Homologs in group_2294

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17625 FBDBKF_17625 100.0 Morganella morganii S1 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
EHELCC_18110 EHELCC_18110 100.0 Morganella morganii S2 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
LHKJJB_18235 LHKJJB_18235 100.0 Morganella morganii S3 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
HKOGLL_17965 HKOGLL_17965 100.0 Morganella morganii S5 thiF Molybdopterin or thiamine biosynthesis adenylyltransferase
F4V73_RS15005 F4V73_RS15005 86.5 Morganella psychrotolerans - HesA/MoeB/ThiF family protein
PMI_RS13725 PMI_RS13725 65.5 Proteus mirabilis HI4320 - HesA/MoeB/ThiF family protein

Distribution of the homologs in the orthogroup group_2294

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2294

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P30138 9.66e-99 291 63 1 244 1 thiF Sulfur carrier protein ThiS adenylyltransferase Escherichia coli (strain K12)
Q17CA7 2.92e-65 212 46 4 250 3 AAEL004607 Adenylyltransferase and sulfurtransferase MOCS3 Aedes aegypti
B0W377 1.13e-64 210 46 4 252 3 CPIJ001621 Adenylyltransferase and sulfurtransferase MOCS3 Culex quinquefasciatus
Q7PY41 2.27e-63 207 46 4 251 3 AGAP001737 Adenylyltransferase and sulfurtransferase MOCS3 Anopheles gambiae
B5DS72 6.65e-63 206 47 4 250 3 GA24966 Adenylyltransferase and sulfurtransferase MOCS3-1 Drosophila pseudoobscura pseudoobscura
B3MLX7 6.86e-63 206 48 4 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila ananassae
B4LRB9 1.29e-62 205 46 2 247 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila virilis
B4NXF7 1.54e-62 205 47 4 250 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila yakuba
Q29PG5 1.9e-62 205 46 4 250 3 GA12041 Adenylyltransferase and sulfurtransferase MOCS3-2 Drosophila pseudoobscura pseudoobscura
B4GKQ3 2.32e-62 205 46 4 250 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila persimilis
B4N7R4 9.24e-62 203 46 3 248 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila willistoni
B4HYP0 4.27e-61 201 45 4 250 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila sechellia
Q9VLJ8 7.68e-61 201 46 4 248 1 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila melanogaster
B4JBC4 9.34e-61 201 46 2 249 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila grimshawi
A8WRE3 8.05e-60 197 44 2 247 3 uba-4 Adenylyltransferase and sulfurtransferase MOCS3 Caenorhabditis briggsae
B4KI53 1.14e-59 198 45 2 247 3 Uba4 Adenylyltransferase and sulfurtransferase MOCS3 Drosophila mojavensis
O44510 7.25e-59 194 43 2 247 3 moc-3 Adenylyltransferase and sulfurtransferase MOCS3 Caenorhabditis elegans
P12282 2.84e-58 188 41 2 247 1 moeB Molybdopterin-synthase adenylyltransferase Escherichia coli (strain K12)
Q8AWD2 7.89e-57 191 44 4 250 2 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Danio rerio
Q55FS0 9.18e-55 184 42 5 249 3 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Dictyostelium discoideum
B4FAT0 1.32e-54 185 45 6 249 2 MOCS3-2 Adenylyltransferase and sulfurtransferase MOCS3-2 Zea mays
B6TNK6 1.35e-54 185 44 6 249 2 MOCS3-1 Adenylyltransferase and sulfurtransferase MOCS3-1 Zea mays
