Homologs in group_468

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17625 FBDBKF_17625 65.5 Morganella morganii S1 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
EHELCC_18110 EHELCC_18110 65.5 Morganella morganii S2 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
NLDBIP_18040 NLDBIP_18040 65.5 Morganella morganii S4 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
LHKJJB_18235 LHKJJB_18235 65.5 Morganella morganii S3 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
HKOGLL_17965 HKOGLL_17965 65.5 Morganella morganii S5 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
F4V73_RS15005 F4V73_RS15005 63.9 Morganella psychrotolerans - HesA/MoeB/ThiF family protein

Distribution of the homologs in the orthogroup group_468

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_468

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30138 5.57e-99 291 60 1 246 1 thiF Sulfur carrier protein ThiS adenylyltransferase Escherichia coli (strain K12)
B0W377 3.77e-64 209 43 3 247 3 CPIJ001621 Adenylyltransferase and sulfurtransferase MOCS3 Culex quinquefasciatus
B4LRB9 8.63e-63 206 43 2 247 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila virilis
Q17CA7 9.76e-63 205 43 4 248 3 AAEL004607 Adenylyltransferase and sulfurtransferase MOCS3 Aedes aegypti
P12282 1.08e-62 199 41 0 244 1 moeB Molybdopterin-synthase adenylyltransferase Escherichia coli (strain K12)
B4JBC4 3.5e-61 201 43 2 247 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila grimshawi
B4N7R4 1e-60 201 42 3 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila willistoni
B5DS72 1.07e-60 200 43 4 248 3 GA24966 Adenylyltransferase and sulfurtransferase MOCS3-1 Drosophila pseudoobscura pseudoobscura
B4GKQ3 3.08e-60 199 43 4 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila persimilis
Q29PG5 3.11e-60 199 43 4 248 3 GA12041 Adenylyltransferase and sulfurtransferase MOCS3-2 Drosophila pseudoobscura pseudoobscura
Q7PY41 4.93e-60 198 42 4 248 3 AGAP001737 Adenylyltransferase and sulfurtransferase MOCS3 Anopheles gambiae
B4KI53 8.77e-60 198 42 2 247 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila mojavensis
O44510 1.75e-59 196 39 2 247 3 moc-3 Adenylyltransferase and sulfurtransferase MOCS3 Caenorhabditis elegans
A8WRE3 3.75e-59 195 40 2 247 3 uba-4 Adenylyltransferase and sulfurtransferase MOCS3 Caenorhabditis briggsae
B4NXF7 4.74e-59 196 42 4 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila yakuba
B3MLX7 1.43e-58 195 42 4 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila ananassae
Q9VLJ8 1.53e-58 195 42 4 248 1 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila melanogaster
Q56067 1.6e-57 186 43 0 244 3 moeB Molybdopterin-synthase adenylyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4HYP0 3.63e-57 191 41 4 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila sechellia
Q8AWD2 1.33e-54 184 41 6 250 2 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Danio rerio
A2R3H4 1.75e-54 185 42 7 263 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P45211 2.08e-53 175 39 0 235 3 moeB Molybdopterin-synthase adenylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q55FS0 9e-53 179 40 5 249 3 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Dictyostelium discoideum
Q4WV19 1.23e-52 180 43 7 257 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0CFD4 1.83e-52 179 41 7 258 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q58E95 9.24e-52 177 39 4 248 2 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Xenopus laevis
