Homologs in group_343

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_11975 FBDBKF_11975 37.5 Morganella morganii S1 dppD dipeptide ABC transporter ATP-binding protein
EHELCC_14330 EHELCC_14330 37.5 Morganella morganii S2 dppD dipeptide ABC transporter ATP-binding protein
NLDBIP_15425 NLDBIP_15425 37.5 Morganella morganii S4 dppD dipeptide ABC transporter ATP-binding protein
LHKJJB_15185 LHKJJB_15185 37.5 Morganella morganii S3 dppD dipeptide ABC transporter ATP-binding protein
HKOGLL_14305 HKOGLL_14305 37.5 Morganella morganii S5 dppD dipeptide ABC transporter ATP-binding protein
F4V73_RS14680 F4V73_RS14680 37.5 Morganella psychrotolerans dppD dipeptide ABC transporter ATP-binding protein
PMI_RS14050 PMI_RS14050 38.6 Proteus mirabilis HI4320 dppD dipeptide ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_343

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_343

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A0A0H3JXA3 1.14e-70 221 41 0 264 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FVF0 5.99e-69 217 40 0 264 1 cntD Metal-staphylopine import system ATP-binding protein CntD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P04285 2.44e-57 189 38 1 267 1 oppD Oligopeptide transport ATP-binding protein OppD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9CKL2 1.03e-56 193 44 1 238 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 6.62e-34 132 32 4 236 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
P50980 2.88e-56 186 40 2 255 3 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. cremoris (strain SK11)
Q07733 4.78e-56 186 40 2 255 1 oppD Oligopeptide transport ATP-binding protein OppD Lactococcus lactis subsp. lactis (strain IL1403)
P24136 2.46e-55 184 39 1 254 1 oppD Oligopeptide transport ATP-binding protein OppD Bacillus subtilis (strain 168)
P0AAG2 3.03e-55 183 38 3 261 3 dppD Dipeptide transport ATP-binding protein DppD Shigella flexneri
P0AAG0 3.03e-55 183 38 3 261 1 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli (strain K12)
P0AAG1 3.03e-55 183 38 3 261 3 dppD Dipeptide transport ATP-binding protein DppD Escherichia coli O157:H7
P76027 9.22e-55 182 38 0 250 1 oppD Oligopeptide transport ATP-binding protein OppD Escherichia coli (strain K12)
P42064 2.06e-54 181 38 3 258 3 appD Oligopeptide transport ATP-binding protein AppD Bacillus subtilis (strain 168)
P26905 1.79e-53 179 39 3 253 3 dppD Dipeptide transport ATP-binding protein DppD Bacillus subtilis (strain 168)
P45052 2.3e-53 179 38 1 260 3 oppD Oligopeptide transport ATP-binding protein OppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3Z3V4 4.84e-52 182 38 4 267 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
Q3Z3V4 9.96e-35 134 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Shigella sonnei (strain Ss046)
P75796 5.21e-52 182 38 4 267 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
P75796 1.03e-34 134 35 5 251 1 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain K12)
Q323W5 5.26e-52 182 38 4 267 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q323W5 3.19e-35 136 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Shigella boydii serotype 4 (strain Sb227)
Q8FJL0 5.37e-52 182 40 3 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FJL0 4.43e-35 135 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RE96 5.48e-52 182 40 3 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q1RE96 4.84e-35 135 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli (strain UTI89 / UPEC)
Q0TJM0 5.89e-52 182 40 3 245 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TJM0 5.34e-35 135 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A967 6.14e-52 182 40 3 244 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
A1A967 7.17e-34 132 34 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O1:K1 / APEC
Q8X6W1 8.37e-52 181 38 4 267 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q8X6W1 2.44e-35 136 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Escherichia coli O157:H7
Q32IB5 8.46e-52 181 38 4 267 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q32IB5 5.61e-35 135 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZQM4 1.76e-51 180 39 3 253 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZQM4 1.49e-35 137 35 4 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57RB2 2.12e-51 180 39 3 253 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q57RB2 1.49e-35 137 35 4 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella choleraesuis (strain SC-B67)
Q5PGP3 2.77e-51 180 39 3 253 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGP3 2.37e-35 136 35 4 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z864 7.53e-51 179 39 3 253 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q8Z864 1.43e-35 137 35 4 239 3 gsiA Glutathione import ATP-binding protein GsiA Salmonella typhi
Q83LT3 2.22e-50 177 38 4 266 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
Q83LT3 1.01e-34 134 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri
A2RI77 2.69e-50 171 36 2 237 1 dppD Dipeptide transport ATP-binding protein DppD Lactococcus lactis subsp. cremoris (strain MG1363)
P45095 5.79e-50 170 38 2 260 3 dppD Dipeptide transport ATP-binding protein DppD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0T6D3 1.16e-49 176 38 4 266 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q0T6D3 1.1e-34 134 35 5 251 3 gsiA Glutathione import ATP-binding protein GsiA Shigella flexneri serotype 5b (strain 8401)
Q6D3A9 3.91e-49 174 39 3 255 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D3A9 4.98e-35 135 34 5 238 3 gsiA Glutathione import ATP-binding protein GsiA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q53193 1.71e-48 166 35 1 248 3 NGR_a01410 Probable peptide ABC transporter ATP-binding protein y4tR Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A0A0H2ZGN6 9.02e-48 164 38 1 234 1 dppD Di/tripeptide transport ATP-binding protein DppD Pseudomonas aeruginosa (strain UCBPP-PA14)
P0AAH7 6.18e-47 162 37 3 241 3 sapD Peptide transport system ATP-binding protein SapD Shigella flexneri
P0AAH4 6.18e-47 162 37 3 241 1 sapD Putrescine export system ATP-binding protein SapD Escherichia coli (strain K12)
P0AAH5 6.18e-47 162 37 3 241 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAH6 6.18e-47 162 37 3 241 3 sapD Peptide transport system ATP-binding protein SapD Escherichia coli O157:H7
