Homologs in group_692

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02930 FBDBKF_02930 33.0 Morganella morganii S1 prpB methylisocitrate lyase
EHELCC_03400 EHELCC_03400 33.0 Morganella morganii S2 prpB methylisocitrate lyase
NLDBIP_00060 NLDBIP_00060 33.0 Morganella morganii S4 prpB methylisocitrate lyase
LHKJJB_01975 LHKJJB_01975 33.0 Morganella morganii S3 prpB methylisocitrate lyase
HKOGLL_02015 HKOGLL_02015 33.0 Morganella morganii S5 prpB methylisocitrate lyase
F4V73_RS05375 F4V73_RS05375 33.0 Morganella psychrotolerans prpB methylisocitrate lyase

Distribution of the homologs in the orthogroup group_692

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_692

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9G6 0.0 768 83 0 432 1 aceA Isocitrate lyase Escherichia coli (strain K12)
P0A9G7 0.0 768 83 0 432 3 aceA Isocitrate lyase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P51066 0.0 759 81 0 432 3 aceA Isocitrate lyase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9K9H0 0.0 573 66 5 430 3 aceA Isocitrate lyase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P9WKK7 0.0 532 61 6 426 1 icl Isocitrate lyase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKK6 0.0 532 61 6 426 1 icl1 Isocitrate lyase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8EVV4 0.0 532 61 6 426 1 icl1 Isocitrate lyase 1 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
P0A5H4 0.0 532 61 6 426 3 icl Isocitrate lyase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P41554 2e-178 508 58 7 428 3 icl Isocitrate lyase Rhodococcus fascians
Q8RQN6 4.3e-176 502 56 8 438 3 aceA Isocitrate lyase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P42449 5.78e-176 501 56 7 427 1 aceA Isocitrate lyase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q10663 2.02e-164 490 57 7 439 1 icl-1 Bifunctional glyoxylate cycle protein Caenorhabditis elegans
Q8NJ72 2.03e-58 203 42 3 252 2 ICL1 Isocitrate lyase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8NJ72 1.31e-32 132 38 2 178 2 ICL1 Isocitrate lyase Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9P8Q7 9.37e-54 191 40 5 263 1 ICL1 Isocitrate lyase Candida albicans
Q9P8Q7 1.62e-31 129 37 2 178 1 ICL1 Isocitrate lyase Candida albicans
Q9C124 3.9e-53 189 42 5 256 3 ICL1 Isocitrate lyase Komagataella pastoris
Q9C124 1.67e-29 124 38 2 178 3 ICL1 Isocitrate lyase Komagataella pastoris
Q6FPK7 7.8e-53 188 39 4 258 3 ICL1 Isocitrate lyase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FPK7 2.59e-35 140 40 2 178 3 ICL1 Isocitrate lyase Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P45457 1.19e-52 188 40 5 256 2 ICL2 Isocitrate lyase 2 (Fragment) Glycine max
P45457 1.57e-32 132 35 3 179 2 ICL2 Isocitrate lyase 2 (Fragment) Glycine max
P45456 1.41e-52 188 40 4 255 2 ICL1 Isocitrate lyase 1 (Fragment) Glycine max
P45456 5.55e-33 134 35 3 179 2 ICL1 Isocitrate lyase 1 (Fragment) Glycine max
P20014 2.77e-52 187 40 5 261 3 ICL1 Isocitrate lyase Candida tropicalis
P20014 3.48e-32 131 37 2 178 3 ICL1 Isocitrate lyase Candida tropicalis
P15479 4.83e-52 187 40 4 255 2 None Isocitrate lyase Ricinus communis
P15479 4.72e-33 134 38 3 179 2 None Isocitrate lyase Ricinus communis
O94198 6.57e-52 186 35 9 350 3 ICL1 Isocitrate lyase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
O94198 7.02e-34 136 36 2 178 3 ICL1 Isocitrate lyase Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q6BRY4 8.87e-52 186 40 5 261 3 ICL1 Isocitrate lyase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q6BRY4 3.62e-35 140 39 2 178 3 ICL1 Isocitrate lyase Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P17069 2.91e-51 184 40 4 255 2 None Isocitrate lyase Gossypium hirsutum
P17069 8.09e-35 139 40 3 179 2 None Isocitrate lyase Gossypium hirsutum
Q9HFN2 5.37e-51 183 37 8 317 3 ICL1 Isocitrate lyase Cyberlindnera jadinii
Q9HFN2 9.45e-32 130 36 2 178 3 ICL1 Isocitrate lyase Cyberlindnera jadinii
P49296 1.39e-50 182 40 4 255 3 None Isocitrate lyase Cucumis sativus
P49296 5.75e-35 139 40 3 179 3 None Isocitrate lyase Cucumis sativus