Q58E95 2.96e-54 184 40 4 255 2 mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Xenopus laevis
Q9ZNW0 1.98e-52 179 41 4 255 2 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Arabidopsis thaliana
A4RPM5 3.34e-51 176 40 7 273 3 UBA4 Adenylyltransferase and sulfurtransferase uba4 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q72J02 3.95e-51 171 43 3 245 1 ttuC Sulfur carrier protein adenylyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q56067 4.76e-51 170 40 2 247 3 moeB Molybdopterin-synthase adenylyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0CFD4 1.59e-50 174 43 7 259 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q09810 5.87e-50 171 39 5 247 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B0Y0P7 6.78e-50 173 43 7 262 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus fumigatus (strain CBS 144.89 / FGSC A1163 / CEA10)
A3LQF9 1.12e-49 171 39 5 247 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
P45211 1.83e-49 165 39 2 238 3 moeB Molybdopterin-synthase adenylyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4WV19 2.11e-49 172 43 7 262 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A1A4L8 2.33e-49 171 44 3 229 2 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Bos taurus
Q6BHZ2 4.21e-49 170 39 7 254 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
D4GSF3 5.48e-49 165 41 2 243 1 ubaA SAMP-activating enzyme E1 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A2R3H4 7.91e-49 170 40 7 264 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A1CAZ7 2.36e-48 169 40 6 264 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A2BDX3 6.14e-48 167 46 3 226 1 Mocs3 Adenylyltransferase and sulfurtransferase MOCS3 Mus musculus
Q6B908 2.83e-47 163 35 3 237 3 moeB Probable molybdopterin-synthase adenylyltransferase Gracilaria tenuistipitata var. liui
A3ACF3 3.44e-47 165 41 5 245 3 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Oryza sativa subsp. japonica
Q59WH7 4.3e-47 164 37 4 251 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Candida albicans (strain SC5314 / ATCC MYA-2876)
O59954 4.84e-47 166 40 7 264 1 uba4 Adenylyltransferase and sulfurtransferase uba4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A5DSR2 6.91e-47 164 39 4 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
P51335 8.48e-47 162 36 2 236 3 moeB Probable molybdopterin-synthase adenylyltransferase Porphyra purpurea
A7THV5 1.09e-46 164 37 5 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A1DED8 2.32e-45 161 41 8 265 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
O95396 3.13e-45 160 45 4 250 1 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Homo sapiens
A5GFZ6 2.05e-44 158 45 3 229 3 MOCS3 Adenylyltransferase and sulfurtransferase MOCS3 Sus scrofa
Q6CBK1 4.57e-44 155 38 9 251 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6FR35 8.78e-44 156 37 5 251 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A5DMB6 1.99e-43 155 37 7 247 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q756K6 3.21e-43 154 37 3 240 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P9WMN7 4.21e-43 153 35 2 253 1 moeZ Probable adenylyltransferase/sulfurtransferase MoeZ Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMN6 4.21e-43 153 35 2 253 3 moeZ Probable adenylyltransferase/sulfurtransferase MoeZ Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A7F582 6.41e-43 154 43 4 216 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