B0Y0P7 9.51e-52 178 42 7 257 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A1CAZ7 4.16e-51 176 44 4 225 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A4RPM5 7.87e-51 176 39 7 268 3 UBA4 Adenylyltransferase and sulfurtransferase uba4 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
O59954 8.9e-51 175 40 7 264 1 uba4 Adenylyltransferase and sulfurtransferase uba4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A2BDX3 1.72e-50 174 41 3 227 1 Mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Mus musculus
Q09810 2.02e-50 172 39 5 251 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B6TNK6 1.11e-49 172 40 5 244 2 MOCS3-1 Adenylyltransferase and sulfurtransferase MOCS3-1 Zea mays
Q6CMC2 1.32e-49 171 38 3 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q756K6 2.62e-49 171 40 2 240 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A5DMB6 4.45e-49 169 41 5 218 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A5DSR2 4.82e-49 170 36 5 251 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A6ZT19 1.73e-48 168 36 4 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain YJM789)
Q6BHZ2 1.8e-48 168 37 4 251 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A1A4L8 2.2e-48 168 41 3 233 2 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Bos taurus
B4FAT0 3.29e-48 168 39 5 244 2 MOCS3-2 Adenylyltransferase and sulfurtransferase MOCS3-2 Zea mays
A7THV5 3.75e-48 167 36 4 249 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P38820 5.69e-48 167 35 4 248 1 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B5VK45 5.69e-48 167 35 4 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain AWRI1631)
B3LSM6 5.69e-48 167 35 4 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain RM11-1a)
A1DED8 1.76e-47 166 41 8 260 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q2TWN3 8.18e-47 164 39 7 255 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A3LQF9 8.05e-46 161 35 5 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6CBK1 1.04e-45 160 37 7 246 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6FR35 1.11e-45 160 38 2 211 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q72J02 1.67e-45 156 38 2 243 1 ttuC Sulfur carrier protein adenylyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
P51335 1.77e-45 159 34 2 239 3 moeB Probable molybdopterin-synthase adenylyltransferase Porphyra purpurea
Q9ZNW0 2.45e-45 160 38 5 251 2 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Arabidopsis thaliana
Q6B908 1.12e-44 156 34 3 247 3 moeB Probable molybdopterin-synthase adenylyltransferase Gracilaria tenuistipitata var. liui
A7F582 1.43e-44 158 38 4 244 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
P9WMN7 5.31e-44 155 35 2 247 1 moeZ Probable adenylyltransferase/sulfurtransferase MoeZ Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMN6 5.31e-44 155 35 2 247 3 moeZ Probable adenylyltransferase/sulfurtransferase MoeZ Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q59WH7 8.5e-44 156 34 5 257 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Candida albicans (strain SC5314 / ATCC MYA-2876)
D4GSF3 1.37e-43 151 37 2 239 1 ubaA SAMP-activating enzyme E1 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q1XDF1 8.7e-43 152 38 3 239 3 moeB Probable molybdopterin-synthase adenylyltransferase Neopyropia yezoensis