P33916 9.44e-47 166 38 2 256 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P33916 1.87e-32 127 34 6 241 1 yejF Uncharacterized ABC transporter ATP-binding protein YejF Escherichia coli (strain K12)
P36636 1.61e-46 161 37 3 241 2 sapD Peptide transport system ATP-binding protein SapD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5U1 2.08e-46 159 39 5 243 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O157:H7
Q0SZJ4 3.83e-46 158 38 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri serotype 5b (strain 8401)
Q83J78 4.09e-46 158 38 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella flexneri
A5VU87 8.72e-46 159 35 2 245 3 BOV_A0348 Putative peptide import ATP-binding protein BOV_A0348 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBN6 9.1e-46 159 35 2 245 3 BMEII0863 Putative peptide import ATP-binding protein BMEII0863 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP1 9.4e-46 159 35 2 245 3 BRA0405 Putative peptide import ATP-binding protein BRA0405/BS1330_II0402 Brucella suis biovar 1 (strain 1330)
Q32AQ2 9.77e-46 157 38 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella dysenteriae serotype 1 (strain Sd197)
Q1R5D9 1.5e-45 156 38 5 243 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain UTI89 / UPEC)
Q0TBX9 1.5e-45 156 38 5 243 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FCN0 1.55e-45 156 38 5 243 3 nikD Nickel import ATP-binding protein NikD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2YK63 3.07e-45 158 35 2 245 3 BAB2_0817 Putative peptide import ATP-binding protein BAB2_0817 Brucella abortus (strain 2308)
Q577J5 3.07e-45 158 35 2 245 3 BruAb2_0796 Putative peptide import ATP-binding protein BruAb2_0796 Brucella abortus biovar 1 (strain 9-941)
P33593 4.26e-45 155 38 5 243 3 nikD Nickel import ATP-binding protein NikD Escherichia coli (strain K12)
Q3YW49 9.23e-45 154 38 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella sonnei (strain Ss046)
Q8FUW8 4.06e-44 155 36 1 234 3 BRA1094 Putative peptide import ATP-binding protein BRA1094/BS1330_II1086 Brucella suis biovar 1 (strain 1330)
Q2YJJ9 4.06e-44 155 36 1 234 3 BAB2_1052 Putative peptide import ATP-binding protein BAB2_1052 Brucella abortus (strain 2308)
Q8VQK6 4.06e-44 155 36 1 234 3 BruAb2_1033 Putative peptide import ATP-binding protein BruAb2_1033 Brucella abortus biovar 1 (strain 9-941)
Q31VE7 5.09e-44 152 37 5 243 3 nikD Nickel import ATP-binding protein NikD Shigella boydii serotype 4 (strain Sb227)
Q8YDH0 1.49e-43 153 36 1 234 3 BMEII0206 Putative peptide import ATP-binding protein BMEII0206 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P77268 1.79e-43 153 35 2 241 2 ddpD Probable D,D-dipeptide transport ATP-binding protein DdpD Escherichia coli (strain K12)
P77737 2.27e-42 150 35 4 243 1 oppF Oligopeptide transport ATP-binding protein OppF Escherichia coli (strain K12)
P0A2U9 3.81e-42 150 35 2 238 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U8 3.81e-42 150 35 2 238 3 amiE Oligopeptide transport ATP-binding protein AmiE Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P42065 5.21e-42 149 36 2 235 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
A0A0H2ZH52 7.46e-42 149 34 4 246 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
P08007 4.83e-41 147 34 5 244 1 oppF Oligopeptide transport ATP-binding protein OppF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P24137 6.73e-41 145 34 4 244 1 oppF Oligopeptide transport ATP-binding protein OppF Bacillus subtilis (strain 168)
P37313 3.02e-40 145 32 4 252 1 dppF Dipeptide transport ATP-binding protein DppF Escherichia coli (strain K12)
Q6GH27 8.2e-40 142 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MRSA252)
P45288 1.25e-39 144 34 4 264 3 sapD Peptide transport system ATP-binding protein SapD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8NWT5 1.43e-39 141 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MW2)
Q6G9I0 2.41e-39 140 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain MSSA476)
Q5HG40 2.41e-39 140 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain COL)
Q2FYQ7 2.41e-39 140 35 3 247 1 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH57 2.41e-39 140 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain USA300)
P45094 2.47e-39 142 34 5 245 3 dppF Dipeptide transport ATP-binding protein DppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45051 2.67e-39 142 35 6 240 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8P2L5 7.58e-39 140 34 4 235 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q7A5Q8 7.65e-39 139 37 3 228 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain N315)
Q99UA2 7.65e-39 139 37 3 228 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0CZ33 1.58e-38 139 34 4 235 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain SSI-1)
Q5XDU4 1.58e-38 139 34 4 235 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ32 1.58e-38 139 34 4 235 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0A2V6 1.58e-38 139 34 4 235 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus pyogenes serotype M1
P63396 2.58e-38 144 34 1 238 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P63396 1.53e-29 120 34 5 239 3 BQ2027_MB1312C Uncharacterized ABC transporter ATP-binding protein Mb1312c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ5 2.58e-38 144 34 1 238 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ5 1.53e-29 120 34 5 239 1 Rv1281c Uncharacterized ABC transporter ATP-binding protein Rv1281c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ4 2.58e-38 144 34 1 238 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQJ4 1.53e-29 120 34 5 239 3 MT1318 Uncharacterized ABC transporter ATP-binding protein MT1318 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q2YXY9 2.7e-37 135 35 3 247 3 nikD Nickel import system ATP-binding protein NikD Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0A2V5 1.47e-36 135 33 6 237 3 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. cremoris (strain SK11)
P0A2V4 1.47e-36 135 33 6 237 1 oppF Oligopeptide transport ATP-binding protein OppF Lactococcus lactis subsp. lactis (strain IL1403)
P16678 7.91e-36 131 33 6 256 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
C0SP98 1.01e-35 133 32 4 237 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
Q2RS21 1.87e-35 130 33 3 238 3 nikD Nickel import ATP-binding protein NikD Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