P38820 2.07e-42 152 36 5 248 1 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B5VK45 2.07e-42 152 36 5 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain AWRI1631)
B3LSM6 2.07e-42 152 36 5 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain RM11-1a)
A6ZT19 2.12e-42 152 36 5 248 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Saccharomyces cerevisiae (strain YJM789)
Q6CMC2 2.13e-42 152 36 4 247 3 UBA4 Adenylyltransferase and sulfurtransferase UBA4 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q2TWN3 3.46e-42 152 39 7 256 3 uba4 Adenylyltransferase and sulfurtransferase uba4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P46048 4.52e-41 144 37 2 244 2 hesA2 Protein HesA, vegetative Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P46049 5.77e-41 144 37 2 237 2 hesA1 Protein HesA, heterocyst Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O31702 1.14e-38 140 37 3 241 3 moeB Molybdopterin-synthase adenylyltransferase Bacillus subtilis (strain 168)
P46037 1.37e-37 136 36 2 237 3 hesA Protein HesA Leptolyngbya boryana
O31619 3.64e-37 136 37 4 240 3 thiF Sulfur carrier protein ThiS adenylyltransferase Bacillus subtilis (strain 168)
P18500 7.14e-37 133 36 2 232 3 hesA Protein HesA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q1XDF1 4.72e-36 134 37 3 235 3 moeB Probable molybdopterin-synthase adenylyltransferase Neopyropia yezoensis
O23034 9.25e-17 82 30 11 264 3 At1g05350 Ubiquitin-like modifier-activating enzyme 5 Arabidopsis thaliana
Q6K6K7 5.52e-16 80 30 11 265 2 Os02g0506500 Ubiquitin-like modifier-activating enzyme 5 Oryza sativa subsp. japonica
Q57097 9.18e-16 77 29 1 135 3 tcdA tRNA threonylcarbamoyladenosine dehydratase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q54C02 3.57e-15 77 29 9 227 3 uba5 Ubiquitin-like modifier-activating enzyme 5 Dictyostelium discoideum
Q9NAN1 8.43e-14 73 30 3 157 3 uba-2 SUMO-activating enzyme subunit uba-2 Caenorhabditis elegans
P20973 1.24e-12 70 31 4 156 1 UBA1 Ubiquitin-activating enzyme E1 1 Triticum aestivum
P20973 3.31e-10 63 37 3 126 1 UBA1 Ubiquitin-activating enzyme E1 1 Triticum aestivum
O42939 1.65e-12 70 29 5 171 1 uba2 Ubiquitin-activating enzyme E1-like Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5M7A4 2e-12 69 31 8 225 1 Uba5 Ubiquitin-like modifier-activating enzyme 5 Rattus norvegicus
Q8VE47 3.14e-12 68 31 8 225 1 Uba5 Ubiquitin-like modifier-activating enzyme 5 Mus musculus
P31251 5.73e-12 68 30 4 156 2 UBA2 Ubiquitin-activating enzyme E1 2 Triticum aestivum
P31251 9.02e-10 62 37 3 126 2 UBA2 Ubiquitin-activating enzyme E1 2 Triticum aestivum
Q46927 6.91e-12 67 32 2 134 1 tcdA tRNA threonylcarbamoyladenosine dehydratase Escherichia coli (strain K12)
P52488 8.18e-12 68 27 3 158 1 UBA2 Ubiquitin-activating enzyme E1-like Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P22515 9.7e-12 68 29 2 152 1 UBA1 Ubiquitin-activating enzyme E1 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P22515 5.34e-11 65 28 4 167 1 UBA1 Ubiquitin-activating enzyme E1 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B0WQV1 1.03e-11 67 30 9 225 3 CPIJ009416 Ubiquitin-like modifier-activating enzyme 5 Culex quinquefasciatus
