Homologs in group_2420

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19535 FBDBKF_19535 79.9 Morganella morganii S1 ubiA 4-hydroxybenzoate octaprenyltransferase
EHELCC_16480 EHELCC_16480 79.9 Morganella morganii S2 ubiA 4-hydroxybenzoate octaprenyltransferase
NLDBIP_16690 NLDBIP_16690 79.9 Morganella morganii S4 ubiA 4-hydroxybenzoate octaprenyltransferase
LHKJJB_16780 LHKJJB_16780 79.9 Morganella morganii S3 ubiA 4-hydroxybenzoate octaprenyltransferase
HKOGLL_18835 HKOGLL_18835 79.9 Morganella morganii S5 ubiA 4-hydroxybenzoate octaprenyltransferase
F4V73_RS18590 F4V73_RS18590 79.2 Morganella psychrotolerans ubiA 4-hydroxybenzoate octaprenyltransferase

Distribution of the homologs in the orthogroup group_2420

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2420

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O52366 6.27e-158 444 74 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Providencia stuartii
Q7MZB6 5.77e-155 436 77 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JRU3 2.72e-140 399 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JNE6 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66FH0 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRU8 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pestis (strain Pestoides F)
Q1CE95 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYL1 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q7CKP5 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pestis
Q1C0T8 1.27e-138 395 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FN99 2.03e-138 394 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2K1U4 8.42e-138 393 73 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q3YUU4 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella sonnei (strain Ss046)
Q327U7 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q31TU8 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TX76 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LPK5 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NFY4 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AGK1 1.32e-137 392 70 0 284 1 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain K12)
B1IUL2 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AGK2 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TA22 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1XC39 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain K12 / DH10B)
C5A133 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MRH2 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O81 (strain ED1a)
B7NS04 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z181 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AGK3 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O157:H7
B7UPK1 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZUR2 1.32e-137 392 70 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0SXQ7 5.2e-137 391 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella flexneri serotype 5b (strain 8401)
B6I5Q5 5.2e-137 391 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain SE11)
A8A7E0 5.2e-137 391 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O9:H4 (strain HS)
B7M7V3 5.2e-137 391 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O8 (strain IAI1)
B7LAY8 5.2e-137 391 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain 55989 / EAEC)
Q83IP7 8.06e-137 390 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shigella flexneri
Q1R3P6 9.09e-137 390 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli (strain UTI89 / UPEC)
A1AIL7 9.09e-137 390 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O1:K1 / APEC
B7MJ30 9.09e-137 390 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A8AN88 9.17e-137 390 69 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q6D9I8 9.15e-135 385 65 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C5B704 9.26e-135 385 68 0 271 3 ubiA 4-hydroxybenzoate octaprenyltransferase Edwardsiella ictaluri (strain 93-146)
Q2NR07 4.05e-132 379 67 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Sodalis glossinidius (strain morsitans)
C6DKC9 6.06e-131 375 65 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A9MH90 5.27e-130 373 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q87KM9 5.68e-128 368 61 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C0Q4D9 1.02e-127 367 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella paratyphi C (strain RKS4594)
Q57GZ3 1.02e-127 367 69 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella choleraesuis (strain SC-B67)
Q7CPB4 3.67e-126 363 68 0 284 1 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XGZ7 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella typhi
B4TQQ2 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella schwarzengrund (strain CVM19633)
B5BJV7 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella paratyphi A (strain AKU_12601)
A9N1L3 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PL17 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T1S9 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella newport (strain SL254)
B4TDL7 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella heidelberg (strain SL476)
B5R7T3 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZ59 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella enteritidis PT4 (strain P125109)
B5FQQ8 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella dublin (strain CT_02021853)
B5F1Q3 3.67e-126 363 68 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Salmonella agona (strain SL483)
B7LL12 5.81e-126 363 67 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7N0X0 1.21e-125 362 60 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio campbellii (strain ATCC BAA-1116)
A4W5F3 1.95e-125 362 67 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Enterobacter sp. (strain 638)
B5XXZ2 3.12e-123 356 67 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Klebsiella pneumoniae (strain 342)
