3 atpF ATP synthase subunit b Geobacillus kaustophilus (strain HTA426)
Q11YP3 2.37e-16 74 30 1 149 3 atpF ATP synthase subunit b Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A6TK61 2.8e-16 74 31 1 148 3 atpF ATP synthase subunit b Alkaliphilus metalliredigens (strain QYMF)
A8F3J8 3.43e-16 74 30 0 147 3 atpF ATP synthase subunit b Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A5FL32 4.57e-16 73 32 1 135 3 atpF ATP synthase subunit b Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q5WB74 7.36e-16 73 34 2 153 3 atpF ATP synthase subunit b Shouchella clausii (strain KSM-K16)
A5CYE6 1.06e-15 73 29 2 159 3 atpF ATP synthase subunit b Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1LBC3 2.04e-15 72 30 1 156 3 atpF ATP synthase subunit b Thermotoga sp. (strain RQ2)
A5ILW8 2.04e-15 72 30 1 156 3 atpF ATP synthase subunit b Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X1U9 2.04e-15 72 30 1 156 3 atpF ATP synthase subunit b Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A1BJW4 2.38e-15 72 31 0 152 3 atpF ATP synthase subunit b Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
P22481 8.28e-15 70 33 3 156 3 atpF ATP synthase subunit b Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
A7HJW1 1.91e-14 69 28 0 153 3 atpF ATP synthase subunit b Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A6L4M2 3.83e-14 68 29 1 154 3 atpF ATP synthase subunit b Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q8CNJ3 5.63e-14 68 27 2 155 3 atpF ATP synthase subunit b Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HMB5 5.63e-14 68 27 2 155 3 atpF ATP synthase subunit b Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P41014 6.88e-14 68 30 2 143 3 atpF ATP synthase subunit b Bacillus caldotenax
A8MJW3 7.14e-14 68 26 0 153 3 atpF ATP synthase subunit b Alkaliphilus oremlandii (strain OhILAs)
Q9K4D7 7.91e-14 68 33 1 146 3 atpF ATP synthase subunit b Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P21904 1.18e-13 67 29 0 156 1 atpF ATP synthase subunit b, sodium ion specific Propionigenium modestum
P09221 1.32e-13 67 34 4 146 1 atpF ATP synthase subunit b Bacillus sp. (strain PS3)
A1SHI7 1.36e-13 68 30 1 146 3 atpF ATP synthase subunit b Nocardioides sp. (strain ATCC BAA-499 / JS614)
Q7A0C4 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MW2)
A8YY74 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain USA300 / TCH1516)
Q6G7K3 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MSSA476)
Q7A4E7 1.57e-13 67 27 2 155 1 atpF ATP synthase subunit b Staphylococcus aureus (strain N315)
Q99SF1 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QIV1 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Newman)
Q5HE93 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain COL)
Q2YUJ7 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IUQ2 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain JH9)
Q2G2F8 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF20 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain USA300)
A6U3J2 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain JH1)
A7X4U9 1.57e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GEW8 1.73e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus aureus (strain MRSA252)
Q6AG62 2.38e-13 67 31 1 153 3 atpF ATP synthase subunit b Leifsonia xyli subsp. xyli (strain CTCB07)
Q4L7Y8 2.82e-13 67 27 2 155 3 atpF ATP synthase subunit b Staphylococcus haemolyticus (strain JCSC1435)
B3QZF0 2.98e-13 67 34 2 161 3 atpF ATP synthase subunit b Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
B3DTV4 3.86e-13 66 30 1 151 3 atpF ATP synthase subunit b Bifidobacterium longum (strain DJO10A)