P18766 2.02e-35 131 32 3 235 3 amiF Oligopeptide transport ATP-binding protein AmiF Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P72479 6.58e-35 130 34 6 242 3 oppF Oligopeptide transport ATP-binding protein OppF Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q2YJJ8 1.22e-34 130 30 3 237 3 BAB2_1053 Putative peptide import ATP-binding protein BAB2_1053 Brucella abortus (strain 2308)
Q8VQK7 1.22e-34 130 30 3 237 3 BruAb2_1034 Putative peptide import ATP-binding protein BruAb2_1034 Brucella abortus biovar 1 (strain 9-941)
Q8YDH1 5.68e-34 129 30 3 237 3 BMEII0205 Putative peptide import ATP-binding protein BMEII0205 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A2RI78 7.83e-34 127 32 5 241 1 dppF Dipeptide transport ATP-binding protein DppF Lactococcus lactis subsp. cremoris (strain MG1363)
P0AAI0 4.98e-33 124 33 7 236 3 sapF Peptide transport system ATP-binding protein SapF Shigella flexneri
P0AAH8 4.98e-33 124 33 7 236 1 sapF Putrescine export system ATP-binding protein SapF Escherichia coli (strain K12)
P0AAH9 4.98e-33 124 33 7 236 3 sapF Peptide transport system ATP-binding protein SapF Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8YBN5 5.35e-33 125 31 3 235 3 BMEII0864 Putative peptide import ATP-binding protein BMEII0864 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FWP2 5.35e-33 125 31 3 235 3 BRA0404 Putative peptide import ATP-binding protein BRA0404/BS1330_II0401 Brucella suis biovar 1 (strain 1330)
Q2YK62 5.35e-33 125 31 3 235 3 BAB2_0818 Putative peptide import ATP-binding protein BAB2_0818 Brucella abortus (strain 2308)
Q577J4 5.35e-33 125 31 3 235 3 BruAb2_0797 Putative peptide import ATP-binding protein BruAb2_0797 Brucella abortus biovar 1 (strain 9-941)
A5VU86 5.35e-33 125 31 3 235 3 BOV_A0347 Putative peptide import ATP-binding protein BOV_A0347 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8RDH4 1.18e-32 125 31 3 250 1 dppD Dipeptide transport ATP-binding protein DppD Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P45289 2.15e-32 122 36 8 244 3 sapF Peptide transport system ATP-binding protein SapF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36638 3.83e-32 122 32 7 240 2 sapF Peptide transport system ATP-binding protein SapF Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P47325 4.01e-32 125 30 4 274 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8YCN8 5.15e-32 121 35 6 242 3 nikD Nickel import ATP-binding protein NikD Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S8 5.15e-32 121 35 6 242 3 nikD Nickel import ATP-binding protein NikD Brucella abortus biovar 1 (strain 9-941)
Q2YL70 5.15e-32 121 35 6 242 3 nikD Nickel import ATP-binding protein NikD Brucella abortus (strain 2308)
Q32AQ1 1.08e-31 120 34 5 225 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q1R5D8 1.36e-31 120 33 5 225 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 1.36e-31 120 33 5 225 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 1.36e-31 120 33 5 225 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8FVM9 2.19e-31 120 35 6 242 2 nikD Nickel import ATP-binding protein NikD Brucella suis biovar 1 (strain 1330)
Q3YW48 3.55e-31 119 33 4 224 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
P75552 4.49e-31 122 29 1 269 3 oppD Oligopeptide transport ATP-binding protein OppD Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q53194 1.04e-30 120 31 3 235 3 NGR_a01400 Probable peptide ABC transporter ATP-binding protein y4tS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P33594 1.34e-30 118 32 3 217 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q31VE6 5.05e-30 116 33 5 225 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q8X4L6 7.77e-30 116 33 4 218 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
P77622 8.21e-30 117 28 6 268 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q4A5A5 3.56e-29 114 32 9 247 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis synoviae (strain 53)
Q88HL1 4.21e-29 114 34 4 240 3 nikD Nickel import ATP-binding protein NikD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q3A9G5 5.65e-29 115 31 6 251 3 metN Methionine import ATP-binding protein MetN Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q2RS22 8.72e-29 113 33 6 225 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q03Z27 9.51e-29 115 32 9 260 3 metN Methionine import ATP-binding protein MetN Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q83J77 3.73e-28 111 32 5 225 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q0SZJ3 4.23e-28 111 32 5 225 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q73EL7 5.63e-28 112 32 9 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81ZF5 5.92e-28 112 32 9 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q63GR8 6.37e-28 112 32 9 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q1JII9 6.47e-28 112 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q6HP89 6.5e-28 112 32 9 254 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
A3CRB9 8.01e-28 110 32 9 264 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus sanguinis (strain SK36)
Q8NSN2 8.28e-28 112 33 6 224 3 metN Methionine import ATP-binding protein MetN Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8DWR3 8.89e-28 110 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E2L2 8.89e-28 110 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype III (strain NEM316)
Q3JYF4 8.89e-28 110 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1J8E4 8.9e-28 112 34 11 264 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q81IN8 1.5e-27 111 32 9 254 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q043Y8 2.23e-27 111 33 8 248 3 metN Methionine import ATP-binding protein MetN Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q48V78 2.46e-27 111 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 2.46e-27 111 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q8EPK1 2.79e-27 110 32 8 254 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5XDS8 4.11e-27 110 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q8YCN7 4.23e-27 108 31 7 274 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 4.23e-27 108 31 7 274 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 4.23e-27 108 31 7 274 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q1JNE0 5.31e-27 110 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 5.31e-27 110 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