A6TGU9 1.31e-122 354 67 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MPP0 1.55e-119 347 65 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
B5FCB4 7.6e-119 345 60 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aliivibrio fischeri (strain MJ11)
Q6LVS3 9.78e-119 345 62 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Photobacterium profundum (strain SS9)
Q5E207 1.23e-118 344 60 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q15ZT9 8.49e-118 342 57 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B6ENU2 2.62e-117 341 60 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aliivibrio salmonicida (strain LFI1238)
Q3IHW5 3.24e-115 336 59 2 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudoalteromonas translucida (strain TAC 125)
B7VMA0 4.1e-113 330 57 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio atlanticus (strain LGP32)
B0BPA2 1.96e-111 326 58 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A0KEP9 2.95e-111 325 61 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B3H1F9 6.82e-111 325 58 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0I2 6.82e-111 325 58 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A8GZR0 8.63e-111 324 54 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
C3LPT6 2.04e-110 323 61 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KVP7 2.04e-110 323 61 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4H4 2.04e-110 323 61 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P57970 5.85e-110 322 60 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pasteurella multocida (strain Pm70)
Q7VL38 7.75e-109 319 59 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q48AL9 1.27e-108 319 56 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1T087 1.63e-108 318 63 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A1WVM9 5.62e-108 317 55 0 273 3 ubiA 4-hydroxybenzoate octaprenyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
A8GKB7 6.07e-108 317 68 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Serratia proteamaculans (strain 568)
A6W3L5 4.26e-107 315 54 2 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Marinomonas sp. (strain MWYL1)
A4STB5 1.1e-105 311 60 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aeromonas salmonicida (strain A449)
Q21DY7 4.82e-105 310 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7MQ87 9.07e-105 309 61 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio vulnificus (strain YJ016)
A3QIF2 1.69e-104 308 53 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8DD49 2.06e-104 308 61 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vibrio vulnificus (strain CMCP6)
A1U6P5 6.6e-104 307 53 1 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q8PDE8 7e-104 307 55 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RMR4 7e-104 307 55 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q4UZN6 7e-104 307 55 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas campestris pv. campestris (strain 8004)
Q3BYM7 7.98e-104 307 55 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B6J612 1.5e-103 306 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Coxiella burnetii (strain CbuK_Q154)
Q83F93 1.54e-103 306 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KGW7 1.54e-103 306 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Coxiella burnetii (strain Dugway 5J108-111)
B6J375 1.54e-103 306 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Coxiella burnetii (strain CbuG_Q212)
Q0I0W3 3.45e-103 305 56 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Histophilus somni (strain 129Pt)
A9N9X0 5.28e-103 305 54 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A8FQF8 9.51e-103 304 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella sediminis (strain HAW-EB3)
B0UUY3 1.81e-102 303 56 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Histophilus somni (strain 2336)
Q8PQD5 2.86e-102 303 54 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas axonopodis pv. citri (strain 306)
B0TRE7 4.25e-102 302 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella halifaxensis (strain HAW-EB4)
B1KKU2 1.13e-101 301 50 0 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q07XN2 1.7e-101 301 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella frigidimarina (strain NCIMB 400)
A1K2P1 3.68e-101 300 51 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Azoarcus sp. (strain BH72)
Q0A5V9 4.17e-101 300 57 1 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q1QSG2 1.17e-100 299 54 0 269 3 ubiA 4-hydroxybenzoate octaprenyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q4ZLB4 1.2e-100 299 53 0 273 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q5H5R3 4.18e-100 298 53 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SS70 4.18e-100 298 53 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P8F5 4.18e-100 298 53 2 272 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q87U39 1.86e-99 296 52 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48BQ5 8.85e-99 294 52 0 273 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2SNV5 1.56e-98 294 52 2 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Hahella chejuensis (strain KCTC 2396)
A6WT76 2.86e-98 293 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella baltica (strain OS185)
A9L4Q8 3.12e-98 292 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella baltica (strain OS195)
B8E613 3.12e-98 292 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella baltica (strain OS223)
A3CZR1 3.64e-98 292 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8CTT5 4.63e-98 292 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q87F82 9.04e-98 292 50 0 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I675 9.04e-98 292 50 0 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xylella fastidiosa (strain M23)
B0U2A2 1.17e-97 291 50 0 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xylella fastidiosa (strain M12)