Q8G7A9 3.89e-13 66 30 1 151 3 atpF ATP synthase subunit b Bifidobacterium longum (strain NCC 2705)
B3EU96 8.81e-13 65 29 3 153 3 atpF ATP synthase subunit b Amoebophilus asiaticus (strain 5a2)
A4J9A3 8.91e-13 65 27 0 155 3 atpF ATP synthase subunit b Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8EM79 1.18e-12 65 33 2 135 3 atpF ATP synthase subunit b Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1W0A7 1.77e-12 65 32 2 152 3 atpF ATP synthase subunit b Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q9K6H1 3.9e-12 63 34 5 158 3 atpF ATP synthase subunit b Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P95785 5.77e-12 63 28 3 162 3 atpF ATP synthase subunit b Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q814V8 8.34e-12 62 30 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HFK6 8.34e-12 62 30 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain B4264)
B3WDL4 9.92e-12 62 27 3 160 3 atpF ATP synthase subunit b Lacticaseibacillus casei (strain BL23)
P50013 1.05e-11 62 32 2 146 3 atpF ATP synthase subunit b Streptomyces lividans
Q82J80 1.29e-11 62 32 2 144 3 atpF ATP synthase subunit b Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q927W0 1.57e-11 62 26 4 164 3 atpF ATP synthase subunit b Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8E076 1.59e-11 62 30 5 165 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5V2 1.59e-11 62 30 5 165 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype III (strain NEM316)
Q3K1J9 1.59e-11 62 30 5 165 3 atpF ATP synthase subunit b Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q49Z54 1.64e-11 62 26 2 155 3 atpF ATP synthase subunit b Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B7HY69 1.72e-11 62 29 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain AH187)
Q72XE4 1.72e-11 62 29 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HAX5 1.87e-11 62 30 1 159 3 atpF ATP synthase subunit b Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q630T9 1.87e-11 62 30 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain ZK / E33L)
B7JGN4 1.87e-11 62 30 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain AH820)
Q81JZ1 1.87e-11 62 30 1 159 3 atpF ATP synthase subunit b Bacillus anthracis
A0RL99 1.87e-11 62 30 1 159 3 atpF ATP synthase subunit b Bacillus thuringiensis (strain Al Hakam)
A9VSA7 1.97e-11 62 28 1 159 3 atpF ATP synthase subunit b Bacillus mycoides (strain KBAB4)
A4VVK3 2.05e-11 62 30 5 165 3 atpF ATP synthase subunit b Streptococcus suis (strain 05ZYH33)
A4W1W1 2.05e-11 62 30 5 165 3 atpF ATP synthase subunit b Streptococcus suis (strain 98HAH33)
B4UJU5 2.21e-11 62 28 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter sp. (strain K)
B7IQW2 2.58e-11 61 29 1 159 3 atpF ATP synthase subunit b Bacillus cereus (strain G9842)
Q2RFX5 2.64e-11 61 30 3 145 1 atpF ATP synthase subunit b Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A3CM10 2.72e-11 61 30 6 166 3 atpF ATP synthase subunit b Streptococcus sanguinis (strain SK36)
B1HM52 2.79e-11 61 25 0 151 3 atpF ATP synthase subunit b Lysinibacillus sphaericus (strain C3-41)
A8AYG5 2.84e-11 61 27 4 165 3 atpF ATP synthase subunit b Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q71WP5 3.06e-11 61 26 4 164 3 atpF ATP synthase subunit b Listeria monocytogenes serotype 4b (strain F2365)
Q2ST38 3.22e-11 61 27 4 155 3 atpF ATP synthase subunit b Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
