Homologs in group_1625

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10710 FBDBKF_10710 64.2 Morganella morganii S1 bioH pimeloyl-ACP methyl ester esterase BioH
EHELCC_15045 EHELCC_15045 64.2 Morganella morganii S2 bioH pimeloyl-ACP methyl ester esterase BioH
NLDBIP_14875 NLDBIP_14875 64.2 Morganella morganii S4 bioH pimeloyl-ACP methyl ester esterase BioH
LHKJJB_14470 LHKJJB_14470 64.2 Morganella morganii S3 bioH pimeloyl-ACP methyl ester esterase BioH
HKOGLL_13090 HKOGLL_13090 64.2 Morganella morganii S5 bioH pimeloyl-ACP methyl ester esterase BioH
F4V73_RS14425 F4V73_RS14425 63.9 Morganella psychrotolerans bioH pimeloyl-ACP methyl ester esterase BioH

Distribution of the homologs in the orthogroup group_1625

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1625

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZM6 0.0 536 100 0 261 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Proteus mirabilis (strain HI4320)
C6DGH6 2.22e-129 369 69 1 256 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8AQW5 6.26e-127 363 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6CZL9 2.46e-126 362 67 1 256 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A7MGD2 4.06e-126 361 70 1 248 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Cronobacter sakazakii (strain ATCC BAA-894)
B7LSB5 4.55e-126 361 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8FCT4 1.83e-125 359 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7NE17 5.11e-125 358 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3YWL3 6.57e-125 358 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella sonnei (strain Ss046)
B2U3M2 6.57e-125 358 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q83PW0 7.59e-125 358 68 2 255 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella flexneri
Q31VM0 8.09e-125 358 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella boydii serotype 4 (strain Sb227)
B1LHL2 8.09e-125 358 67 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain SMS-3-5 / SECEC)
P13001 8.93e-125 358 68 2 255 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain K12)
B1X758 8.93e-125 358 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain K12 / DH10B)
C4ZUR7 8.93e-125 358 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain K12 / MC4100 / BW2952)
B6I2X6 1.17e-124 357 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain SE11)
B1IP53 1.17e-124 357 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A5M0 1.17e-124 357 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O9:H4 (strain HS)
B7M1W8 1.17e-124 357 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O8 (strain IAI1)
Q8Z221 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella typhi
B5BHG7 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella paratyphi A (strain AKU_12601)
C0Q0I5 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella paratyphi C (strain RKS4594)
Q5PLY8 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5R7K5 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R369 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella enteritidis PT4 (strain P125109)
Q57IW5 1.3e-124 357 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella choleraesuis (strain SC-B67)
B7N145 1.53e-124 357 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O81 (strain ED1a)
B7NMH7 1.54e-124 357 67 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UKB7 1.69e-124 357 67 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4SVL3 3.51e-124 356 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella newport (strain SL254)
A7ZSU1 4.56e-124 356 68 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O139:H28 (strain E24377A / ETEC)
B5YTW3 5.09e-124 356 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X716 5.09e-124 356 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O157:H7
A8GKT5 5.12e-124 356 68 1 250 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Serratia proteamaculans (strain 568)
B7L4T9 5.93e-124 355 67 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain 55989 / EAEC)
Q0TC55 6.84e-124 355 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8ZLI9 7.98e-124 355 67 1 251 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TKT6 7.98e-124 355 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella heidelberg (strain SL476)
B5FJT1 7.98e-124 355 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella dublin (strain CT_02021853)
Q1R5M2 1.05e-123 355 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli (strain UTI89 / UPEC)
A1AGT6 1.05e-123 355 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O1:K1 / APEC
B7MDN8 1.05e-123 355 68 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5F8M6 1.29e-123 355 67 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella agona (strain SL483)
Q32AM6 3.5e-123 353 67 2 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shigella dysenteriae serotype 1 (strain Sd197)