Q5P5M0 1.27e-97 291 51 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2Y5S3 3.8e-97 290 51 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q8EJJ5 6.62e-97 289 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q494A7 4.42e-96 287 51 1 271 3 ubiA 4-hydroxybenzoate octaprenyltransferase Blochmanniella pennsylvanica (strain BPEN)
Q9PH76 2.3e-95 286 50 0 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Xylella fastidiosa (strain 9a5c)
A4VGN3 7.62e-95 284 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Stutzerimonas stutzeri (strain A1501)
A1S2M4 7.78e-95 284 51 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A0KSE2 1.11e-94 283 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella sp. (strain ANA-3)
A1RFH5 1.42e-94 283 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella sp. (strain W3-18-1)
A4YAV1 1.42e-94 283 52 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q82TP2 1.73e-94 283 52 2 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
C4L7X6 4.96e-94 282 58 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q39JF0 5.91e-94 281 51 2 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q608Z9 1.4e-93 281 54 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q0HQR8 1.53e-93 281 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella sp. (strain MR-7)
Q0HN13 1.53e-93 281 51 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella sp. (strain MR-4)
Q3K4G3 2.31e-93 280 49 0 273 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q3JBS8 2.52e-93 280 52 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q4K3L9 4.39e-93 280 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1YTH7 6.58e-93 279 50 2 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia ambifaria (strain MC40-6)
Q0BI45 7.33e-93 279 50 2 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q31DM4 8.26e-93 279 49 1 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q0AGZ9 8.63e-93 279 52 2 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B1JVZ5 8.63e-93 279 50 2 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia orbicola (strain MC0-3)
Q9HTK0 1.28e-92 278 50 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V5P9 1.28e-92 278 50 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas aeruginosa (strain LESB58)
Q1BYZ6 1.68e-92 278 50 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia orbicola (strain AU 1054)
A0K4Q5 1.68e-92 278 50 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia cenocepacia (strain HI2424)
B2JGG3 4.73e-92 277 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
B1J454 5.94e-92 277 48 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas putida (strain W619)
Q02E04 1.02e-91 276 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
A4Y0P0 1.32e-91 276 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas mendocina (strain ymp)
A6VEG6 2.5e-91 275 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas aeruginosa (strain PA7)
A9AGE2 3.96e-91 275 48 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q5QUP3 6.61e-91 274 50 2 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q1I2R3 8.39e-91 274 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas entomophila (strain L48)
A6SUU0 1.37e-90 273 49 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Janthinobacterium sp. (strain Marseille)
A4G1Y9 2.61e-90 272 49 0 280 3 ubiA 4-hydroxybenzoate octaprenyltransferase Herminiimonas arsenicoxydans
C1DK47 5.46e-90 272 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q0VTA7 5.59e-90 271 53 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1GXB3 6.15e-90 272 49 1 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q2SZ16 6.37e-90 271 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63R13 9.33e-90 271 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia pseudomallei (strain K96243)
Q3JNX1 9.33e-90 271 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia pseudomallei (strain 1710b)
Q62H69 9.33e-90 271 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia mallei (strain ATCC 23344)
A3MPC2 9.33e-90 271 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia mallei (strain NCTC 10247)
A4JBP9 1.49e-89 271 50 2 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A3NDA6 3.52e-89 270 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia pseudomallei (strain 668)
A3NZ16 3.52e-89 270 49 0 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Burkholderia pseudomallei (strain 1106a)
Q88C65 4.32e-89 270 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5WB34 4.32e-89 270 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KQB7 7.45e-89 269 49 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas putida (strain GB-1)
Q47J11 7.53e-89 269 51 1 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Dechloromonas aromatica (strain RCB)
C3K4C4 7.75e-88 266 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Pseudomonas fluorescens (strain SBW25)
B2SXA0 2.05e-87 265 50 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q12S01 4.48e-87 264 50 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A5CXV6 1.53e-86 262 49 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
A1KSZ7 1.84e-86 263 47 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M390 1.84e-86 263 47 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria meningitidis serogroup C (strain 053442)
B4RK00 1.96e-86 263 47 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F9S8 3.28e-86 262 47 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q145H3 6.47e-86 261 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Paraburkholderia xenovorans (strain LB400)
Q9K083 1.38e-85 261 47 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7VQU0 7.03e-85 258 45 2 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Blochmanniella floridana