A9HDM4 3.85e-11 61 31 2 155 3 atpF ATP synthase subunit b Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A0ALL7 4.32e-11 61 26 4 164 3 atpF ATP synthase subunit b Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8RGD8 4.96e-11 60 28 0 156 3 atpF ATP synthase subunit b Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q03A22 5.94e-11 60 27 3 160 3 atpF ATP synthase subunit b Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8Y4B8 6.1e-11 60 27 6 166 3 atpF ATP synthase subunit b Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q67TC1 6.26e-11 60 30 0 150 3 atpF ATP synthase subunit b Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q6MS90 6.32e-11 60 27 4 155 3 atpF ATP synthase subunit b Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q03LX7 7.41e-11 60 27 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5J5 7.41e-11 60 27 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M108 7.41e-11 60 27 4 169 3 atpF ATP synthase subunit b Streptococcus thermophilus (strain CNRZ 1066)
A4XKX4 7.85e-11 60 29 2 148 3 atpF ATP synthase subunit b Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q4JUJ6 8.5e-11 60 27 1 151 3 atpF ATP synthase subunit b Corynebacterium jeikeium (strain K411)
B1ZWP0 8.63e-11 60 29 0 130 3 atpF ATP synthase subunit b Opitutus terrae (strain DSM 11246 / JCM 15787 / PB90-1)
B1I6L8 9.58e-11 60 31 3 160 3 atpF ATP synthase subunit b Desulforudis audaxviator (strain MP104C)
Q03EL0 1.27e-10 59 26 2 156 3 atpF ATP synthase subunit b Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A5CQ56 1.31e-10 60 34 1 135 3 atpF ATP synthase subunit b Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B3E0Z6 1.39e-10 59 27 3 151 3 atpF ATP synthase subunit b Methylacidiphilum infernorum (isolate V4)
Q02XA1 1.54e-10 59 30 5 160 3 atpF ATP synthase subunit b Lactococcus lactis subsp. cremoris (strain SK11)
P0A2Z1 1.54e-10 59 30 5 160 3 atpF ATP synthase subunit b Lactococcus lactis subsp. cremoris (strain MG1363)
P0A2Z0 1.54e-10 59 30 5 160 3 atpF ATP synthase subunit b Lactococcus lactis subsp. lactis (strain IL1403)
Q04G24 1.7e-10 59 28 4 152 3 atpF ATP synthase subunit b Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q3A942 2.01e-10 58 32 2 144 3 atpF ATP synthase subunit b Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A4T8J9 2.04e-10 61 29 1 153 3 atpFH ATP synthase subunit b-delta Mycolicibacterium gilvum (strain PYR-GCK)
A0JY68 2.25e-10 59 31 1 145 3 atpF ATP synthase subunit b Arthrobacter sp. (strain FB24)
Q2IHP6 2.38e-10 59 27 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter dehalogenans (strain 2CP-C)
Q1B550 2.55e-10 60 27 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain MCS)
A1UJY7 2.55e-10 60 27 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain KMS)
A3Q3B4 2.55e-10 60 27 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium sp. (strain JLS)
A6W7G5 2.67e-10 59 33 1 135 3 atpF ATP synthase subunit b Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q1WUD0 2.78e-10 58 28 2 149 3 atpF ATP synthase subunit b Ligilactobacillus salivarius (strain UCC118)
A9WNC4 3.05e-10 58 32 1 146 3 atpF ATP synthase subunit b Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q6A8C3 3.13e-10 58 29 2 164 3 atpF ATP synthase subunit b Cutibacterium acnes (strain DSM 16379 / KPA171202)
A8YUJ7 3.3e-10 58 31 5 167 3 atpF ATP synthase subunit b Lactobacillus helveticus (strain DPC 4571)
Q8KRV2 3.64e-10 58 28 3 156 1 atpF ATP synthase subunit b, sodium ion specific Ilyobacter tartaricus
Q74K19 3.87e-10 58 31 2 144 3 atpF ATP synthase subunit b Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A7GV60 4.82e-10 58 28 2 156 3 atpF ATP synthase subunit b Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q04BA7 6.06e-10 57 32 4 156 3 atpF ATP synthase subunit b Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAW9 6.06e-10 57 32 4 156 3 atpF ATP synthase subunit b Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A9KK96 6.26e-10 58 27 4 158 3 atpF ATP synthase subunit b Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A0Q2Z8 1.05e-09 57 27 6 163 3 atpF ATP synthase subunit b Clostridium novyi (strain NT)