P28240 3.36e-50 181 36 8 317 1 ICL1 Isocitrate lyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P28240 3.13e-35 140 41 3 177 1 ICL1 Isocitrate lyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
C8V9Y5 3.77e-50 182 39 6 259 1 mclA Methylisocitrate lyase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8V9Y5 2.04e-25 112 39 5 182 1 mclA Methylisocitrate lyase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A8NR45 4.07e-50 181 39 6 266 3 ACU-7 Isocitrate lyase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A8NR45 2.73e-33 134 42 3 179 3 ACU-7 Isocitrate lyase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
O13439 1.29e-49 179 39 6 266 3 ACU-7 Isocitrate lyase Coprinopsis cinerea
O13439 9.11e-34 135 42 2 178 3 ACU-7 Isocitrate lyase Coprinopsis cinerea
P93110 1.61e-49 180 39 4 255 2 None Isocitrate lyase Cucurbita maxima
P93110 5.32e-35 140 40 3 179 2 None Isocitrate lyase Cucurbita maxima
Q6Z6M4 8.47e-49 178 39 5 256 1 ICL Isocitrate lyase Oryza sativa subsp. japonica
Q6Z6M4 4.88e-36 142 40 3 179 1 ICL Isocitrate lyase Oryza sativa subsp. japonica
P25248 1.33e-48 177 38 4 255 2 None Isocitrate lyase Brassica napus
P25248 1.22e-35 141 41 3 179 2 None Isocitrate lyase Brassica napus
L7HUY5 1.49e-48 177 35 7 289 2 ICL1 Isocitrate lyase Pyricularia oryzae (strain Y34)
L7HUY5 1.42e-34 138 41 2 178 2 ICL1 Isocitrate lyase Pyricularia oryzae (strain Y34)
P0CT06 1.57e-48 177 35 7 289 1 ICL1 Isocitrate lyase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P0CT06 1.26e-34 138 41 2 178 1 ICL1 Isocitrate lyase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
P28297 1.59e-48 177 38 4 255 1 ICL Isocitrate lyase Arabidopsis thaliana
P28297 5.26e-35 140 40 3 179 1 ICL Isocitrate lyase Arabidopsis thaliana
Q9SE26 1.9e-48 177 39 5 256 2 ICL Isocitrate lyase Dendrobium crumenatum
Q9SE26 2.02e-35 141 40 3 179 2 ICL Isocitrate lyase Dendrobium crumenatum
P41555 3.23e-48 176 37 4 258 3 ICL1 Isocitrate lyase Yarrowia lipolytica (strain CLIB 122 / E 150)
P41555 1.28e-31 130 37 2 178 3 ICL1 Isocitrate lyase Yarrowia lipolytica (strain CLIB 122 / E 150)
P49297 3.66e-48 176 39 4 255 2 None Isocitrate lyase Solanum lycopersicum
P49297 2.79e-36 143 41 3 179 2 None Isocitrate lyase Solanum lycopersicum
P28299 1.45e-47 174 36 7 288 2 acu-3 Isocitrate lyase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P28299 9.47e-32 130 38 2 178 2 acu-3 Isocitrate lyase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q43097 2.53e-47 174 41 5 238 2 ICL Isocitrate lyase Pinus taeda 8
Q43097 1.5e-35 141 40 3 179 2 ICL Isocitrate lyase Pinus taeda 8
G9NNY7 3.31e-47 173 38 6 258 3 mcl 2-methylisocitrate lyase, mitochondrial Hypocrea atroviridis (strain ATCC 20476 / IMI 206040)
G9NNY7 4.52e-31 128 40 3 179 3 mcl 2-methylisocitrate lyase, mitochondrial Hypocrea atroviridis (strain ATCC 20476 / IMI 206040)
Q6BZP5 3.59e-47 173 37 4 260 1 YALI0F31999g 2-methylisocitrate lyase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6BZP5 3.35e-33 134 43 3 179 1 YALI0F31999g 2-methylisocitrate lyase, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
Q96TP5 9.92e-47 171 36 6 261 2 ICL1 Isocitrate lyase Coccidioides immitis (strain RS)
Q96TP5 4.16e-34 137 39 2 178 2 ICL1 Isocitrate lyase Coccidioides immitis (strain RS)
P28298 1.54e-45 168 37 7 257 1 acuD Isocitrate lyase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P28298 1.04e-37 147 43 2 178 1 acuD Isocitrate lyase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q96WZ5 2.44e-45 168 35 3 256 3 icl1 Isocitrate lyase Talaromyces marneffei
Q96WZ5 4.85e-33 134 39 2 178 3 icl1 Isocitrate lyase Talaromyces marneffei
Q4HYR2 2.51e-45 168 37 5 256 1 ICL1 Isocitrate lyase Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4HYR2 2.15e-32 132 38 2 178 1 ICL1 Isocitrate lyase Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6T267 4.58e-45 167 38 5 247 3 icl1 Isocitrate lyase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6T267 1.89e-36 143 41 2 178 3 icl1 Isocitrate lyase Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q86ZF1 2.22e-44 165 35 4 256 2 ICL1 Isocitrate lyase Leptosphaeria maculans
Q86ZF1 5.87e-31 128 37 2 178 2 ICL1 Isocitrate lyase Leptosphaeria maculans