Q3SLJ4 7.46e-85 259 48 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q12GA4 2.15e-84 257 47 0 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9JV93 9.09e-84 256 46 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1TJR2 1.9e-81 250 48 2 279 3 ubiA 4-hydroxybenzoate octaprenyltransferase Paracidovorax citrulli (strain AAC00-1)
Q4FR08 2.06e-81 250 48 2 291 3 ubiA 4-hydroxybenzoate octaprenyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6F9N8 4.45e-81 249 49 3 282 3 ubiA 4-hydroxybenzoate octaprenyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1VJ21 7.76e-81 248 46 0 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Polaromonas naphthalenivorans (strain CJ2)
Q1LJ64 6.05e-78 241 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A1WKC0 9.12e-78 241 45 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Verminephrobacter eiseniae (strain EF01-2)
Q1Q996 1.58e-77 241 46 3 292 3 ubiA 4-hydroxybenzoate octaprenyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q46XG9 2.09e-77 239 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4SZT5 5.42e-75 233 46 2 281 3 ubiA 4-hydroxybenzoate octaprenyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
B1XRV6 7.84e-75 233 45 0 277 3 ubiA 4-hydroxybenzoate octaprenyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q21S73 1.08e-74 233 46 3 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B0U042 2.54e-74 231 43 2 284 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A2SMA7 2.49e-73 230 46 3 287 3 ubiA 4-hydroxybenzoate octaprenyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q0K739 2.09e-72 227 49 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q5WWR8 4.81e-70 221 45 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Legionella pneumophila (strain Lens)
Q8XVY9 6.13e-70 221 45 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A1W307 2.41e-69 219 41 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Acidovorax sp. (strain JS42)
B9MBT5 2.41e-69 219 41 0 275 3 ubiA 4-hydroxybenzoate octaprenyltransferase Acidovorax ebreus (strain TPSY)
Q5X5D5 7.4e-69 218 45 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Legionella pneumophila (strain Paris)
Q5ZVL0 2.19e-68 216 45 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IBS2 2.81e-68 216 45 0 270 3 ubiA 4-hydroxybenzoate octaprenyltransferase Legionella pneumophila (strain Corby)
A0Q4X3 6.7e-64 205 40 0 283 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. novicida (strain U112)
A4IYU3 1.47e-63 204 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
A7NA50 1.47e-63 204 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SF41 1.75e-63 204 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A564 1.75e-63 204 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. holarctica (strain LVS)
Q5NGI4 6.86e-63 202 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HY6 6.86e-63 202 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q0BNI0 9.59e-63 202 40 0 276 3 ubiA 4-hydroxybenzoate octaprenyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q54U71 2.65e-62 206 40 3 273 3 coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Dictyostelium discoideum
Q9VHS7 7.76e-57 190 39 5 281 2 Coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Drosophila melanogaster
Q298G6 1.8e-56 189 39 5 281 3 Coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Drosophila pseudoobscura pseudoobscura
Q96H96 3.86e-56 187 37 2 279 1 COQ2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Homo sapiens
Q16QL3 5.03e-56 189 37 2 277 3 coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Aedes aegypti
Q2KIQ4 1.45e-54 184 37 2 279 2 COQ2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Bos taurus
Q499N4 1.52e-54 184 37 2 279 1 Coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Rattus norvegicus
Q66JT7 7.02e-53 179 37 2 279 1 Coq2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Mus musculus
Q55500 4.63e-51 172 34 1 281 1 plqA 4-hydroxybenzoate solanesyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8I7J4 2.03e-50 172 36 4 280 3 coq-2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Caenorhabditis elegans
Q8W405 7.04e-49 167 34 3 279 1 PGT-1 4-hydroxybenzoate geranyltransferase 1 Lithospermum erythrorhizon
Q10252 1.19e-48 168 33 5 295 1 ppt1 4-hydroxybenzoate polyprenyltransferase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8W404 3.34e-47 162 34 1 275 1 PGT-2 4-hydroxybenzoate geranyltransferase 2 Lithospermum erythrorhizon
Q93YP7 4.12e-46 162 34 2 279 2 PPT1 4-hydroxybenzoate polyprenyltransferase, mitochondrial Arabidopsis thaliana
P32378 2.5e-38 141 35 2 229 1 COQ2 4-hydroxybenzoate polyprenyltransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A455R413 1.05e-29 117 29 4 244 1 ascA Prenytransferase ascA Acremonium egyptiacum
A0A097ZPE3 3.9e-27 110 31 4 239 1 andD Polyprenyl transferase andD Emericella variicolor
A0A193PS58 8.95e-27 109 31 6 245 1 stbC Prenyltransferase stbC Stachybotrys bisbyi
G1XTZ7 1.32e-26 110 36 7 233 2 AOL_s00215g276 Polyprenyl transferase AOL_s00215g276 Arthrobotrys oligospora (strain ATCC 24927 / CBS 115.81 / DSM 1491)
B6HV35 2.45e-26 108 33 11 251 1 adrG Prenytransferase adrG Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A0A1Y0BRF7 8.46e-24 101 31 9 246 3 adrG Prenytransferase adrG Penicillium roqueforti
A0A2P1DP87 1.28e-23 100 32 3 193 3 macG Polyprenyl transferase macG Penicillium terrestre
A0A455LRX2 4.23e-23 99 34 6 234 2 atnF Polyprenyl transferase atnF Arthrinium sp.
Q5AR21 5.39e-22 96 36 3 153 3 ausN Polyprenyl transferase ausN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q0C8A6 2.68e-21 95 34 9 218 1 trt2 Polyprenyl transferase trt2 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A1E1FFM8 5e-21 94 31 8 239 3 prhE Polyprenyl transferase prhE Penicillium brasilianum
A0A0F7TXA1 3.45e-20 91 28 10 298 3 ausN Polyprenyl transferase ausN Penicillium brasilianum
A0A0U5CJV1 1.51e-19 90 35 4 163 1 ausN Polyprenyl transferase ausN Aspergillus calidoustus
A0A455LM21 2.52e-19 89 35 5 177 2 ntnF Polyprenyl transferase ntnF Nectria sp.