A5GFZ6 1.38e-42 153 42 3 230 3 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Sus scrofa
O95396 6.54e-42 151 41 3 233 1 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Homo sapiens
A3ACF3 8.17e-41 148 37 7 243 3 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Oryza sativa subsp. japonica
P46049 2.03e-40 143 36 2 244 2 hesA1 Protein HesA, heterocyst Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P46048 2.65e-36 132 34 2 244 2 hesA2 Protein HesA, vegetative Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O31619 4.37e-36 133 35 4 241 3 thiF Sulfur carrier protein ThiS adenylyltransferase Bacillus subtilis (strain 168)
P18500 8.3e-35 128 34 2 232 3 hesA Protein HesA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O31702 1.99e-31 121 33 4 243 3 moeB Molybdopterin-synthase adenylyltransferase Bacillus subtilis (strain 168)
P46037 3.19e-31 119 31 2 244 3 hesA Protein HesA Leptolyngbya boryana
Q9SJT1 2.84e-24 104 35 3 154 1 SAE2 SUMO-activating enzyme subunit 2 Arabidopsis thaliana
O42939 4.76e-22 98 32 2 158 1 uba2 Ubiquitin-activating enzyme E1-like Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7SXG4 1.12e-20 94 33 2 144 1 uba2 SUMO-activating enzyme subunit 2 Danio rerio
Q7ZY60 1.06e-19 91 31 2 148 2 uba2-b SUMO-activating enzyme subunit 2-B Xenopus laevis
Q642Q1 1.09e-19 91 31 2 148 2 uba2-a SUMO-activating enzyme subunit 2-A Xenopus laevis
O23034 1.6e-19 90 27 10 261 3 At1g05350 Ubiquitin-like modifier-activating enzyme 5 Arabidopsis thaliana
Q28GH3 1.81e-19 90 31 2 148 2 uba2 SUMO-activating enzyme subunit 2 Xenopus tropicalis
Q54L40 2.13e-19 90 31 3 166 3 uba2 SUMO-activating enzyme subunit 2 Dictyostelium discoideum
Q9UBT2 5.13e-19 89 31 2 144 1 UBA2 SUMO-activating enzyme subunit 2 Homo sapiens
P22515 1.07e-18 88 30 3 167 1 UBA1 Ubiquitin-activating enzyme E1 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P22515 2.13e-07 55 28 5 154 1 UBA1 Ubiquitin-activating enzyme E1 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9Z1F9 1.08e-18 88 30 2 144 1 Uba2 SUMO-activating enzyme subunit 2 Mus musculus
Q54C02 1.09e-18 87 28 9 242 3 uba5 Ubiquitin-like modifier-activating enzyme 5 Dictyostelium discoideum
P22314 1.72e-18 87 31 4 172 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Homo sapiens
P22314 1.72e-07 55 25 2 151 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Homo sapiens
A3KMV5 2.39e-18 87 31 4 172 2 UBA1 Ubiquitin-like modifier-activating enzyme 1 Bos taurus
A3KMV5 1.69e-07 55 24 2 151 2 UBA1 Ubiquitin-like modifier-activating enzyme 1 Bos taurus
Q02053 2.73e-18 87 31 4 172 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Mus musculus
Q02053 1.08e-07 55 25 2 157 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Mus musculus
Q6K6K7 6.33e-18 85 28 11 265 2 Os02g0506500 Ubiquitin-like modifier-activating enzyme 5 Oryza sativa subsp. japonica
P20973 7.59e-18 85 32 3 155 1 UBA1 Ubiquitin-activating enzyme E1 1 Triticum aestivum
Q5U300 8.68e-18 85 31 4 172 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Rattus norvegicus
Q5U300 2.03e-07 55 25 2 157 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Rattus norvegicus
Q29504 1.32e-17 85 31 4 172 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Oryctolagus cuniculus
Q29504 1.18e-07 55 25 2 151 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Oryctolagus cuniculus
Q9NAN1 1.43e-17 85 31 4 161 3 uba-2 SUMO-activating enzyme subunit uba-2 Caenorhabditis elegans