P55662 5.37e-27 108 28 7 241 3 NGR_a01510 Probable amino-acid ABC transporter ATP-binding protein y4tH Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q0SFW6 5.81e-27 110 31 6 235 3 metN2 Methionine import ATP-binding protein MetN 2 Rhodococcus jostii (strain RHA1)
Q8FVN0 6.04e-27 108 31 7 274 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
P0C0E9 6.06e-27 108 33 9 254 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 6.06e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q48QM2 6.59e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 6.59e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 6.59e-27 108 33 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
D8KFN1 7.46e-27 110 31 11 284 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain NZ9000)
P0CI33 7.46e-27 110 31 11 284 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain MG1363)
Q6GIH9 7.96e-27 109 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q1J982 9.2e-27 108 32 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q6G2E2 9.64e-27 109 31 10 274 3 metN Methionine import ATP-binding protein MetN Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q50294 1e-26 108 33 8 238 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q6D5H7 1.03e-26 109 29 8 276 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2FVF1 1.08e-26 107 30 8 252 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q839D5 1.11e-26 108 31 6 249 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8P2K6 1.12e-26 109 33 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q4L4R9 1.19e-26 109 31 9 261 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q5L3R0 1.34e-26 107 31 9 254 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Geobacillus kaustophilus (strain HTA426)
Q4JTG9 1.42e-26 109 33 7 224 3 metN Methionine import ATP-binding protein MetN Corynebacterium jeikeium (strain K411)
Q74IV9 1.69e-26 108 31 8 250 3 metN Methionine import ATP-binding protein MetN Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q4L884 1.89e-26 107 29 3 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q98QH5 1.9e-26 107 33 7 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9CIN4 2.11e-26 108 30 11 284 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. lactis (strain IL1403)
Q8FRX8 2.33e-26 108 31 7 248 3 metN Methionine import ATP-binding protein MetN Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P0CZ31 2.74e-26 108 32 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 2.74e-26 108 32 10 263 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8G5P8 2.83e-26 109 33 6 234 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q6NJ07 3.1e-26 108 31 7 235 3 metN Methionine import ATP-binding protein MetN Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5FM63 3.4e-26 107 31 5 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q88UV2 4.16e-26 107 32 6 236 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O26096 4.35e-26 107 31 8 253 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain ATCC 700392 / 26695)
A0A0H3JT74 4.38e-26 105 30 8 252 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6XYZ4 4.89e-26 106 35 9 228 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Spiroplasma kunkelii
Q97T09 5.35e-26 107 31 11 276 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7A6M2 5.37e-26 107 30 5 242 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 5.37e-26 107 30 5 242 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8DRF9 5.69e-26 107 32 10 273 3 metN Methionine import ATP-binding protein MetN Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P63354 5.89e-26 107 30 3 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 5.89e-26 107 30 3 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YWP2 6.14e-26 107 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q17VE0 6.84e-26 107 32 8 253 3 metN Methionine import ATP-binding protein MetN Helicobacter acinonychis (strain Sheeba)
Q6D3Q6 7.12e-26 107 32 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5KVK2 8.65e-26 107 31 9 254 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q93DA2 9.05e-26 107 31 9 258 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q49W48 9.25e-26 107 31 7 258 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5HV18 1.04e-25 106 30 6 244 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni (strain RM1221)
Q0PAB6 1.04e-25 106 30 6 244 3 metN Methionine import ATP-binding protein MetN Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q6KHL1 1.09e-25 105 35 7 222 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mobile (strain ATCC 43663 / 163K / NCTC 11711)
Q04F14 1.09e-25 106 28 6 272 3 metN1 Methionine import ATP-binding protein MetN 1 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
P47425 1.15e-25 105 36 8 225 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q6GEL4 1.21e-25 105 29 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MRSA252)
Q6AE21 1.49e-25 106 33 10 238 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q8NXH5 1.56e-25 106 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 1.56e-25 106 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 1.56e-25 106 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 1.56e-25 106 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 1.56e-25 106 30 5 242 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q832Y6 1.6e-25 106 30 9 262 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q5M5Z2 1.95e-25 106 29 9 273 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5HQQ9 2.01e-25 105 31 8 254 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49ZE0 2.04e-25 104 31 8 246 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5WJP0 2.06e-25 105 35 8 241 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q03EE4 2.24e-25 104 29 8 259 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q032A0 2.31e-25 106 30 11 284 3 metN Methionine import ATP-binding protein MetN Lactococcus lactis subsp. cremoris (strain SK11)
Q81J16 2.33e-25 104 30 8 246 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P47326 2.79e-25 108 35 3 161 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8DRR9 2.84e-25 104 33 8 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8ENU2 3.24e-25 105 32 5 238 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q04BY7 3.66e-25 103 32 5 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8NQU4 4.41e-25 103 30 7 232 1 argV Arginine transport ATP-binding protein ArgV Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q03A07 4.56e-25 105 32 6 251 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8CTB2 5.11e-25 104 31 8 254 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5M1F6 5.3e-25 105 29 9 273 3 metN Methionine import ATP-binding protein MetN Streptococcus thermophilus (strain CNRZ 1066)