A6TF35 5.37e-123 353 67 1 251 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MMB5 1.62e-122 352 68 1 250 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5XTS4 1.81e-122 352 66 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Klebsiella pneumoniae (strain 342)
Q8GHL1 1.03e-119 345 70 2 246 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Serratia marcescens
A1JSF8 1.49e-119 345 64 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q664J8 8.81e-118 340 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5V7 8.81e-118 340 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q7N9V7 1.5e-117 340 67 1 246 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
B1JHZ5 1.34e-116 337 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A9R4D0 1.34e-116 337 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pestis bv. Antiqua (strain Angola)
Q74Y45 1.34e-116 337 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pestis
A7FNV8 1.34e-116 337 63 1 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BGT3 2.52e-109 318 61 1 259 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Edwardsiella ictaluri (strain 93-146)
Q2NQH6 1.1e-103 304 60 1 250 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Sodalis glossinidius (strain morsitans)
C4K407 1.49e-90 271 52 1 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B5FFE9 1.5e-87 263 52 2 245 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aliivibrio fischeri (strain MJ11)
Q7MPY0 6.7e-87 261 52 2 250 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio vulnificus (strain YJ016)
Q8DDU4 1.07e-86 261 52 2 250 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio vulnificus (strain CMCP6)
B6EPQ0 1.5e-85 258 53 2 245 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aliivibrio salmonicida (strain LFI1238)
Q5E8N3 2.65e-85 258 52 2 243 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A7MST3 3.07e-83 252 51 2 245 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio campbellii (strain ATCC BAA-1116)
Q6LVQ7 2.16e-82 250 52 2 247 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Photobacterium profundum (strain SS9)
Q87TC2 4.34e-82 249 51 2 245 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KNL4 2.38e-81 248 48 2 249 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B7VHH1 5.83e-79 241 48 3 253 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Vibrio atlanticus (strain LGP32)
A0KF11 1.12e-77 238 49 3 246 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4ST17 2.32e-77 237 48 3 251 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aeromonas salmonicida (strain A449)
Q89A54 1.54e-74 231 41 3 259 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q5QZC0 1.05e-72 226 45 2 244 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1KM44 3.07e-69 217 46 5 247 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shewanella woodyi (strain ATCC 51908 / MS32)
Q8E8N6 1.55e-68 215 45 8 259 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8D1X1 8.24e-67 211 39 3 257 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Wigglesworthia glossinidia brevipalpis
C4LA13 9.77e-67 211 44 3 259 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q0HPU6 7.88e-65 206 44 8 257 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Shewanella sp. (strain MR-7)
Q15N09 2.49e-63 202 43 5 254 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5WW99 6.04e-53 174 40 6 237 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Legionella pneumophila (strain Lens)
A5IBW4 4.28e-52 172 39 6 237 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Legionella pneumophila (strain Corby)
Q5ZVG6 1.21e-51 171 39 6 237 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X590 1.9e-51 171 39 6 237 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Legionella pneumophila (strain Paris)
Q82SL8 3.09e-51 171 37 5 248 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q87DT3 8.02e-46 157 37 7 254 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9H6 8.02e-46 157 37 7 254 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xylella fastidiosa (strain M23)
B0U6I9 4.48e-45 155 37 7 254 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xylella fastidiosa (strain M12)
Q5H6D1 1.14e-44 154 37 5 252 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P907 1.14e-44 154 37 5 252 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PQE0 1.97e-44 153 37 5 252 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas axonopodis pv. citri (strain 306)
Q9PDM3 3.36e-43 150 36 7 254 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xylella fastidiosa (strain 9a5c)
B4SM83 7.14e-42 147 36 5 257 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Stenotrophomonas maltophilia (strain R551-3)
B2FLM6 1.85e-41 145 37 4 245 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Stenotrophomonas maltophilia (strain K279a)
Q2Y9Y7 2.84e-41 145 33 5 257 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7NPW5 3.33e-41 145 36 5 256 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8PDF3 2.76e-40 142 36 4 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RMQ9 2.76e-40 142 36 4 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas campestris pv. campestris (strain B100)