P52488 1.51e-17 85 32 3 164 1 UBA2 Ubiquitin-activating enzyme E1-like Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P31251 1.13e-16 82 30 3 155 2 UBA2 Ubiquitin-activating enzyme E1 2 Triticum aestivum
P92974 2.21e-16 81 32 3 155 1 UBA2 Ubiquitin-activating enzyme E1 2 Arabidopsis thaliana
P52495 1.71e-15 79 28 3 167 3 UBA1 Ubiquitin-activating enzyme E1 1 Candida albicans (strain WO-1)
P52495 1.18e-07 55 28 2 152 3 UBA1 Ubiquitin-activating enzyme E1 1 Candida albicans (strain WO-1)
P31254 2.42e-15 78 31 4 169 1 Uba1y Ubiquitin-like modifier-activating enzyme 1 Y Mus musculus
P31254 5.47e-06 50 25 2 157 1 Uba1y Ubiquitin-like modifier-activating enzyme 1 Y Mus musculus
O94609 2.81e-15 78 29 4 167 1 ptr3 Ubiquitin-activating enzyme E1 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94609 7.83e-07 53 26 4 173 1 ptr3 Ubiquitin-activating enzyme E1 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9V6U8 1.08e-14 76 33 6 177 1 Uba3 Nedd8-activating enzyme E1 catalytic subunit Drosophila melanogaster
P31252 1.21e-14 76 34 3 155 1 UBA3 Ubiquitin-activating enzyme E1 3 Triticum aestivum
Q55C16 1.9e-13 73 30 4 165 3 uba1 Ubiquitin-like modifier-activating enzyme 1 Dictyostelium discoideum
Q55C16 2.17e-07 55 26 3 152 3 uba1 Ubiquitin-like modifier-activating enzyme 1 Dictyostelium discoideum
P93028 1.48e-12 70 32 3 155 1 UBA1 Ubiquitin-activating enzyme E1 1 Arabidopsis thaliana
Q46927 1.92e-12 68 29 4 143 1 tcdA tRNA threonylcarbamoyladenosine dehydratase Escherichia coli (strain K12)
Q09765 1.97e-12 69 29 3 150 1 uba3 NEDD8-activating enzyme E1 catalytic subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q57097 2.14e-12 68 28 1 130 3 tcdA tRNA threonylcarbamoyladenosine dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5R4A0 3.27e-12 68 29 5 176 2 UBA3 NEDD8-activating enzyme E1 catalytic subunit Pongo abelii
Q54QG9 3.32e-12 68 29 3 156 1 uba3 NEDD8-activating enzyme E1 catalytic subunit Dictyostelium discoideum
Q8TBC4 3.52e-12 68 29 5 176 1 UBA3 NEDD8-activating enzyme E1 catalytic subunit Homo sapiens
B4JIY0 4.5e-12 68 30 8 224 3 GH12371 Ubiquitin-like modifier-activating enzyme 5 Drosophila grimshawi
Q99MI7 5.36e-12 68 28 5 176 1 Uba3 NEDD8-activating enzyme E1 catalytic subunit Rattus norvegicus
Q8C878 5.89e-12 68 28 5 176 1 Uba3 NEDD8-activating enzyme E1 catalytic subunit Mus musculus
P91430 6.14e-12 68 28 8 222 1 uba-5 Ubiquitin-like modifier-activating enzyme 5 Caenorhabditis elegans
Q29HT0 6.24e-12 68 30 8 224 3 GA14526 Ubiquitin-like modifier-activating enzyme 5 Drosophila pseudoobscura pseudoobscura
B4M357 8.04e-12 67 30 8 224 3 GJ19153 Ubiquitin-like modifier-activating enzyme 5 Drosophila virilis
Q6IVA4 1.3e-11 67 28 11 257 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Gallus gallus
B4NDE5 3.4e-11 65 29 8 224 3 GK10218 Ubiquitin-like modifier-activating enzyme 5 Drosophila willistoni
Q8JGT5 5.69e-11 65 24 4 164 2 sae1 SUMO-activating enzyme subunit 1 Xenopus laevis
B4PYA4 6.46e-11 65 30 8 224 3 GE15940 Ubiquitin-like modifier-activating enzyme 5 Drosophila yakuba
C3YZ51 7.12e-11 65 26 9 255 3 BRAFLDRAFT_113714 Ubiquitin-like modifier-activating enzyme 5 Branchiostoma floridae
Q19360 7.8e-11 65 27 5 181 1 rfl-1 NEDD8-activating enzyme E1 catalytic subunit Caenorhabditis elegans
B4L1K2 7.95e-11 64 29 8 224 3 GI14749 Ubiquitin-like modifier-activating enzyme 5 Drosophila mojavensis
A8XEQ8 8.59e-11 64 28 8 222 3 uba-5 Ubiquitin-like modifier-activating enzyme 5 Caenorhabditis briggsae