Q1B677 5.39e-25 104 30 7 247 3 metN Methionine import ATP-binding protein MetN Mycobacterium sp. (strain MCS)
Q4L885 5.42e-25 103 29 5 242 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus haemolyticus (strain JCSC1435)
Q1CR30 6.54e-25 104 30 7 249 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain HPAG1)
Q7A088 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MW2)
Q6G7A0 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain MSSA476)
Q7A471 6.76e-25 103 28 6 236 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain N315)
Q99S48 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HDY7 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain COL)
Q2YYM5 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FW35 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER8 6.76e-25 103 28 6 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus aureus (strain USA300)
Q8ETV7 7.38e-25 103 33 8 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q21BU8 7.68e-25 104 30 8 249 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB18)
Q4QMH4 7.74e-25 104 29 7 263 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q73F67 8.17e-25 103 29 8 256 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8E3S0 1e-24 104 33 10 254 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q6HPN0 1.14e-24 102 29 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 1.14e-24 102 29 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 1.14e-24 102 29 8 250 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q492R2 1.22e-24 101 33 5 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Blochmanniella pennsylvanica (strain BPEN)
Q1GBJ0 1.3e-24 102 32 5 234 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q2SRI1 1.32e-24 104 32 4 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q9PDN2 1.33e-24 103 29 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain 9a5c)
Q8DY54 1.5e-24 103 33 10 254 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.5e-24 103 33 10 254 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P56344 1.68e-24 101 28 6 241 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
Q65VG9 1.88e-24 103 30 9 272 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QP85 2.26e-24 103 30 9 248 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
P54954 2.67e-24 100 30 7 240 1 yxeO Probable amino-acid import ATP-binding protein YxeO Bacillus subtilis (strain 168)
P44513 2.71e-24 103 30 9 248 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q67SV5 3.18e-24 102 29 6 244 3 metN Methionine import ATP-binding protein MetN Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q92LX3 3.37e-24 102 31 8 253 3 metN Methionine import ATP-binding protein MetN Rhizobium meliloti (strain 1021)
Q5FKL2 3.71e-24 102 34 7 244 3 metN Methionine import ATP-binding protein MetN Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q63H62 3.98e-24 101 29 7 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q92EZ6 4e-24 102 31 5 241 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HDY6 4.15e-24 100 29 6 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain COL)
Q2FW34 4.15e-24 100 29 6 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FER7 4.15e-24 100 29 6 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain USA300)
Q9KIF7 4.34e-24 103 30 6 242 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q1CFH7 4.39e-24 102 32 7 240 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.39e-24 102 32 7 240 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.39e-24 102 32 7 240 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q87DT9 4.85e-24 102 29 5 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8Z0H0 5.11e-24 102 29 6 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8CQS7 5.61e-24 102 30 7 235 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 5.61e-24 102 30 7 235 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GEL3 5.72e-24 100 30 6 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MRSA252)
Q0I5E9 5.76e-24 102 33 8 231 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q7A7E3 5.91e-24 102 30 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 5.91e-24 102 30 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q03P57 6.7e-24 102 30 7 258 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
P54537 6.83e-24 99 27 6 231 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
O51587 7.48e-24 101 28 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8UH62 7.76e-24 101 29 5 227 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q89UD2 8.1e-24 101 30 7 236 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5HM28 8.15e-24 100 27 9 261 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q660M8 8.62e-24 101 28 6 254 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q5WDP1 8.73e-24 101 31 7 240 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q9ZJ34 8.88e-24 101 30 7 249 3 metN Methionine import ATP-binding protein MetN Helicobacter pylori (strain J99 / ATCC 700824)
Q8CRI7 9.52e-24 100 29 9 248 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8YA75 9.81e-24 101 31 5 241 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8E8K8 1.02e-23 101 30 6 234 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8Y4L8 1.03e-23 101 31 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2YVT7 1.08e-23 101 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q0BMC9 1.17e-23 101 30 6 237 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 1.17e-23 101 30 6 237 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q92VJ2 1.17e-23 101 29 4 231 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q724C0 1.23e-23 100 31 5 241 3 metN1 Methionine import ATP-binding protein MetN 1 Listeria monocytogenes serotype 4b (strain F2365)