P46831 4.62e-44 165 36 6 265 3 aceA Isocitrate lyase Mycobacterium leprae (strain TN)
P46831 2.94e-23 105 49 1 99 3 aceA Isocitrate lyase Mycobacterium leprae (strain TN)
O07718 1.23e-43 159 35 3 257 1 aceAa Putative isocitrate lyase subunit A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8VJU4 1.12e-41 160 35 3 255 1 icl2 Isocitrate lyase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8VJU4 3.76e-23 105 46 2 109 1 icl2 Isocitrate lyase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
H8F3R6 1.12e-41 160 35 3 255 1 aceAb Isocitrate lyase 2 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
H8F3R6 3.76e-23 105 46 2 109 1 aceAb Isocitrate lyase 2 Mycobacterium tuberculosis (strain ATCC 35801 / TMC 107 / Erdman)
Q7TZA8 1.12e-41 160 35 3 255 3 aceA Isocitrate lyase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TZA8 3.76e-23 105 46 2 109 3 aceA Isocitrate lyase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q12031 9.94e-41 155 35 6 256 1 ICL2 Mitochondrial 2-methylisocitrate lyase ICL2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q12031 1.63e-33 135 40 4 181 1 ICL2 Mitochondrial 2-methylisocitrate lyase ICL2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O50078 7.45e-35 139 27 15 499 1 aceA Isocitrate lyase Hyphomicrobium methylovorum
Q9P6J1 2.87e-30 125 32 5 252 3 icl2 Mitochondrial 2-methylisocitrate lyase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9I0K4 3.61e-29 122 27 14 444 1 PA2634 Isocitrate lyase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
D4GTL3 2.5e-27 114 31 9 286 1 aceA Isocitrate lyase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
O07717 5.87e-24 106 46 2 109 1 aceAb Putative isocitrate lyase subunit B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P77541 2.83e-18 88 28 9 266 1 prpB 2-methylisocitrate lyase Escherichia coli (strain K12)
P54528 9.12e-18 87 39 6 169 1 mmgF 2-methylisocitrate lyase Bacillus subtilis (strain 168)
Q56062 2.15e-16 82 28 10 265 1 prpB 2-methylisocitrate lyase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9Z9T7 7.7e-16 81 37 6 169 3 mmgF 2-methylisocitrate lyase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q937P0 5.86e-15 78 27 12 301 1 prpB 2-methylisocitrate lyase Cupriavidus necator
Q9KSC2 6.19e-14 75 27 9 290 3 prpB 2-methylisocitrate lyase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9YFM7 9.06e-14 75 26 8 260 3 prpB 2-methylisocitrate lyase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q0QLE4 2.07e-13 73 26 11 308 1 Dml 2,3-dimethylmalate lyase Eubacterium barkeri
O49290 1.05e-12 72 50 2 86 1 At1g77060 Carboxyvinyl-carboxyphosphonate phosphorylmutase, chloroplastic Arabidopsis thaliana
Q8NSL2 1.36e-10 65 28 7 221 3 prpB2 Probable 2-methylisocitrate lyase 2 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8EJW1 5.16e-10 63 28 6 217 3 prpB 2-methylisocitrate lyase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8NSH8 5.74e-10 63 32 5 154 3 prpB1 Probable 2-methylisocitrate lyase 1 Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q05957 3.16e-09 61 51 2 72 1 PDP Petal death protein Dianthus caryophyllus
P11435 1.34e-08 59 36 2 84 1 bcpA Carboxyvinyl-carboxyphosphonate phosphorylmutase Streptomyces hygroscopicus
A6VZF8 1.55e-05 50 40 4 84 3 Mmwyl1_2926 Oxaloacetate decarboxylase Marinomonas sp. (strain MWYL1)
Q3KCJ2 0.000122 47 29 6 156 3 Pfl01_2772 Oxaloacetate decarboxylase 2 Pseudomonas fluorescens (strain Pf0-1)
C1DEN4 0.000127 47 40 5 86 3 Avin_20130 Oxaloacetate decarboxylase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
P20699 0.000293 42 42 2 59 2 None Isocitrate lyase (Fragment) Helianthus annuus
B1JFP4 0.00031 46 27 6 159 3 PputW619_5152 Oxaloacetate decarboxylase 2 Pseudomonas putida (strain W619)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13620
Feature type CDS
Gene aceA
Product isocitrate lyase
Location 3025813 - 3027120 (strand: -1)
Length 1308 (nucleotides) / 435 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_692
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00463 Isocitrate lyase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2224 Energy production and conversion (C) C Isocitrate lyase