Q0ZS23 1.18e-09 57 22 0 156 1 atpF ATP synthase subunit b, sodium ion specific Clostridium paradoxum
Q0AUC9 1.7e-09 57 26 0 145 3 atpF ATP synthase subunit b Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B6YR08 1.83e-09 56 23 1 153 3 atpF ATP synthase subunit b Azobacteroides pseudotrichonymphae genomovar. CFP2
A9AVV0 1.89e-09 56 23 2 154 3 atpF ATP synthase subunit b Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
P20601 2e-09 56 26 0 153 3 atpF ATP synthase subunit b Priestia megaterium (strain ATCC 12872 / QMB1551)
A6L8N7 2.14e-09 56 26 1 154 3 atpF ATP synthase subunit b Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A3DIM5 2.43e-09 56 25 2 154 3 atpF ATP synthase subunit b Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
P0A2Z3 2.55e-09 56 25 0 144 1 atpF ATP synthase subunit b Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IQX4 2.55e-09 56 25 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae (strain CGSP14)
P0A2Z2 2.55e-09 56 25 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B1ICT3 2.55e-09 56 25 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae (strain Hungary19A-6)
B5E675 2.55e-09 56 25 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 19F (strain G54)
Q04HT5 2.55e-09 56 25 0 144 3 atpF ATP synthase subunit b Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A6LQH2 3.38e-09 55 26 1 157 3 atpF ATP synthase subunit b Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B0RED8 3.74e-09 56 33 1 135 3 atpF ATP synthase subunit b Clavibacter sepedonicus
O05098 3.91e-09 55 22 1 157 3 atpF ATP synthase subunit b Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q1AVH5 3.94e-09 55 25 0 153 3 atpF ATP synthase subunit b Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q042L1 4.61e-09 55 31 2 144 3 atpF ATP synthase subunit b Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q9RGY5 5.87e-09 55 30 5 167 2 atpF ATP synthase subunit b Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A1TD58 7.15e-09 56 33 6 156 3 atpFH ATP synthase subunit b-delta Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q65DX0 8.54e-09 55 32 4 160 3 atpF ATP synthase subunit b Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A7HIW7 9.4e-09 55 28 0 149 3 atpF ATP synthase subunit b Anaeromyxobacter sp. (strain Fw109-5)
Q5Z0Y5 1.41e-08 54 32 1 136 3 atpF ATP synthase subunit b Nocardia farcinica (strain IFM 10152)
A9BFX7 1.63e-08 53 23 0 156 3 atpF ATP synthase subunit b Petrotoga mobilis (strain DSM 10674 / SJ95)
A8L3W1 2.11e-08 54 27 1 146 3 atpF ATP synthase subunit b Parafrankia sp. (strain EAN1pec)
Q2S434 2.48e-08 53 32 0 144 3 atpF ATP synthase subunit b Salinibacter ruber (strain DSM 13855 / M31)
B2KEW8 2.65e-08 53 29 3 141 3 atpF ATP synthase subunit b Elusimicrobium minutum (strain Pei191)
B1MLV9 2.91e-08 55 29 3 155 3 atpFH ATP synthase subunit b-delta Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q8FQ24 3.53e-08 53 27 1 151 3 atpF ATP synthase subunit b Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A0R204 3.88e-08 53 26 0 142 1 atpF ATP synthase subunit b Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q3B400 3.99e-08 54 27 2 144 3 atpF1 ATP synthase subunit b 1 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8A9U9 4.03e-08 53 30 7 168 3 atpF ATP synthase subunit b Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q831A1 4.39e-08 53 25 1 156 3 atpF ATP synthase subunit b Enterococcus faecalis (strain ATCC 700802 / V583)