P44785 1.28e-23 101 28 7 263 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6MSQ1 1.32e-23 102 32 4 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5WKL3 1.47e-23 100 30 8 251 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q8DMX9 1.54e-23 99 33 7 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97N50 1.54e-23 99 33 7 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HV7 1.54e-23 99 33 7 232 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P75551 1.56e-23 103 37 2 143 3 oppF Oligopeptide transport ATP-binding protein OppF Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q5HIL5 1.57e-23 100 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 1.57e-23 100 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 1.57e-23 100 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q667L9 1.59e-23 100 32 7 240 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8VNL9 1.76e-23 99 29 10 258 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q04DA7 1.81e-23 100 30 8 253 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q38WL5 1.84e-23 100 30 5 235 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q6LKD4 1.87e-23 100 30 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q6GJL2 1.88e-23 100 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q21UI2 1.95e-23 100 33 9 215 3 modC Molybdenum import ATP-binding protein ModC Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7VI92 2.09e-23 100 33 6 232 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q4KC87 2.13e-23 100 32 10 254 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6F9P2 2.4e-23 100 30 9 240 3 metN2 Methionine import ATP-binding protein MetN 2 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4FL37 2.45e-23 100 30 5 236 1 tmoW Trimethylamine N-oxide transport system ATP-binding protein TmoW Pelagibacter ubique (strain HTCC1062)
Q6A6X6 2.52e-23 100 32 9 238 3 metN Methionine import ATP-binding protein MetN Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1DDP4 2.57e-23 100 34 8 227 3 metN Methionine import ATP-binding protein MetN Myxococcus xanthus (strain DK1622)
Q5M243 2.8e-23 99 31 7 241 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXJ3 2.8e-23 99 31 7 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain CNRZ 1066)
Q9X196 2.83e-23 100 31 7 233 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9JUX4 2.93e-23 100 29 7 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8PNN4 2.96e-23 100 28 5 247 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas axonopodis pv. citri (strain 306)
Q9KLQ5 3.1e-23 100 29 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8PC11 3.25e-23 100 28 5 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9JZW0 3.63e-23 100 29 7 240 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q88WA5 3.72e-23 100 31 6 248 3 metN1 Methionine import ATP-binding protein MetN 1 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q03I82 3.89e-23 98 31 7 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q38UT9 4.1e-23 98 29 4 233 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Latilactobacillus sakei subsp. sakei (strain 23K)
Q8ELQ6 4.11e-23 99 31 6 234 3 metN3 Methionine import ATP-binding protein MetN 3 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q928L8 4.18e-23 99 31 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7A470 4.21e-23 98 29 6 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain N315)
Q99S47 4.21e-23 98 29 6 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NY21 4.46e-23 99 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 4.46e-23 99 29 7 238 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q88AS5 4.52e-23 99 29 8 251 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7NIW1 4.55e-23 99 30 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0I2Z4 4.57e-23 99 31 6 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q9CIS9 4.82e-23 98 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. lactis (strain IL1403)
Q0P9X7 5.13e-23 97 28 7 232 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1VZQ5 5.19e-23 97 28 7 232 3 peb1C Probable ABC transporter ATP-binding protein PEB1C Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q65F80 5.19e-23 99 30 7 259 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8F6Z1 5.59e-23 99 26 5 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 5.59e-23 99 26 5 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8NVB5 5.68e-23 97 30 6 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MW2)
Q6G799 5.68e-23 97 30 6 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain MSSA476)
Q6N9W0 5.76e-23 99 30 6 244 3 metN1 Methionine import ATP-binding protein MetN 1 Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q71X09 6.34e-23 99 31 8 236 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q7N8B9 6.82e-23 99 30 7 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9K876 7.35e-23 99 28 6 232 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q0SML1 7.69e-23 99 28 6 259 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q57SD6 7.74e-23 99 31 7 230 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q3KCC5 7.84e-23 99 30 8 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q9CK97 7.94e-23 99 30 11 268 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q6D734 8.89e-23 99 30 6 226 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7NC40 8.9e-23 98 25 7 260 3 pstB Phosphate import ATP-binding protein PstB Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q13VD7 9.06e-23 99 32 8 244 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q5PCG9 9.35e-23 98 33 11 242 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1WVG9 9.76e-23 99 28 9 270 3 metN Methionine import ATP-binding protein MetN Ligilactobacillus salivarius (strain UCC118)
O32169 1e-22 98 30 9 255 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q9MUN1 1.01e-22 98 29 7 245 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q6GH28 1.1e-22 96 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q63S19 1.12e-22 98 30 6 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 1.12e-22 98 30 6 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 1.12e-22 98 30 6 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q03ZL6 1.12e-22 97 30 11 241 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P17328 1.18e-22 99 28 4 248 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XZP8 1.28e-22 98 29 7 235 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8DIA0 1.32e-22 98 31 7 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9X0Y8 1.37e-22 96 30 10 256 3 pstB Phosphate import ATP-binding protein PstB Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9I1C8 1.42e-22 98 31 7 237 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5HG41 1.42e-22 95 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 1.42e-22 95 27 6 236 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 1.42e-22 95 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