P31254 1.24e-11 67 30 4 166 1 Uba1y Ubiquitin-like modifier-activating enzyme 1 Y Mus musculus
P31254 1.48e-05 49 28 2 157 1 Uba1y Ubiquitin-like modifier-activating enzyme 1 Y Mus musculus
Q8JGT5 1.95e-11 66 26 3 161 2 sae1 SUMO-activating enzyme subunit 1 Xenopus laevis
Q09765 2.12e-11 66 30 4 160 1 uba3 NEDD8-activating enzyme E1 catalytic subunit Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9GZZ9 3.66e-11 65 28 10 260 1 UBA5 Ubiquitin-like modifier-activating enzyme 5 Homo sapiens
Q5R8X4 3.91e-11 65 28 10 260 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Pongo abelii
Q02053 5.13e-11 65 29 3 165 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Mus musculus
Q02053 2.79e-06 51 26 2 157 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Mus musculus
Q28DS0 5.76e-11 65 26 3 161 2 sae1 SUMO-activating enzyme subunit 1 Xenopus tropicalis
Q5U300 1.47e-10 64 29 3 165 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Rattus norvegicus
Q5U300 7.97e-06 50 26 2 157 1 Uba1 Ubiquitin-like modifier-activating enzyme 1 Rattus norvegicus
B9VJ80 1.69e-10 63 29 9 222 2 None Ubiquitin-like modifier-activating enzyme 5 Bombyx mori
P92974 1.72e-10 64 29 3 155 1 UBA2 Ubiquitin-activating enzyme E1 2 Arabidopsis thaliana
P92974 7.6e-10 62 33 2 118 1 UBA2 Ubiquitin-activating enzyme E1 2 Arabidopsis thaliana
P22314 1.8e-10 64 29 3 165 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Homo sapiens
P22314 8.89e-06 50 26 2 151 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Homo sapiens
Q55C16 1.87e-10 64 27 3 165 3 uba1 Ubiquitin-like modifier-activating enzyme 1 Dictyostelium discoideum
A3KMV5 2.05e-10 63 29 3 165 2 UBA1 Ubiquitin-like modifier-activating enzyme 1 Bos taurus
A3KMV5 3.01e-06 51 26 2 151 2 UBA1 Ubiquitin-like modifier-activating enzyme 1 Bos taurus
P31252 2.14e-10 63 28 3 165 1 UBA3 Ubiquitin-activating enzyme E1 3 Triticum aestivum
P31252 2.57e-09 60 36 3 119 1 UBA3 Ubiquitin-activating enzyme E1 3 Triticum aestivum
A7MAZ3 2.33e-10 63 27 10 260 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Bos taurus
Q9SJT1 2.77e-10 63 27 2 151 1 SAE2 SUMO-activating enzyme subunit 2 Arabidopsis thaliana
Q29504 3.32e-10 63 29 3 165 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Oryctolagus cuniculus
Q29504 4.83e-06 50 26 2 151 1 UBA1 Ubiquitin-like modifier-activating enzyme 1 Oryctolagus cuniculus
C3YZ51 4.45e-10 62 28 8 223 3 BRAFLDRAFT_113714 Ubiquitin-like modifier-activating enzyme 5 Branchiostoma floridae
B4L1K2 6.45e-10 62 30 9 225 3 GI14749 Ubiquitin-like modifier-activating enzyme 5 Drosophila mojavensis
B4JIY0 6.5e-10 62 30 9 225 3 GH12371 Ubiquitin-like modifier-activating enzyme 5 Drosophila grimshawi
W0TA05 6.57e-10 62 25 7 248 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Kluyveromyces marxianus (strain DMKU3-1042 / BCC 29191 / NBRC 104275)
A6ZT79 9.92e-10 62 25 9 259 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Saccharomyces cerevisiae (strain YJM789)
P38862 1.04e-09 62 25 9 259 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6AXQ0 1.14e-09 61 28 3 150 2 Sae1 SUMO-activating enzyme subunit 1 Rattus norvegicus