Q4UZP1 2.76e-40 142 36 4 255 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Xanthomonas campestris pv. campestris (strain 8004)
Q609V0 1.19e-35 130 33 4 247 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q5NZF6 5.21e-33 123 34 5 243 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C5BMZ8 6.74e-28 115 30 4 249 3 bioC Biotin biosynthesis bifunctional protein BioHC Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5F641 1.23e-25 104 29 4 244 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
E6MWF8 3.19e-23 98 28 4 248 1 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria meningitidis serogroup B / serotype 15 (strain H44/76)
Q9K197 3.19e-23 98 28 4 248 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JSN0 4.73e-23 99 29 4 248 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KRU9 1.68e-22 96 28 4 248 3 bioH Pimeloyl-[acyl-carrier protein] methyl ester esterase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B3PI89 2e-22 99 29 4 243 3 bioC Biotin biosynthesis bifunctional protein BioHC Cellvibrio japonicus (strain Ueda107)
Q21FY5 9.33e-15 77 26 7 250 3 bioC Biotin biosynthesis bifunctional protein BioHC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
O06734 6.85e-13 70 27 11 259 3 yisY AB hydrolase superfamily protein YisY Bacillus subtilis (strain 168)
A1JMX1 1.87e-09 60 24 7 265 3 rutD Putative carbamate hydrolase RutD Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
O34592 2.28e-09 60 25 9 259 2 ydjP AB hydrolase superfamily protein YdjP Bacillus subtilis (strain 168)
A8IAD8 2.74e-09 59 26 7 261 3 rutD Putative carbamate hydrolase RutD Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P22862 1.38e-08 57 23 9 263 1 estF Arylesterase Pseudomonas fluorescens
A8GCT3 2.64e-08 57 24 6 265 3 rutD Putative carbamate hydrolase RutD Serratia proteamaculans (strain 568)
H2KZ86 6.37e-08 56 36 3 107 1 abhd-5.2 Abhydrolase domain-containing protein abhd-5.2 Caenorhabditis elegans
Q476M7 1.6e-07 54 24 8 269 3 mhpC 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q400K3 1.97e-07 54 24 9 272 3 mhpC2 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase 2 Pseudomonas putida
P91143 6e-07 53 32 1 102 3 abhd-5.1 Abhydrolase domain-containing protein abhd-5.1 Caenorhabditis elegans
B1M5I5 1.27e-06 52 26 8 267 3 rutD Putative carbamate hydrolase RutD Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q52532 1.8e-06 51 24 9 262 3 mhpC 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase Pseudomonas sp.
O07015 2.03e-06 51 22 6 262 1 rsbQ Sigma factor SigB regulation protein RsbQ Bacillus subtilis (strain 168)
B7N3G5 2.13e-06 51 24 7 243 3 rutD Putative carbamate hydrolase RutD Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2JQW2 5.48e-06 50 23 7 268 3 mhpC 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q55921 5.82e-06 50 22 10 266 3 slr0314 Putative non-heme chloroperoxidase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A7ZKB4 8.43e-06 49 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O139:H28 (strain E24377A / ETEC)
B1IV88 8.91e-06 49 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYW4 8.91e-06 49 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O9:H4 (strain HS)
B7NLB7 1.12e-05 49 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UNZ2 1.23e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O127:H6 (strain E2348/69 / EPEC)
D4GEU7 1.41e-05 48 23 6 234 3 rutD Putative carbamate hydrolase RutD Pantoea ananatis (strain LMG 20103)
B7MTF2 1.55e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O81 (strain ED1a)
Q0TJ58 1.69e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LIZ6 1.75e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain SMS-3-5 / SECEC)
Q47GC1 1.77e-05 48 22 8 273 3 mhpC2 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase 2 Dechloromonas aromatica (strain RCB)
I6XU97 1.8e-05 48 33 5 117 1 Rv0045c Esterase Rv0045c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5EA59 1.85e-05 48 32 2 116 2 ABHD4 (Lyso)-N-acylphosphatidylethanolamine lipase Bos taurus
A4WCP8 1.87e-05 48 36 4 100 3 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase Enterobacter sp. (strain 638)
D3QPK2 1.98e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O55:H7 (strain CB9615 / EPEC)
C6UPN1 1.98e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5YU51 1.98e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAU7 1.98e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O157:H7
D2NGI6 2.07e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O150:H5 (strain SE15)
Q8TB40 2.18e-05 48 32 2 116 1 ABHD4 (Lyso)-N-acylphosphatidylethanolamine lipase Homo sapiens
Q3Z3A4 2.19e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Shigella sonnei (strain Ss046)
B7LFB9 2.19e-05 48 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain 55989 / EAEC)