A0LDW8 4.4e-08 53 31 2 158 3 atpF ATP synthase subunit b Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A9WGS8 4.5e-08 52 29 4 141 3 atpF ATP synthase subunit b Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
B2GLY6 5.31e-08 52 28 2 152 3 atpF ATP synthase subunit b Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A8Z5R3 5.44e-08 53 28 1 149 3 atpF ATP synthase subunit b Karelsulcia muelleri (strain GWSS)
B0SLC4 5.75e-08 52 26 0 152 3 atpF ATP synthase subunit b Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDA1 5.75e-08 52 26 0 152 3 atpF ATP synthase subunit b Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
A6LJR5 6.69e-08 52 28 0 153 3 atpF ATP synthase subunit b Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q64UA6 6.82e-08 52 25 1 154 3 atpF ATP synthase subunit b Bacteroides fragilis (strain YCH46)
Q5LD84 6.82e-08 52 25 1 154 3 atpF ATP synthase subunit b Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
B2G687 8e-08 52 24 2 149 3 atpF ATP synthase subunit b Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIQ7 8e-08 52 24 2 149 3 atpF ATP synthase subunit b Limosilactobacillus reuteri (strain DSM 20016)
A5IYE1 8.35e-08 52 25 2 148 3 atpF ATP synthase subunit b Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
A1R7V6 8.63e-08 52 31 1 146 3 atpF ATP synthase subunit b Paenarthrobacter aurescens (strain TC1)
Q0SGP5 1.15e-07 52 30 1 151 3 atpF ATP synthase subunit b Rhodococcus jostii (strain RHA1)
B2HQK6 1.21e-07 52 25 0 133 3 atpF ATP synthase subunit b Mycobacterium marinum (strain ATCC BAA-535 / M)
A7NIR3 1.49e-07 51 28 2 153 3 atpF ATP synthase subunit b Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q4G3A0 1.58e-07 51 28 3 142 3 atpF2 ATP synthase subunit b', chloroplastic Emiliania huxleyi
A7Z9Q4 1.64e-07 51 33 4 136 3 atpF ATP synthase subunit b Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q88UT9 1.65e-07 51 27 4 158 3 atpF ATP synthase subunit b Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P37814 1.76e-07 51 33 4 136 1 atpF ATP synthase subunit b Bacillus subtilis (strain 168)
B1YMR8 1.93e-07 51 27 3 136 3 atpF ATP synthase subunit b Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q03QY4 2.92e-07 50 27 4 133 3 atpF ATP synthase subunit b Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q0RDB0 3.16e-07 51 29 2 155 3 atpF ATP synthase subunit b Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
P9WPV5 3.26e-07 50 25 1 129 1 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPV4 3.26e-07 50 25 1 129 3 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U205 3.26e-07 50 25 1 129 3 atpF ATP synthase subunit b Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KI94 3.26e-07 50 25 1 129 3 atpF ATP synthase subunit b Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P63657 3.26e-07 50 25 1 129 3 atpF ATP synthase subunit b Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B2GAU1 3.47e-07 50 24 2 154 3 atpF ATP synthase subunit b Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q6MAK3 5.18e-07 50 26 0 150 3 atpF ATP synthase subunit b Protochlamydia amoebophila (strain UWE25)
A4XAW6 9.86e-07 49 32 1 146 3 atpF ATP synthase subunit b Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
B0JWU9 1.01e-06 49 26 1 157 3 atpF ATP synthase subunit b Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
A5UQN7 1.11e-06 48 28 2 153 3 atpF ATP synthase subunit b Roseiflexus sp. (strain RS-1)
P80285 1.12e-06 49 31 1 151 1 atpF ATP synthase subunit b Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
B4S7A0 1.3e-06 49 28 3 118 3 atpF1 ATP synthase subunit b 1 Prosthecochloris aestuarii (strain DSM 271 / SK 413)
A8FIB6 1.51e-06 48 31 2 132 3 atpF ATP synthase subunit b Bacillus pumilus (strain SAFR-032)