Q17DT0 2.02e-09 60 29 10 225 3 AAEL004076 Ubiquitin-like modifier-activating enzyme 5 Aedes aegypti
Q6IVA4 2.24e-09 60 29 8 225 2 UBA5 Ubiquitin-like modifier-activating enzyme 5 Gallus gallus
B4PYA4 2.75e-09 60 29 9 225 3 GE15940 Ubiquitin-like modifier-activating enzyme 5 Drosophila yakuba
Q6CBC3 2.78e-09 60 28 7 199 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Yarrowia lipolytica (strain CLIB 122 / E 150)
B4M357 2.79e-09 60 30 9 225 3 GJ19153 Ubiquitin-like modifier-activating enzyme 5 Drosophila virilis
Q3KQ23 2.96e-09 60 27 11 258 2 uba5 Ubiquitin-like modifier-activating enzyme 5 Xenopus laevis
P41226 3.3e-09 60 31 4 166 1 UBA7 Ubiquitin-like modifier-activating enzyme 7 Homo sapiens
P41226 2.07e-05 48 27 2 151 1 UBA7 Ubiquitin-like modifier-activating enzyme 7 Homo sapiens
B4IK21 3.78e-09 60 29 9 225 3 GM13085 Ubiquitin-like modifier-activating enzyme 5 Drosophila sechellia
X1WER2 4.55e-09 59 27 7 228 3 uba5 Ubiquitin-like modifier-activating enzyme 5 Danio rerio
Q19360 4.57e-09 59 29 6 178 1 rfl-1 NEDD8-activating enzyme E1 catalytic subunit Caenorhabditis elegans
Q9VYY3 4.77e-09 59 29 9 225 2 Uba5 Ubiquitin-like modifier-activating enzyme 5 Drosophila melanogaster
P93028 5.61e-09 59 33 2 118 1 UBA1 Ubiquitin-activating enzyme E1 1 Arabidopsis thaliana
P93028 5.51e-08 57 28 4 156 1 UBA1 Ubiquitin-activating enzyme E1 1 Arabidopsis thaliana
B4R345 5.69e-09 59 29 9 225 3 GD17028 Ubiquitin-like modifier-activating enzyme 5 Drosophila simulans
A2VE14 5.91e-09 59 26 2 156 2 SAE1 SUMO-activating enzyme subunit 1 Bos taurus
Q6GLG7 6.86e-09 58 27 11 258 2 uba5 Ubiquitin-like modifier-activating enzyme 5 Xenopus tropicalis
Q5NVN7 7.82e-09 58 26 2 156 2 SAE1 SUMO-activating enzyme subunit 1 Pongo abelii
Q9UBE0 7.82e-09 58 26 2 156 1 SAE1 SUMO-activating enzyme subunit 1 Homo sapiens
B3NUC9 1.2e-08 58 30 8 201 3 GG18422 Ubiquitin-like modifier-activating enzyme 5 Drosophila erecta
D1GY43 1.46e-08 58 28 9 228 3 GF23479 Ubiquitin-like modifier-activating enzyme 5 Drosophila ananassae
Q9R1T2 1.48e-08 58 27 2 149 1 Sae1 SUMO-activating enzyme subunit 1 Mus musculus
P52495 1.88e-08 58 26 4 167 3 UBA1 Ubiquitin-activating enzyme E1 1 Candida albicans (strain WO-1)
P52495 2.14e-08 58 32 2 112 3 UBA1 Ubiquitin-activating enzyme E1 1 Candida albicans (strain WO-1)
Q29HT0 2.02e-08 57 29 9 225 3 GA14526 Ubiquitin-like modifier-activating enzyme 5 Drosophila pseudoobscura pseudoobscura
O94609 2.25e-08 58 26 4 168 1 ptr3 Ubiquitin-activating enzyme E1 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94609 1.51e-07 55 33 1 100 1 ptr3 Ubiquitin-activating enzyme E1 1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B4NDE5 2.27e-08 57 28 9 225 3 GK10218 Ubiquitin-like modifier-activating enzyme 5 Drosophila willistoni
Q6FQY7 3.26e-08 57 26 6 215 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9Z1F9 3.57e-08 57 24 3 146 1 Uba2 SUMO-activating enzyme subunit 2 Mus musculus
Q7SXG4 3.59e-08 57 24 2 148 1 uba2 SUMO-activating enzyme subunit 2 Danio rerio
B4GYC7 4.51e-08 56 29 8 208 3 GL19893 Ubiquitin-like modifier-activating enzyme 5 Drosophila persimilis