A0A2I1BT09 7.03e-19 88 32 7 210 1 nvfB DMOA farnesyltransferase nvfB Aspergillus novofumigatus (strain IBT 16806)
G3Y418 1.75e-17 84 32 6 191 1 yanG Polyprenyl transferase yanG Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q1J1C3 1.05e-16 81 27 6 258 3 ctaB Protoheme IX farnesyltransferase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q3MFT6 1.24e-15 79 33 6 204 3 ctaB Protoheme IX farnesyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q4WLD0 1.47e-15 78 28 11 274 1 pyr6 Polyprenyl transferase pyr6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8YYA3 1.5e-15 78 30 9 264 3 ctaB Protoheme IX farnesyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7K336 1.58e-15 78 31 8 217 3 ctaB Protoheme IX farnesyltransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q0BBM3 2.45e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1BTD0 2.89e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia orbicola (strain AU 1054)
B1JZ41 2.89e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia orbicola (strain MC0-3)
B4EA84 2.89e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0KAR0 2.89e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia cenocepacia (strain HI2424)
B1YN86 2.98e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia ambifaria (strain MC40-6)
A4JI25 3.22e-15 77 26 8 292 3 ctaB Protoheme IX farnesyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8DHQ2 3.57e-15 77 30 10 261 3 ctaB Protoheme IX farnesyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P9WEQ7 3.67e-15 77 28 6 194 3 olcH Polyprenyl transferase olcH Penicillium canescens
Q39CQ5 4.15e-15 77 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A4G936 5.49e-15 76 28 4 182 3 ctaB Protoheme IX farnesyltransferase Herminiimonas arsenicoxydans
A0A1B7YCK2 7.33e-15 76 32 6 189 1 dpchC Polyprenyl transferase dpchC Colletotrichum higginsianum (strain IMI 349063)
W6QIT8 1.16e-14 76 27 7 220 3 mpaA Polyprenyl transferase mpaA Penicillium roqueforti (strain FM164)
B8HMH3 1.38e-14 75 32 6 196 3 ctaB Protoheme IX farnesyltransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
F1DBA7 1.52e-14 75 32 6 176 1 mpaA Polyprenyl transferase mpaA Penicillium brevicompactum
A0A0B5L778 1.72e-14 75 32 6 176 1 mpaA' Polyprenyl transferase mpaA' Penicillium brevicompactum
P9WEX8 1.88e-14 75 31 3 185 1 dpasC Polyprenyl transferase dpmaC Metarhizium anisopliae
A4YC13 1.98e-14 75 27 8 285 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q82VQ6 2.79e-14 74 26 6 251 3 ctaB Protoheme IX farnesyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A0A3G9GNJ4 4.89e-14 74 32 5 179 1 cdmH 6-hydroxymellein 5-farnesyltransferase cdmH Talaromyces verruculosus
A1RE84 1.14e-13 73 26 8 285 3 cyoE2 Protoheme IX farnesyltransferase 2 Shewanella sp. (strain W3-18-1)
Q5B8A2 1.32e-13 73 27 10 292 2 pkfkE Prenyltransferase pkfE Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1UZV8 1.6e-13 72 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia mallei (strain SAVP1)
Q62F61 1.6e-13 72 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia mallei (strain ATCC 23344)
A2S646 1.6e-13 72 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia mallei (strain NCTC 10229)
A3MQ44 1.6e-13 72 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia mallei (strain NCTC 10247)
Q089F2 1.98e-13 72 26 8 286 3 cyoE2 Protoheme IX farnesyltransferase 2 Shewanella frigidimarina (strain NCIMB 400)
A6T2T7 3.55e-13 71 25 4 182 3 ctaB Protoheme IX farnesyltransferase Janthinobacterium sp. (strain Marseille)
Q0ADH9 3.65e-13 71 24 5 245 3 ctaB Protoheme IX farnesyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q63XS7 4.73e-13 71 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia pseudomallei (strain K96243)
A3N5D1 4.73e-13 71 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia pseudomallei (strain 668)
Q3JWF7 4.73e-13 71 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia pseudomallei (strain 1710b)
A3NR29 4.73e-13 71 25 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia pseudomallei (strain 1106a)
B8GPF3 6.42e-13 70 25 5 241 3 cyoE Protoheme IX farnesyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q2NV87 7.1e-13 70 30 2 160 3 cyoE Protoheme IX farnesyltransferase Sodalis glossinidius (strain morsitans)
Q5SLI3 8.25e-13 71 27 5 224 3 ctaB Protoheme IX farnesyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72H22 8.64e-13 71 27 5 224 3 ctaB Protoheme IX farnesyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q0HDK5 8.93e-13 70 27 9 254 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella sp. (strain MR-4)