P47643 1.68e-06 49 21 0 150 3 atpF ATP synthase subunit b Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A0PUK4 1.76e-06 48 24 0 133 3 atpF ATP synthase subunit b Mycobacterium ulcerans (strain Agy99)
A8M2J7 2.14e-06 48 30 1 146 3 atpF ATP synthase subunit b Salinispora arenicola (strain CNS-205)
Q47M78 2.59e-06 48 27 2 157 3 atpF ATP synthase subunit b Thermobifida fusca (strain YX)
A0LLG2 2.59e-06 48 32 4 150 3 atpF ATP synthase subunit b Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q9PR09 2.94e-06 48 25 0 150 3 atpF ATP synthase subunit b Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIC4 2.94e-06 48 25 0 150 3 atpF ATP synthase subunit b Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
A6VWQ5 3.48e-06 48 29 3 118 3 atpF1 ATP synthase subunit b 1 Marinomonas sp. (strain MWYL1)
P26681 4.22e-06 47 23 3 158 3 atpF ATP synthase subunit b Enterococcus hirae (strain ATCC 9790 / DSM 20160 / JCM 8729 / LMG 6399 / NBRC 3181 / NCIMB 6459 / NCDO 1258 / NCTC 12367 / WDCM 00089 / R)
Q3Z8Z6 4.87e-06 47 24 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q7UFB9 4.98e-06 48 29 4 130 3 atpF2 ATP synthase subunit b 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B4U2D7 5.17e-06 47 24 2 148 3 atpF ATP synthase subunit b Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B1WXB2 5.94e-06 47 25 2 133 3 atpF3 ATP synthase subunit b 2 Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q98QU1 5.97e-06 47 26 4 150 3 atpF ATP synthase subunit b Mycoplasmopsis pulmonis (strain UAB CTIP)
Q79VG9 7.43e-06 47 25 1 151 3 atpF ATP synthase subunit b Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDG9 7.66e-06 47 25 1 151 3 atpF ATP synthase subunit b Corynebacterium glutamicum (strain R)
Q3ZZU1 8.83e-06 46 24 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain CBDB1)
A5FRQ1 8.83e-06 46 24 0 148 3 atpF ATP synthase subunit b Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B2J056 9.43e-06 47 30 3 147 3 atpF ATP synthase subunit b Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B1VFY3 9.55e-06 47 27 1 151 3 atpF ATP synthase subunit b Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A1TD59 1.01e-05 46 24 0 142 3 atpF ATP synthase subunit b Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8EWZ2 1.2e-05 46 26 5 165 3 atpF ATP synthase subunit b Malacoplasma penetrans (strain HF-2)
A9NGW6 1.51e-05 46 24 2 153 3 atpF ATP synthase subunit b Acholeplasma laidlawii (strain PG-8A)
A8G6V4 1.69e-05 45 25 0 123 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9215)
A5FVI8 1.73e-05 46 28 6 169 3 atpF2 ATP synthase subunit b 2 Acidiphilium cryptum (strain JF-5)
Q7V034 1.76e-05 45 25 1 142 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q38WK1 2.08e-05 45 24 3 150 3 atpF ATP synthase subunit b Latilactobacillus sakei subsp. sakei (strain 23K)
Q48UD7 2.35e-05 45 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1J7G3 2.35e-05 45 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JMJ3 2.35e-05 45 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JCL7 2.35e-05 45 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q7NCS0 2.4e-05 45 30 6 152 3 atpF2 ATP synthase subunit b' Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
P9WPV2 2.5e-05 46 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WPV3 2.57e-05 46 26 1 153 1 atpFH ATP synthase subunit b-delta Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A5U206 2.57e-05 46 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AMV1 2.57e-05 46 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KI95 2.57e-05 46 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A501 2.57e-05 46 26 1 153 3 atpFH ATP synthase subunit b-delta Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q2J6M9 2.73e-05 45 27 2 155 3 atpF ATP synthase subunit b Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A4T8K9 2.92e-05 45 24 0 133 3 atpF ATP synthase subunit b Mycolicibacterium gilvum (strain PYR-GCK)