X1WER2 9.84e-11 64 29 9 228 3 uba5 Ubiquitin-like modifier-activating enzyme 5 Danio rerio
P41226 1.02e-10 65 28 4 165 1 UBA7 Ubiquitin-like modifier-activating enzyme 7 Homo sapiens
P41226 3.56e-10 63 28 2 150 1 UBA7 Ubiquitin-like modifier-activating enzyme 7 Homo sapiens
D1GY43 1.32e-10 64 29 8 224 3 GF23479 Ubiquitin-like modifier-activating enzyme 5 Drosophila ananassae
B4IK21 1.38e-10 63 30 8 224 3 GM13085 Ubiquitin-like modifier-activating enzyme 5 Drosophila sechellia
Q06624 1.57e-10 63 26 2 166 1 AOS1 DNA damage tolerance protein RHC31 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9VYY3 1.58e-10 63 30 8 224 2 Uba5 Ubiquitin-like modifier-activating enzyme 5 Drosophila melanogaster
Q28DS0 1.65e-10 63 23 4 164 2 sae1 SUMO-activating enzyme subunit 1 Xenopus tropicalis
B4GYC7 1.79e-10 63 29 7 212 3 GL19893 Ubiquitin-like modifier-activating enzyme 5 Drosophila persimilis
O65041 1.85e-10 63 26 5 162 1 ECR1 NEDD8-activating enzyme E1 catalytic subunit Arabidopsis thaliana
B4R345 2.49e-10 63 30 8 224 3 GD17028 Ubiquitin-like modifier-activating enzyme 5 Drosophila simulans
Q8C7R4 3.79e-10 63 26 3 149 1 Uba6 Ubiquitin-like modifier-activating enzyme 6 Mus musculus
Q6AXQ0 5.75e-10 62 25 2 149 2 Sae1 SUMO-activating enzyme subunit 1 Rattus norvegicus
Q17820 6.07e-10 62 31 4 156 3 aos-1 SUMO-activating enzyme subunit aos-1 Caenorhabditis elegans
Q54WI4 6.66e-10 62 26 2 148 3 sae1 SUMO-activating enzyme subunit 1 Dictyostelium discoideum
Q6GLG7 8.47e-10 61 26 11 261 2 uba5 Ubiquitin-like modifier-activating enzyme 5 Xenopus tropicalis
Q3KQ23 1.27e-09 61 26 11 261 2 uba5 Ubiquitin-like modifier-activating enzyme 5 Xenopus laevis
Q5M7A4 1.33e-09 61 27 10 257 1 Uba5 Ubiquitin-like modifier-activating enzyme 5 Rattus norvegicus
Q7ZVX6 1.35e-09 61 28 5 176 2 uba3 NEDD8-activating enzyme E1 catalytic subunit Danio rerio
B9VJ80 1.8e-09 60 27 6 221 2 None Ubiquitin-like modifier-activating enzyme 5 Bombyx mori
Q9GZZ9 1.91e-09 60 28 11 257 1 UBA5 Ubiquitin-like modifier-activating enzyme 5 Homo sapiens
Q5NVN7 1.95e-09 60 24 2 156 2 SAE1 SUMO-activating enzyme subunit 1 Pongo abelii
Q9UBE0 1.95e-09 60 24 2 156 1 SAE1 SUMO-activating enzyme subunit 1 Homo sapiens
Q9DBK7 1.97e-09 61 27 4 165 1 Uba7 Ubiquitin-like modifier-activating enzyme 7 Mus musculus
Q9DBK7 1.21e-08 58 26 2 150 1 Uba7 Ubiquitin-like modifier-activating enzyme 7 Mus musculus
Q17DT0 2.27e-09 60 29 8 224 3 AAEL004076 Ubiquitin-like modifier-activating enzyme 5 Aedes aegypti
Q5R8X4 2.27e-09 60 28 11 257 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Pongo abelii
B0WQV1 2.31e-09 60 29 7 224 3 CPIJ009416 Ubiquitin-like modifier-activating enzyme 5 Culex quinquefasciatus
A0AVT1 2.31e-09 60 28 3 153 1 UBA6 Ubiquitin-like modifier-activating enzyme 6 Homo sapiens
A7MAZ3 3.33e-09 60 27 11 257 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Bos taurus
Q8VE47 4.43e-09 59 27 10 257 1 Uba5 Ubiquitin-like modifier-activating enzyme 5 Mus musculus
A2VE14 8.88e-09 58 23 2 156 2 SAE1 SUMO-activating enzyme subunit 1 Bos taurus
Q9R1T2 1.66e-08 57 24 2 149 1 Sae1 SUMO-activating enzyme subunit 1 Mus musculus
Q99344 3.02e-08 56 25 6 188 1 UBA3 NEDD8-activating enzyme E1 catalytic subunit Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B3NUC9 5.27e-08 56 30 6 182 3 GG18422 Ubiquitin-like modifier-activating enzyme 5 Drosophila erecta
O32037 6.75e-08 55 29 1 133 3 tcdA tRNA threonylcarbamoyladenosine dehydratase Bacillus subtilis (strain 168)