O64252 2.58e-05 48 31 4 98 3 59.2 Putative non-heme haloperoxidase Mycobacterium phage D29
A6TAC7 2.63e-05 48 22 7 268 3 mhpC 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8FJ43 2.64e-05 48 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P9WNH5 2.86e-05 48 33 4 115 1 hsaD 4,5:9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNH4 2.86e-05 48 33 4 115 3 hsaD 4,5:9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
D5CZG9 3.05e-05 47 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O18:K1:H7 (strain IHE3034 / ExPEC)
A1A9R4 3.05e-05 47 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O1:K1 / APEC
B7MIF6 3.05e-05 47 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O45:K1 (strain S88 / ExPEC)
B5EZI7 3.46e-05 47 26 11 258 3 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase Salmonella agona (strain SL483)
Q1RDK8 3.89e-05 47 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain UTI89 / UPEC)
Q8VD66 3.91e-05 47 32 2 116 1 Abhd4 (Lyso)-N-acylphosphatidylethanolamine lipase Mus musculus
O05235 4.19e-05 47 23 7 247 3 yugF Uncharacterized hydrolase YugF Bacillus subtilis (strain 168)
D3H122 4.37e-05 47 24 9 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O44:H18 (strain 042 / EAEC)
Q2T4P1 5.1e-05 48 25 6 244 3 thaQ Polyketide synthase ThaQ Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q47HL4 5.45e-05 47 22 9 267 3 mhpC1 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase 1 Dechloromonas aromatica (strain RCB)
P0A573 7.18e-05 47 25 6 260 3 BQ2027_MB2734 Uncharacterized protein Mb2734 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WNH3 7.18e-05 47 25 6 260 1 Rv2715 Uncharacterized protein Rv2715 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNH2 7.18e-05 47 25 6 260 3 MT2788 Uncharacterized protein MT2788 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B0SW62 8.27e-05 46 21 6 268 3 rutD Putative carbamate hydrolase RutD Caulobacter sp. (strain K31)
B5FPE7 9.76e-05 46 25 11 258 3 menH 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase Salmonella dublin (strain CT_02021853)
Q48MQ7 9.82e-05 46 22 6 253 3 rutD Putative carbamate hydrolase RutD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P27747 0.000102 46 29 3 111 1 acoC Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9SZU7 0.000121 46 19 7 266 1 KAI2 Probable esterase KAI2 Arabidopsis thaliana
O52866 0.000175 45 32 2 112 1 None Soluble epoxide hydrolase Corynebacterium sp. (strain C12)
Q4ZXS0 0.000186 45 22 6 251 3 rutD Putative carbamate hydrolase RutD Pseudomonas syringae pv. syringae (strain B728a)
Q15KI9 0.000187 46 28 3 113 2 PHYLLO Protein PHYLLO, chloroplastic Arabidopsis thaliana
C8U5H1 0.000197 45 22 7 244 2 rutD Putative carbamate hydrolase RutD Escherichia coli O103:H2 (strain 12009 / EHEC)
Q83LK8 0.000232 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Shigella flexneri
D2AC40 0.000232 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Shigella flexneri serotype X (strain 2002017)
C8UMM5 0.000276 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O111:H- (strain 11128 / EHEC)
C8TNB9 0.000281 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O26:H11 (strain 11368 / EHEC)
B6I985 0.000289 45 22 7 244 1 rutD Putative carbamate hydrolase RutD Escherichia coli (strain SE11)
P75895 0.000289 45 22 7 244 1 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12)
B1X9D0 0.000289 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12 / DH10B)
C9QZ67 0.000289 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain ATCC 33849 / DSM 4235 / NCIMB 12045 / K12 / DH1)
C4ZQD7 0.000289 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain K12 / MC4100 / BW2952)
C6UFC0 0.000289 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain B / REL606)
C6EHJ8 0.000289 45 22 7 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli (strain B / BL21-DE3)
A4JPX5 0.000293 45 21 5 266 3 mhpC 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q7CWX3 0.000334 44 26 7 246 3 rutD Putative carbamate hydrolase RutD Agrobacterium fabrum (strain C58 / ATCC 33970)
A4VQH7 0.000401 44 21 5 259 3 rutD Putative carbamate hydrolase RutD Stutzerimonas stutzeri (strain A1501)
B7M8Z4 0.000403 44 22 6 244 3 rutD Putative carbamate hydrolase RutD Escherichia coli O8 (strain IAI1)
Q01398 0.00062 43 27 2 113 1 dehH1 Haloacetate dehalogenase H-1 Moraxella sp. (strain B)
B1ZB18 0.000651 43 23 6 259 3 rutD Putative carbamate hydrolase RutD Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9W3H8 0.000694 43 24 6 258 3 rutD Putative carbamate hydrolase RutD Methylorubrum extorquens (strain PA1)
P26174 0.000763 43 25 7 216 3 bchO Magnesium-chelatase 30 kDa subunit Rhodobacter capsulatus
O31581 0.000775 43 23 6 245 3 yfhM AB hydrolase superfamily protein YfhM Bacillus subtilis (strain 168)
Q59695 0.00078 43 25 9 257 3 acoC Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system Pseudomonas putida
Q49KF8 0.000839 43 22 7 267 3 mhpC1 2-hydroxy-6-oxononadienedioate/2-hydroxy-6-oxononatrienedioate hydrolase 1 Pseudomonas putida