Q9RR78 9.92e-13 70 27 7 215 3 ctaB Protoheme IX farnesyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q2T1F6 1.05e-12 70 24 6 291 3 ctaB Protoheme IX farnesyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
P9WEX2 1.25e-12 70 32 5 169 1 dpasC Polyprenyl transferase dpasC Apiospora sacchari
Q0HPV6 1.78e-12 69 27 8 254 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella sp. (strain MR-7)
Q67ML5 1.82e-12 69 29 8 257 3 ctaB Protoheme IX farnesyltransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B0C0A5 1.83e-12 69 29 4 195 3 ctaB Protoheme IX farnesyltransferase Acaryochloris marina (strain MBIC 11017)
A1TWQ8 2.24e-12 69 25 6 290 3 cyoE Protoheme IX farnesyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A0L2E7 3e-12 68 26 7 252 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella sp. (strain ANA-3)
Q114N4 3.12e-12 69 28 3 209 3 ctaB Protoheme IX farnesyltransferase Trichodesmium erythraeum (strain IMS101)
Q6LVR2 3.19e-12 68 26 5 236 3 cyoE Protoheme IX farnesyltransferase Photobacterium profundum (strain SS9)
I1RL16 3.44e-12 69 31 5 176 1 dpfgC Polyprenyl transferase dpfgC Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A7NRY4 4.75e-12 69 28 5 241 3 ctaB Protoheme IX farnesyltransferase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
A3CYW8 5.26e-12 68 26 7 259 3 cyoE Protoheme IX farnesyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
A9KUX8 5.26e-12 68 26 7 259 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella baltica (strain OS195)
A6WU15 6.31e-12 68 26 7 259 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella baltica (strain OS185)
A7HQW1 7.41e-12 68 30 7 193 3 ctaB Protoheme IX farnesyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4VS42 8.77e-12 67 25 12 291 3 cyoE Protoheme IX farnesyltransferase Stutzerimonas stutzeri (strain A1501)
Q1LRS0 1.54e-11 67 28 4 194 3 ctaB Protoheme IX farnesyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
B1XKB3 1.83e-11 67 28 9 259 3 ctaB Protoheme IX farnesyltransferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B7KHX2 2.11e-11 66 30 8 254 3 ctaB Protoheme IX farnesyltransferase Gloeothece citriformis (strain PCC 7424)
B0TNS4 2.25e-11 66 26 8 286 3 cyoE Protoheme IX farnesyltransferase Shewanella halifaxensis (strain HAW-EB4)
B0SMP1 2.35e-11 66 24 5 231 3 ctaB Protoheme IX farnesyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SE58 2.35e-11 66 24 5 231 3 ctaB Protoheme IX farnesyltransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q5JDN5 2.39e-11 66 28 11 266 3 TK1957 Digeranylgeranylglyceryl phosphate synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8Y2G4 2.46e-11 66 24 7 283 3 ctaB Protoheme IX farnesyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q15N01 2.57e-11 66 25 6 237 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8F9F8 2.72e-11 66 26 3 163 3 ctaB Protoheme IX farnesyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72VU2 2.72e-11 66 26 3 163 3 ctaB Protoheme IX farnesyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q829U3 3.02e-11 66 29 4 190 3 ctaB Protoheme IX farnesyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B1KM58 3.57e-11 65 26 8 286 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella woodyi (strain ATCC 51908 / MS32)
Q3J6R6 3.99e-11 65 26 4 190 3 cyoE Protoheme IX farnesyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q055W1 4.87e-11 65 25 3 166 3 ctaB Protoheme IX farnesyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04PG4 4.87e-11 65 25 3 166 3 ctaB Protoheme IX farnesyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q1H1S8 5.68e-11 65 26 2 161 3 ctaB Protoheme IX farnesyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4XNK8 7.12e-11 65 26 7 251 3 cyoE Protoheme IX farnesyltransferase Pseudomonas mendocina (strain ymp)
Q476H8 9.52e-11 64 26 7 260 3 ctaB Protoheme IX farnesyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q2JQK9 1e-10 64 29 10 274 3 ctaB Protoheme IX farnesyltransferase Synechococcus sp. (strain JA-3-3Ab)
B2VHR9 1.17e-10 64 28 2 160 3 cyoE Protoheme IX farnesyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7W316 1.18e-10 64 25 4 180 3 ctaB Protoheme IX farnesyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WE16 1.18e-10 64 25 4 180 3 ctaB Protoheme IX farnesyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8E8P7 1.23e-10 64 27 7 212 3 cyoE Protoheme IX farnesyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q87IR2 1.51e-10 63 28 7 222 3 cyoE1 Protoheme IX farnesyltransferase 1 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B2AGR8 1.59e-10 63 26 4 194 3 ctaB Protoheme IX farnesyltransferase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A7N6I9 1.74e-10 63 27 7 222 3 cyoE2 Protoheme IX farnesyltransferase 2 Vibrio campbellii (strain ATCC BAA-1116)