Q9V6U8 5.8e-08 56 28 4 167 1 Uba3 Nedd8-activating enzyme E1 catalytic subunit Drosophila melanogaster
Q9UBT2 5.87e-08 56 24 3 146 1 UBA2 SUMO-activating enzyme subunit 2 Homo sapiens
P55586 6.34e-08 56 29 5 186 4 NGR_a02280 Uncharacterized protein y4oA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O43069 6.71e-08 56 28 7 183 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54WI4 1.8e-07 54 22 2 159 3 sae1 SUMO-activating enzyme subunit 1 Dictyostelium discoideum
O93922 1.9e-07 55 27 8 233 1 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Komagataella pastoris
Q54QG9 1.9e-07 54 29 5 158 1 uba3 NEDD8-activating enzyme E1 catalytic subunit Dictyostelium discoideum
Q6IQS6 2.92e-07 53 25 3 161 2 sae1 SUMO-activating enzyme subunit 1 Danio rerio
Q28GH3 3.34e-07 54 25 2 145 2 uba2 SUMO-activating enzyme subunit 2 Xenopus tropicalis
P91430 3.43e-07 53 26 8 222 1 uba-5 Ubiquitin-like modifier-activating enzyme 5 Caenorhabditis elegans
Q7ZY60 6.12e-07 53 24 2 145 2 uba2-b SUMO-activating enzyme subunit 2-B Xenopus laevis
A3LPA1 7.45e-07 53 26 10 225 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
O32037 8.73e-07 52 31 2 143 3 tcdA tRNA threonylcarbamoyladenosine dehydratase Bacillus subtilis (strain 168)
Q642Q1 8.91e-07 53 24 2 145 2 uba2-a SUMO-activating enzyme subunit 2-A Xenopus laevis
A7TEY0 1.41e-06 52 25 11 283 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q8C7R4 1.66e-06 52 24 2 149 1 Uba6 Ubiquitin-like modifier-activating enzyme 6 Mus musculus
Q86CR9 1.72e-06 52 24 9 241 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Dictyostelium discoideum
Q5AWA2 2.22e-06 52 26 6 200 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9DBK7 4.04e-06 51 29 4 168 1 Uba7 Ubiquitin-like modifier-activating enzyme 7 Mus musculus
Q9DBK7 9.01e-06 50 32 1 105 1 Uba7 Ubiquitin-like modifier-activating enzyme 7 Mus musculus
Q59PZ3 4.83e-06 50 25 6 200 3 APG7 Ubiquitin-like modifier-activating enzyme ATG7 Candida albicans (strain SC5314 / ATCC MYA-2876)
A0AVT1 6.23e-06 50 24 3 149 1 UBA6 Ubiquitin-like modifier-activating enzyme 6 Homo sapiens
A0AVT1 0.000306 45 31 2 90 1 UBA6 Ubiquitin-like modifier-activating enzyme 6 Homo sapiens
P9WM11 6.43e-06 50 32 4 129 4 Rv1355c Uncharacterized protein Rv1355c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WM10 6.43e-06 50 32 4 129 4 MT1398 Uncharacterized protein MT1398 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q54L40 1.12e-05 49 22 3 166 3 uba2 SUMO-activating enzyme subunit 2 Dictyostelium discoideum
Q99MI7 1.26e-05 49 26 4 171 1 Uba3 NEDD8-activating enzyme E1 catalytic subunit Rattus norvegicus
Q8C878 1.27e-05 49 26 4 171 1 Uba3 NEDD8-activating enzyme E1 catalytic subunit Mus musculus
Q06624 1.69e-05 48 25 3 143 1 AOS1 DNA damage tolerance protein RHC31 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5R4A0 1.69e-05 48 26 4 171 2 UBA3 NEDD8-activating enzyme E1 catalytic subunit Pongo abelii
Q8TBC4 1.8e-05 48 26 4 171 1 UBA3 NEDD8-activating enzyme E1 catalytic subunit Homo sapiens
Q17820 2.2e-05 48 28 6 156 3 aos-1 SUMO-activating enzyme subunit aos-1 Caenorhabditis elegans
Q52CS0 2.32e-05 48 27 9 196 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A8XEQ8 2.81e-05 48 25 8 225 3 uba-5 Ubiquitin-like modifier-activating enzyme 5 Caenorhabditis briggsae