P14175 1.55e-22 99 27 4 248 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q5PFQ7 1.6e-22 98 30 7 230 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q1WSB9 1.61e-22 97 25 4 234 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Ligilactobacillus salivarius (strain UCC118)
Q5YRD1 1.61e-22 97 33 8 214 3 metN Methionine import ATP-binding protein MetN Nocardia farcinica (strain IFM 10152)
Q8Z8W8 1.63e-22 98 30 7 230 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q89LP2 1.67e-22 98 31 5 228 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q2YXZ0 1.75e-22 95 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
P96063 1.76e-22 98 31 8 230 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8FCE2 1.78e-22 99 29 8 236 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCE2 6.02e-12 68 29 9 220 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBN5 1.78e-22 99 29 8 236 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBN5 6.02e-12 68 29 9 220 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q2YYM4 1.82e-22 96 30 6 219 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9TKX3 1.93e-22 97 31 7 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q58206 2.39e-22 95 31 8 216 1 MJ0796 Uncharacterized ABC transporter ATP-binding protein MJ0796 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q1WSB8 2.41e-22 96 28 6 242 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ligilactobacillus salivarius (strain UCC118)
Q8NWT6 2.42e-22 95 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 2.42e-22 95 27 6 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q49ZD9 2.47e-22 96 28 8 237 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9I6L0 2.47e-22 97 27 6 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P27675 2.51e-22 95 26 9 254 2 glnQ Glutamine transport ATP-binding protein GlnQ Geobacillus stearothermophilus
Q5NFU5 2.53e-22 97 30 6 237 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q3KJS6 2.54e-22 97 31 6 232 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q7VV72 2.56e-22 97 27 6 249 3 metN Methionine import ATP-binding protein MetN Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4E1 2.56e-22 97 27 6 249 3 metN Methionine import ATP-binding protein MetN Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFU9 2.56e-22 97 27 6 249 3 metN Methionine import ATP-binding protein MetN Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q0AU85 2.57e-22 97 31 7 232 3 metN Methionine import ATP-binding protein MetN Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q1BY14 2.59e-22 97 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 2.59e-22 97 31 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q14H97 2.63e-22 97 30 6 237 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q18C09 2.68e-22 97 30 5 222 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q7VM95 2.93e-22 97 30 6 241 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q0SY86 3.11e-22 99 29 8 236 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
Q0SY86 1.51e-11 67 29 9 220 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri serotype 5b (strain 8401)
P37388 3.26e-22 99 29 8 236 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
P37388 1.28e-11 67 29 9 220 1 xylG Xylose import ATP-binding protein XylG Escherichia coli (strain K12)
Q8UA73 3.31e-22 97 29 8 253 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q39IE7 3.51e-22 97 30 8 247 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q31V51 3.56e-22 98 29 8 236 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q31V51 6.25e-12 68 29 9 220 3 xylG Xylose import ATP-binding protein XylG Shigella boydii serotype 4 (strain Sb227)
Q8XDM1 3.56e-22 98 29 8 236 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q8XDM1 6.25e-12 68 29 9 220 3 xylG Xylose import ATP-binding protein XylG Escherichia coli O157:H7
Q134N9 3.87e-22 97 30 7 244 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisB5)
Q7A5Q9 4.1e-22 94 26 5 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 4.1e-22 94 26 5 236 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q4KK46 4.24e-22 97 31 7 237 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8UCD5 4.33e-22 97 33 8 232 3 modC Molybdenum import ATP-binding protein ModC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q668K6 4.41e-22 97 29 8 255 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8CRI6 4.51e-22 95 32 8 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HM27 4.51e-22 95 32 8 216 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P10346 5.08e-22 94 28 6 225 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q02ME3 5.37e-22 97 31 7 237 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8ZR89 5.49e-22 96 33 11 242 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E0SCY1 5.75e-22 97 29 4 231 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
Q9RR46 5.76e-22 97 30 5 239 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q8Z8R5 6.01e-22 96 32 11 243 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q9A7X1 6.15e-22 96 27 4 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q035B3 6.51e-22 95 28 5 248 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q032H4 6.57e-22 95 30 6 235 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain SK11)
A2RI01 6.57e-22 95 30 6 235 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Lactococcus lactis subsp. cremoris (strain MG1363)
P9WQM1 6.93e-22 96 30 7 239 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 6.93e-22 96 30 7 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 6.93e-22 96 30 7 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1IGN4 7.11e-22 96 30 8 258 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q9M0G9 7.17e-22 98 31 10 253 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q03PY5 7.3e-22 95 28 4 232 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8PGE8 7.37e-22 96 32 10 252 3 metN Methionine import ATP-binding protein MetN Xanthomonas axonopodis pv. citri (strain 306)
Q83J33 7.48e-22 97 29 8 236 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q83J33 1.63e-11 67 29 9 220 3 xylG Xylose import ATP-binding protein XylG Shigella flexneri
Q45460 7.59e-22 96 27 8 258 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q65P77 8.63e-22 95 30 9 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q97UY8 9.7e-22 96 29 6 234 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q6LN52 1.1e-21 95 28 6 263 3 metN Methionine import ATP-binding protein MetN Photobacterium profundum (strain SS9)