Q60CP3 1.95e-10 63 24 6 248 3 cyoE Protoheme IX farnesyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q146A1 1.97e-10 63 25 6 233 3 ctaB Protoheme IX farnesyltransferase Paraburkholderia xenovorans (strain LB400)
A3Q941 2.07e-10 63 26 7 259 3 cyoE1 Protoheme IX farnesyltransferase 1 Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q7VT22 2.27e-10 63 25 4 180 3 ctaB Protoheme IX farnesyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0KER8 2.43e-10 63 26 4 194 3 ctaB Protoheme IX farnesyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A8LW09 2.5e-10 63 26 7 250 3 ctaB Protoheme IX farnesyltransferase Salinispora arenicola (strain CNS-205)
Q2YCM2 2.54e-10 63 25 6 223 3 ctaB Protoheme IX farnesyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q6AF34 2.62e-10 63 30 12 260 3 ctaB Protoheme IX farnesyltransferase Leifsonia xyli subsp. xyli (strain CTCB07)
A0A3T0ZHL4 2.91e-10 63 31 6 174 1 cle5 Polyprenyl transferase cle5 Aspergillus versicolor
Q7P0G0 3e-10 63 26 9 232 3 ctaB1 Protoheme IX farnesyltransferase 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q8K997 3.02e-10 63 32 5 149 3 cyoE Protoheme IX farnesyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q7MDC8 3.91e-10 62 25 10 290 3 cyoE Protoheme IX farnesyltransferase Vibrio vulnificus (strain YJ016)
Q8D6H2 4.99e-10 62 24 9 290 3 cyoE Protoheme IX farnesyltransferase Vibrio vulnificus (strain CMCP6)
Q48AB7 5.02e-10 62 27 6 205 3 cyoE Protoheme IX farnesyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A8H9S9 5.35e-10 62 26 9 288 3 cyoE Protoheme IX farnesyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q1LTJ4 5.39e-10 62 33 4 130 3 cyoE Protoheme IX farnesyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
B6YW76 5.47e-10 62 28 11 247 3 TON_1950 Digeranylgeranylglyceryl phosphate synthase Thermococcus onnurineus (strain NA1)
C5BFX0 5.49e-10 62 26 2 174 3 cyoE Protoheme IX farnesyltransferase Edwardsiella ictaluri (strain 93-146)
Q1IGZ4 5.54e-10 62 25 10 289 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas entomophila (strain L48)
C6DB46 6.32e-10 62 27 2 160 3 cyoE Protoheme IX farnesyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D836 7.63e-10 62 27 2 160 3 cyoE Protoheme IX farnesyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4IZX0 8.52e-10 61 25 5 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BNW5 8.52e-10 61 25 5 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
A0Q4E4 8.52e-10 61 25 5 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. novicida (strain U112)
A9HWL4 8.68e-10 62 25 5 196 3 ctaB Protoheme IX farnesyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2IR91 9.62e-10 62 28 8 235 3 ctaB Protoheme IX farnesyltransferase Rhodopseudomonas palustris (strain HaA2)
Q79EF2 1.08e-09 61 28 6 204 3 ctaB Protoheme IX farnesyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2A5L1 1.13e-09 61 25 5 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7N9N4 1.19e-09 61 25 3 243 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
P9WEW7 1.61e-09 61 28 5 195 1 dpmpC Polyprenyl transferase dpmpC Macrophomina phaseolina (strain MS6)
B1XS75 1.61e-09 60 22 6 261 3 ctaB Protoheme IX farnesyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
B0KFZ0 2.18e-09 60 26 6 260 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas putida (strain GB-1)
A7MFG8 2.26e-09 60 26 2 160 3 cyoE Protoheme IX farnesyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q6F9R1 2.7e-09 60 29 4 169 3 cyoE Protoheme IX farnesyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A4X9F8 2.97e-09 60 25 2 247 3 ctaB Protoheme IX farnesyltransferase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A8FPN0 3.01e-09 60 29 6 193 3 cyoE Protoheme IX farnesyltransferase Shewanella sediminis (strain HAW-EB3)
Q493G3 3.39e-09 60 27 5 179 3 cyoE Protoheme IX farnesyltransferase Blochmanniella pennsylvanica (strain BPEN)
C5D862 3.49e-09 60 27 5 205 3 ctaB Protoheme IX farnesyltransferase Geobacillus sp. (strain WCH70)
A6VRF6 3.53e-09 60 23 2 194 3 cyoE Protoheme IX farnesyltransferase Marinomonas sp. (strain MWYL1)