O65041 3.18e-05 48 26 3 156 1 ECR1 NEDD8-activating enzyme E1 catalytic subunit Arabidopsis thaliana
A7KAL8 3.54e-05 48 26 5 184 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A5E0T7 5.91e-05 47 25 8 203 3 ATG7 Ubiquitin-like modifier-activating enzyme ATG7 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
P38756 0.000154 46 21 1 119 1 TCD1 tRNA threonylcarbamoyladenosine dehydratase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7EI75 0.00016 46 26 7 194 3 atg7 Ubiquitin-like modifier-activating enzyme atg7 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
P42744 0.000248 45 29 1 98 1 AXR1 NEDD8-activating enzyme E1 regulatory subunit AXR1 Arabidopsis thaliana
P0DI13 0.000277 45 27 5 143 1 SAE1B-2 SUMO-activating enzyme subunit 1B-2 Arabidopsis thaliana
P0DI12 0.000277 45 27 5 143 1 SAE1B-1 SUMO-activating enzyme subunit 1B-1 Arabidopsis thaliana
G2XR75 0.000387 45 25 7 194 1 atg7 Ubiquitin-like modifier-activating enzyme atg7 Botryotinia fuckeliana (strain T4)
P55624 0.00041 45 25 4 173 4 NGR_a01950 Uncharacterized protein y4qC Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7ZVX6 0.000471 44 25 4 168 2 uba3 NEDD8-activating enzyme E1 catalytic subunit Danio rerio
M7U9B9 0.00055 44 25 7 194 1 atg7 Ubiquitin-like modifier-activating enzyme atg7 Botryotinia fuckeliana (strain BcDW1)
Q9ZV69 0.000618 44 27 1 98 1 AXL1 NEDD8-activating enzyme E1 regulatory subunit AXL Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_18040
Feature type CDS
Gene thiF
Product Molybdopterin or thiamine biosynthesis adenylyltransferase
Location 18199 - 18957 (strand: 1)
Length 759 (nucleotides) / 252 (amino acids)

Contig

Accession ZDB_539
Length 38736 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2294
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00899 ThiF family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0476 Coenzyme transport and metabolism (H) H Molybdopterin or thiamine biosynthesis adenylyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MLNDHDFMRYSRQLLLEDIGPEGQLKLKQSHAVITGLGGLGSPAALYLAAAGVGELTLIDDDEVHLSNLQRQILYTEADVPDNKARTAAARLRALNPALTLNVITERQTRETLQHIVQTADIVLDCTDNMATRHAINAACVTQQKTLVSGSAVGFSGQLLVLQPPFEHGCYCCLYPDDVIPERNCRTAGVLGPVVGVIGTLQALEAIKLLAGLPSPLNGKLRLFDGRQQSWSTLQLRRAAECPVCQEAAACA

Flanking regions ( +/- flanking 50bp)

GCAGCTGATGACACTGACCGGGGAAGCCGCTGAATATCAAGAGGTTAACCATGCTGAATGATCATGATTTTATGCGCTACAGCCGCCAGCTGCTGCTGGAGGATATCGGCCCGGAAGGTCAGCTGAAACTCAAACAGTCTCATGCGGTGATCACCGGTCTCGGCGGACTGGGATCCCCTGCGGCACTGTATCTGGCCGCCGCCGGTGTCGGTGAGCTGACCCTGATTGATGATGATGAAGTGCATCTCTCCAACCTCCAGCGCCAGATTTTATATACCGAAGCCGATGTGCCGGACAATAAAGCCCGCACTGCGGCAGCACGTCTGCGGGCGCTGAACCCGGCCCTGACACTCAATGTGATCACCGAACGTCAGACCCGGGAAACGCTGCAACACATTGTACAAACAGCAGATATTGTCCTCGACTGTACCGACAACATGGCCACCCGCCATGCCATCAACGCCGCCTGCGTAACGCAGCAAAAAACCCTGGTCAGCGGCAGTGCGGTTGGTTTCAGCGGACAACTTCTGGTACTGCAGCCGCCGTTTGAACACGGCTGCTACTGCTGCCTCTATCCGGATGATGTCATTCCGGAACGCAACTGCCGCACTGCCGGTGTGCTCGGCCCGGTTGTCGGGGTGATCGGCACACTCCAGGCGCTGGAAGCCATTAAACTGCTGGCCGGATTGCCTTCCCCGCTGAACGGGAAATTACGCCTTTTCGACGGCAGACAGCAAAGCTGGAGCACATTACAGCTCCGGCGGGCGGCAGAGTGCCCGGTGTGTCAGGAGGCAGCCGCATGCGCATAACGGTGAATGACGAGGTGATGGATATAGATCCCCCCATTACCGTCAGTGAA