Q6CBC3 6.8e-08 56 25 9 248 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Yarrowia lipolytica (strain CLIB 122 / E 150)
P55624 1.46e-07 55 28 7 183 4 NGR_a01950 Uncharacterized protein y4qC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6IQS6 2.03e-07 54 26 7 167 2 sae1 SUMO-activating enzyme subunit 1 Danio rerio
W0TA05 2.3e-07 54 25 6 205 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Kluyveromyces marxianus (strain DMKU3-1042 / BCC 29191 / NBRC 104275)
P79064 1.39e-06 52 27 1 102 4 rad31 DNA damage tolerance protein rad31 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P38862 1.66e-06 52 24 9 252 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZT79 1.71e-06 52 24 9 252 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Saccharomyces cerevisiae (strain YJM789)
A7KAL8 4.81e-06 50 26 4 172 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
O93922 1.3e-05 49 25 9 221 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Komagataella pastoris
O13861 3.18e-05 48 30 2 137 3 SPAC1A6.10 tRNA threonylcarbamoyladenosine dehydratase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6CXW3 3.22e-05 48 22 8 245 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6BGV9 4.21e-05 47 24 6 212 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A7TEY0 0.000306 45 23 10 263 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P38756 0.000331 45 21 1 140 1 TCD1 tRNA threonylcarbamoyladenosine dehydratase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5DLC6 0.00046 44 24 5 170 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
O43069 0.000469 44 25 7 208 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q52CS0 0.000847 43 24 6 170 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13725
Feature type CDS
Gene -
Product HesA/MoeB/ThiF family protein
Location 3049296 - 3050045 (strand: 1)
Length 750 (nucleotides) / 249 (amino acids)
In genomic island GI62

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_468
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00899 ThiF family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0476 Coenzyme transport and metabolism (H) H Molybdopterin or thiamine biosynthesis adenylyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MLNDNDFMRYSRQVMLEDIGLKGQTKIQQARVLIIGLGGLGSPASLYLAGAGVGELILVDDDNLHVSNLQRQILYRTQDIPDAKSDIAKQALLALNPDIKITTYKQRVNDDFPSTLLQNIDLVLDCTDNMSTRQAINRICVKQQIPLISGSAVGFSGQLIVFEPPFIHGCYHCLYPDNKEPQRNCQTAGILGPVVGVIGTLQALEAIKLLAGLPSTLSGKLRLFDGRKQNWSTLRLTPSKNCPVCRGLA

Flanking regions ( +/- flanking 50bp)

TGGCAACAGGTAACACTTAAATTATTAGAATTAGTAGAGGGAAAACCATCATGCTAAATGATAATGATTTTATGCGTTATAGCCGACAAGTGATGTTAGAAGATATAGGATTAAAAGGGCAAACCAAAATACAGCAAGCCAGAGTATTAATTATTGGCTTAGGTGGGTTAGGCTCTCCAGCATCACTTTATCTAGCAGGTGCAGGAGTGGGTGAACTTATTTTAGTCGATGATGATAATTTGCATGTCTCGAATTTACAGCGTCAAATTCTCTATCGCACTCAAGATATCCCAGATGCAAAATCAGACATCGCCAAACAGGCTCTACTTGCCTTAAATCCTGACATTAAAATCACCACCTATAAACAACGTGTTAATGATGATTTTCCCTCTACGTTGCTTCAAAACATCGATTTAGTTTTAGATTGCACTGATAACATGAGCACTCGCCAAGCAATCAATCGTATCTGTGTTAAACAACAAATACCGCTTATTAGTGGCAGTGCCGTTGGATTTAGTGGTCAGTTGATCGTGTTTGAGCCCCCTTTTATTCATGGTTGTTACCACTGTCTCTATCCTGATAACAAAGAGCCACAACGCAATTGCCAAACAGCTGGAATTCTAGGCCCCGTTGTAGGGGTCATTGGTACTCTGCAGGCACTTGAAGCAATTAAGTTACTTGCAGGTTTACCAAGTACGTTAAGTGGAAAACTACGTCTGTTCGATGGTAGAAAACAAAATTGGAGCACCTTGCGCTTAACACCATCAAAAAACTGTCCTGTTTGTCGAGGGTTAGCATGAATATTACCGTAAATGACGAACGTTATTCTCTGGATATGCCTGTCACGATA