A7G9Q5 3.38e-05 45 22 2 134 3 atpF ATP synthase subunit b Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IE30 3.38e-05 45 22 2 134 3 atpF ATP synthase subunit b Clostridium botulinum (strain Okra / Type B1)
B5XKP7 3.55e-05 45 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M49 (strain NZ131)
A3PEU2 3.92e-05 44 24 1 142 3 atpF2 ATP synthase subunit b' Prochlorococcus marinus (strain MIT 9301)
A5HY48 3.97e-05 44 22 2 134 3 atpF ATP synthase subunit b Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FQH5 3.97e-05 44 22 2 134 3 atpF ATP synthase subunit b Clostridium botulinum (strain ATCC 19397 / Type A)
B1KSS4 4.35e-05 44 22 2 134 3 atpF ATP synthase subunit b Clostridium botulinum (strain Loch Maree / Type A3)
Q180X1 4.57e-05 44 24 0 129 3 atpF ATP synthase subunit b Clostridioides difficile (strain 630)
Q9A0J1 4.85e-05 44 24 3 155 3 atpF ATP synthase subunit b Streptococcus pyogenes serotype M1
P08447 5.12e-05 44 31 7 166 3 atpF ATP synthase subunit b Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RF3 5.12e-05 44 31 7 166 3 atpF ATP synthase subunit b Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q21ZA0 5.42e-05 45 30 2 116 3 atpF2 ATP synthase subunit b 2 Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
P53006 5.95e-05 45 25 3 154 3 atpFH ATP synthase subunit b-delta Mycobacterium leprae (strain TN)
B8ZR39 5.95e-05 45 25 3 154 3 atpFH ATP synthase subunit b-delta Mycobacterium leprae (strain Br4923)
Q40608 5.97e-05 44 26 0 138 3 atpF2 ATP synthase subunit b', chloroplastic Ochrosphaera neapolitana
B2TJZ6 6.25e-05 44 20 0 152 3 atpF ATP synthase subunit b Clostridium botulinum (strain Eklund 17B / Type B)
B2UZJ6 6.25e-05 44 20 0 152 3 atpF ATP synthase subunit b Clostridium botulinum (strain Alaska E43 / Type E3)
B1XHZ1 6.52e-05 44 33 5 141 3 atpF2 ATP synthase subunit b' Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS17670
Feature type CDS
Gene atpF
Product F0F1 ATP synthase subunit B
Location 176323 - 176793 (strand: -1)
Length 471 (nucleotides) / 156 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000007
Length 196482 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2107
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00430 ATP synthase B/B' CF(0)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0711 Energy production and conversion (C) C FoF1-type ATP synthase, membrane subunit b or b'

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02109 F-type H+-transporting ATPase subunit b Oxidative phosphorylation
Photosynthesis
Metabolic pathways
F-type ATPase, prokaryotes and chloroplasts

Protein Sequence

MNLNATILGQAIAFVLFVLFCMKFVWPPIMAAIEKRQKEIADGLSSAERAKKDLDLAQANATDQMKKAKAEASALIDQANKQRAQIIDEAKAEAEVERSKIVAQAQAEIDAERKRAREELRKQVAILAVAGAEKIIERTVDEAANSDIVDKLVAEL

Flanking regions ( +/- flanking 50bp)

CTTCACCCTGATATTTACATCAACTCAATTAACAAAAGAGGTATTGTGCTGTGAATCTTAACGCAACAATCCTCGGCCAGGCCATCGCGTTTGTCCTGTTTGTTTTGTTCTGTATGAAGTTTGTATGGCCACCGATTATGGCGGCCATTGAAAAGCGTCAAAAAGAAATTGCTGACGGTTTATCTTCCGCAGAACGTGCTAAAAAGGACCTGGACTTAGCGCAAGCCAATGCGACCGACCAAATGAAAAAAGCGAAAGCGGAAGCATCTGCCCTCATCGATCAAGCGAATAAACAACGCGCTCAGATTATCGATGAAGCAAAAGCAGAAGCGGAAGTTGAGCGTAGCAAAATCGTTGCTCAGGCACAGGCGGAAATTGACGCCGAACGCAAACGGGCACGGGAAGAGTTACGCAAGCAGGTCGCCATTTTAGCTGTCGCGGGTGCCGAGAAAATTATTGAACGTACCGTGGATGAAGCTGCTAACAGCGACATCGTTGATAAACTTGTCGCTGAACTGTAAGGAGGATGGGGCATGTCTGAAATCGTTACTGTAGCTCGCCCCTACGCCAA