P45247 1.22e-21 93 33 10 239 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 1.22e-21 93 33 10 239 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
P40735 1.26e-21 94 31 7 233 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus subtilis (strain 168)
Q21GS5 1.26e-21 95 33 7 208 3 modC Molybdenum import ATP-binding protein ModC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7AH43 1.41e-21 95 30 8 235 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q81C68 1.42e-21 94 28 6 243 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q92XW1 1.43e-21 95 29 3 224 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q2FNX9 1.49e-21 94 27 6 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q8RFN2 1.62e-21 95 31 8 235 3 metN Methionine import ATP-binding protein MetN Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7N8M2 1.7e-21 95 31 7 240 3 metN Methionine import ATP-binding protein MetN Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q1M8E0 1.81e-21 95 35 7 251 3 metN Methionine import ATP-binding protein MetN Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9CM80 1.89e-21 95 32 8 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
P39456 1.89e-21 93 28 9 245 1 tcyC L-cystine import ATP-binding protein TcyC Bacillus subtilis (strain 168)
Q663R5 1.89e-21 93 29 9 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCI2 1.89e-21 93 29 9 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8Z9T1 1.89e-21 93 29 9 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis
Q1C0A2 1.89e-21 93 29 9 245 3 pstB2 Phosphate import ATP-binding protein PstB 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q57S53 1.9e-21 95 32 11 245 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q6XYZ3 1.9e-21 94 30 8 241 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Spiroplasma kunkelii
Q839D4 1.96e-21 94 25 7 264 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q895C4 2.03e-21 94 30 7 222 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q8EUJ1 2.07e-21 94 26 8 268 3 pstB Phosphate import ATP-binding protein PstB Malacoplasma penetrans (strain HF-2)
Q73XU8 2.08e-21 95 29 7 239 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9KGD6 2.14e-21 94 31 8 230 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P48243 2.2e-21 93 29 7 225 1 gluA Glutamate transport ATP-binding protein GluA Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0S0Z3 2.25e-21 95 31 6 243 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q815Y7 2.27e-21 94 30 6 233 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q0SBZ1 2.32e-21 95 31 6 234 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q07LR5 2.36e-21 95 30 7 243 3 metN Methionine import ATP-binding protein MetN Rhodopseudomonas palustris (strain BisA53)
P44531 2.4e-21 94 32 8 218 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q6FAN3 2.48e-21 95 33 9 235 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8XNY7 2.65e-21 93 32 8 220 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
O31339 2.66e-21 95 28 8 238 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q50293 2.72e-21 94 29 6 230 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q97JB8 2.82e-21 93 30 10 252 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8FV85 3e-21 95 30 7 241 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 3e-21 95 30 7 241 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 3e-21 95 30 7 241 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 3e-21 95 30 7 241 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q6F1W5 3e-21 95 30 7 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q88RB3 3.09e-21 94 30 7 242 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8RQL7 3.13e-21 92 29 8 222 3 gluA Glutamate transport ATP-binding protein GluA Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7VZ31 3.16e-21 92 34 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8T0 3.16e-21 92 34 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK40 3.16e-21 92 34 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3BNZ3 3.67e-21 94 32 10 252 3 metN Methionine import ATP-binding protein MetN Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q46Y69 3.7e-21 94 31 5 238 3 metN Methionine import ATP-binding protein MetN Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2KVK2 3.76e-21 94 29 7 247 3 metN Methionine import ATP-binding protein MetN Bordetella avium (strain 197N)
P0AAG3 3.77e-21 92 30 9 242 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli (strain K12)
P0AAG4 3.77e-21 92 30 9 242 3 gltL Glutamate/aspartate import ATP-binding protein GltL Escherichia coli O157:H7
Q5X484 3.83e-21 94 29 8 261 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14555
Feature type CDS
Gene -
Product ABC transporter ATP-binding protein
Location 3227303 - 3228112 (strand: -1)
Length 810 (nucleotides) / 269 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_343
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0444 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)		 EP ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component

Protein Sequence

MNNLLTLNQVSIYDPHSEKKRVDNLSFSLKQGRTLAIVGESGSGKSLISKAIIGLLPSTLALSGEIFFDEKPLHLYSEQQRRALLGTSLGMIVQNGMSAFDPLIKIGKQVSQTLIYHFSYTKLQAFNATKQALDEVFEHQSLMIMQAFPHQLSGGQLQRVMIAMALALSPRLLIADEPTTALDAPLRREILQLLQRITISKNTTLIFISHDLGLVSQIADDILVMKEGKLIEFGDKNSVLDTPKQAYTRYLIEARAKLSQRFAQVLYAR

Flanking regions ( +/- flanking 50bp)

TTTACGCGATGTGTTCGACCCCGATAATCGTCAATCAGTCGGGGATAAATATGAACAATTTACTGACGCTTAATCAAGTCTCAATCTATGATCCTCACAGCGAAAAAAAGCGGGTAGATAATCTCTCCTTTAGCCTTAAACAGGGGCGAACGTTAGCTATTGTCGGTGAGAGTGGTAGTGGTAAAAGCTTAATCAGTAAAGCCATTATTGGCTTACTTCCAAGTACACTTGCACTATCGGGAGAAATTTTTTTTGATGAAAAGCCCCTTCATTTATATTCAGAGCAACAACGGCGTGCCCTATTAGGGACATCGCTAGGTATGATTGTGCAAAACGGCATGAGTGCTTTTGATCCGTTGATAAAAATAGGCAAGCAAGTTAGCCAAACTTTAATTTACCATTTTTCTTATACTAAATTACAAGCATTCAATGCCACTAAACAAGCATTGGATGAGGTGTTTGAGCATCAATCTTTAATGATTATGCAGGCATTTCCTCACCAATTAAGTGGGGGGCAATTACAACGTGTGATGATTGCCATGGCTTTGGCGTTATCACCAAGGTTATTAATTGCTGATGAACCTACTACCGCATTAGACGCTCCCTTGCGCAGAGAAATATTACAGCTATTGCAACGTATCACGATATCTAAAAACACCACCTTAATTTTTATCTCCCATGATCTAGGATTAGTCAGTCAGATTGCTGATGATATTTTAGTGATGAAAGAGGGAAAATTAATCGAGTTTGGTGACAAAAACAGCGTATTAGATACACCTAAGCAAGCCTATACCCGTTATTTAATTGAGGCTAGAGCTAAGCTTTCCCAACGTTTTGCACAGGTGCTTTATGCTCGGTGATCAGCATGAAACGGCGATAAACAACAAGAGGATCGAATGCTATTACGAGT