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS14455
Feature type CDS
Gene bioH
Product pimeloyl-ACP methyl ester esterase BioH
Location 3207069 - 3207854 (strand: -1)
Length 786 (nucleotides) / 261 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1625
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00561 alpha/beta hydrolase fold

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0596 Coenzyme transport and metabolism (H)
General function prediction only (R)		 HR 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase MenH and related esterases, alpha/beta hydrolase fold

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02170 pimeloyl-[acyl-carrier protein] methyl ester esterase [EC:3.1.1.85] Biotin metabolism
Metabolic pathways
Biosynthesis of cofactors		 Pimeloyl-ACP biosynthesis, BioC-BioH pathway, malonyl-ACP => pimeloyl-ACP

Protein Sequence

MNKLYWQTLGEGKTHLVLLHGWGLNAQVWQSIITRLSSHFTLHLVDLPGYGRSQGFPVLTLKEMADIVFSQAPEKKAIWLGWSLGGLVASRIALDNPNNVRALITVASSPCFAAHEAWPGIKPDVLKGFEQQLSDNFHRTVERFLALQTLGTQSAREDTKALKAVVLAQPLPSVETLNGGLEILRTEDLREQLTTLCCPFIRLYGYLDGLVPRKVAALLDARYPDSPSVIFRHAAHAPFISHPDEFSETLLKQCEALSILA

Flanking regions ( +/- flanking 50bp)

GTTATCAGCATAGTGCACATCCCTGTAAAATAAGAGAAGAGAGCATAACAATGAATAAATTGTATTGGCAGACTTTAGGTGAAGGAAAAACGCATCTTGTGCTGTTGCACGGATGGGGCTTGAATGCTCAGGTTTGGCAATCAATCATTACGCGATTAAGCTCGCATTTTACCCTGCATCTGGTTGATTTACCGGGATATGGCAGAAGCCAAGGTTTTCCTGTGCTAACGCTTAAAGAGATGGCTGATATTGTTTTTTCACAGGCACCTGAAAAAAAAGCCATTTGGCTAGGATGGTCATTAGGGGGATTAGTGGCAAGCCGTATTGCACTTGATAATCCTAATAATGTACGGGCGTTAATTACCGTTGCCTCTTCCCCTTGTTTTGCTGCTCATGAAGCATGGCCAGGAATTAAGCCAGACGTGTTAAAAGGTTTCGAGCAACAATTGAGTGATAACTTTCATCGAACGGTTGAGCGCTTTTTAGCCTTGCAAACACTCGGTACTCAAAGTGCTCGTGAAGATACTAAGGCCTTGAAAGCGGTCGTGTTGGCACAACCTTTGCCTTCCGTTGAAACATTAAACGGCGGGCTGGAAATTTTACGTACAGAAGATTTGCGAGAACAGCTTACTACCTTATGTTGTCCTTTTATTCGGCTTTATGGTTATTTAGATGGTTTAGTGCCAAGAAAAGTCGCAGCTTTATTAGATGCTCGTTATCCTGACTCTCCTTCGGTTATTTTTCGCCATGCCGCACATGCTCCCTTTATTTCTCATCCGGATGAATTTAGTGAAACCTTGTTAAAGCAGTGTGAGGCCTTATCAATTCTGGCATGAATGAAGAGGTTATAACGCTAATAGACTATTCAAGATGATATAGCGTTTCG