Kegg Ortholog Annotation(s)

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG001381 Isocitrate lyase Icl (isocitrase) (isocitratase) VF0253 Others

Protein Sequence

MSMSRSEQIAQLEKEWEQPRWKGIKRPYSAEDVIKLRGSVNPEHTLARRGAQRLWSSLNGKSKKGYVNALGALTGGQALQQAKAGLEAIYLSGWQVAADANTAASMYPDQSLYPVDSVPNVVQRINNTFRRADQIQWSNGIGPQHKDYIDFFLPIVADAEAGFGGVLNAFELMKAMIEAGAAGVHFEDQLAAVKKCGHMGGKVLVPTQEAVQKLVAARLAADVSDVPTLLVARTDADAADLLTSDCDPYDSSFLTGERTAEGFFCTHAGIEQAISRGLAYAPYADLVWCETSTPDLKMAAKFAEAIHDKYPGKMLAYNCSPSFNWKKNLDDSTIAHFQDELSAMGYKFQFITLAGIHSMWFNMFDLAHDYAKGEGMKHYVEKVQEKEFAALSKGYTFSSHQQEVGTGYFDKVTTIIQGGMSSVTALTGSTEEQQF

Flanking regions ( +/- flanking 50bp)

AAACTGCAAATATAAAACATCATCACTACCAGATTTATAGGAGTTATTTTATGTCTATGAGTAGATCAGAGCAGATTGCCCAATTAGAAAAAGAGTGGGAACAACCTCGCTGGAAAGGGATCAAACGTCCTTATAGCGCAGAAGATGTCATTAAATTACGAGGTTCCGTTAACCCTGAACATACCTTAGCAAGACGTGGTGCGCAACGGCTTTGGTCATCATTAAATGGTAAGTCGAAGAAGGGATATGTCAATGCATTAGGTGCTTTAACAGGAGGGCAAGCATTACAGCAAGCTAAAGCGGGATTAGAAGCCATTTATCTATCTGGTTGGCAAGTGGCGGCTGATGCGAATACTGCTGCCAGTATGTACCCTGATCAATCTTTATACCCGGTGGACTCTGTACCCAATGTTGTTCAGCGTATTAATAATACGTTTAGACGAGCTGATCAAATTCAGTGGTCAAATGGTATCGGCCCTCAGCATAAAGATTATATTGATTTTTTCCTTCCTATTGTTGCTGATGCAGAAGCGGGTTTTGGTGGTGTACTTAACGCATTTGAATTAATGAAAGCAATGATTGAGGCGGGTGCAGCAGGCGTTCACTTTGAAGATCAGTTAGCCGCAGTGAAAAAATGCGGTCATATGGGCGGAAAAGTCTTAGTACCTACGCAAGAGGCTGTGCAAAAGCTGGTGGCAGCACGTTTAGCGGCAGATGTTTCGGATGTTCCTACCTTATTGGTTGCCAGAACTGATGCGGATGCGGCCGATCTCTTAACTTCAGATTGCGATCCTTACGATAGTTCATTTTTAACTGGTGAGCGTACCGCTGAAGGTTTTTTCTGTACTCATGCAGGAATTGAGCAAGCCATTAGTCGAGGGCTTGCTTATGCCCCTTATGCCGATTTGGTCTGGTGTGAGACTTCCACGCCAGATCTGAAAATGGCGGCTAAATTTGCCGAAGCGATCCATGATAAATATCCCGGTAAAATGTTAGCGTATAATTGCTCTCCATCTTTTAACTGGAAAAAGAATCTTGACGATAGCACGATCGCCCATTTCCAAGATGAGCTTTCTGCGATGGGGTATAAATTCCAGTTTATCACTTTAGCGGGTATTCATAGTATGTGGTTCAATATGTTCGATTTAGCGCATGATTACGCTAAAGGTGAAGGTATGAAACACTATGTTGAAAAGGTACAAGAAAAAGAATTTGCTGCACTATCGAAAGGCTACACCTTCTCATCTCATCAACAAGAAGTGGGCACCGGCTATTTTGATAAAGTGACGACGATTATTCAAGGTGGTATGTCATCTGTTACGGCATTAACTGGCTCTACTGAAGAGCAACAATTCTAGTCCTTACTGTGATGCACTTTTGTGGTGATAATTCAGGAGCAGGATGCTCC