Q9I719 3.66e-09 60 24 6 282 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02UW5 3.66e-09 60 24 6 282 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
A4T079 4.05e-09 59 23 4 211 3 ctaB Protoheme IX farnesyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A6UXP9 4.05e-09 60 24 6 282 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas aeruginosa (strain PA7)
A8GAQ0 4.14e-09 59 26 2 160 3 cyoE Protoheme IX farnesyltransferase Serratia proteamaculans (strain 568)
Q0ABY1 4.36e-09 59 25 4 220 3 cyoE Protoheme IX farnesyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q88RL9 4.4e-09 59 26 6 260 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A1AV76 4.98e-09 59 30 5 150 3 cyoE Protoheme IX farnesyltransferase Ruthia magnifica subsp. Calyptogena magnifica
A8FCU6 5.15e-09 59 27 6 218 3 ctaB Protoheme IX farnesyltransferase Bacillus pumilus (strain SAFR-032)
A5VWP2 5.36e-09 59 27 5 221 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A1KAQ4 5.89e-09 59 27 4 173 3 ctaB Protoheme IX farnesyltransferase Azoarcus sp. (strain BH72)
Q12IC7 6.42e-09 59 26 8 252 3 cyoE Protoheme IX farnesyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q4KKL2 6.75e-09 59 24 7 285 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1SY55 6.96e-09 59 29 9 214 3 cyoE Protoheme IX farnesyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0RH20 7.5e-09 58 28 9 267 3 ctaB Protoheme IX farnesyltransferase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q3SLW5 7.9e-09 58 25 3 177 3 ctaB Protoheme IX farnesyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q9XAC2 8.86e-09 58 27 4 190 3 ctaB Protoheme IX farnesyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A1JNP6 1.07e-08 58 27 2 160 3 cyoE Protoheme IX farnesyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2JNL3 1.12e-08 58 27 10 276 3 ctaB Protoheme IX farnesyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6L147 1.14e-08 58 26 5 176 3 ctaB1 Protoheme IX farnesyltransferase 1 Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A6T5H1 1.21e-08 58 26 2 160 3 cyoE Protoheme IX farnesyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1W108 1.28e-08 58 25 4 227 3 ctaB Protoheme IX farnesyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C1DG34 1.39e-08 58 26 5 210 3 cyoE Protoheme IX farnesyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A9MM32 1.41e-08 58 27 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5N1X0 1.89e-08 58 30 5 198 3 ctaB Protoheme IX farnesyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31JY9 1.89e-08 58 30 5 198 3 ctaB Protoheme IX farnesyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q2KTX0 2.05e-08 57 22 6 212 3 ctaB Protoheme IX farnesyltransferase Bordetella avium (strain 197N)
A0A8D5M7V9 2.4e-08 57 30 8 203 1 esdpC Polyprenyl transferase esdpC Penicillium shearii
Q21PS1 2.58e-08 57 25 4 174 3 cyoE Protoheme IX farnesyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7VRH6 2.94e-08 57 29 5 176 3 cyoE Protoheme IX farnesyltransferase Blochmanniella floridana
Q83SF7 3.16e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Shigella flexneri
A5UPV7 3.38e-08 57 28 6 244 3 ctaB Protoheme IX farnesyltransferase Roseiflexus sp. (strain RS-1)
B1J467 3.49e-08 57 25 7 285 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas putida (strain W619)
Q8Z8V5 3.64e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella typhi
Q8ZRC4 3.71e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFP5 3.71e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SC4 3.71e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella choleraesuis (strain SC-B67)
A9MWZ0 3.72e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q1RFB2 3.74e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli (strain UTI89 / UPEC)
Q0TKL4 3.74e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A897 3.74e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O1:K1 / APEC
Q5R0Y6 3.74e-08 57 25 11 288 3 cyoE Protoheme IX farnesyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q325H3 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Shigella boydii serotype 4 (strain Sb227)
B1LJI2 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
P0AEA5 3.81e-08 57 26 2 160 1 cyoE Protoheme IX farnesyltransferase Escherichia coli (strain K12)
B1J021 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AEA6 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A7ZX84 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O9:H4 (strain HS)
B1XFL6 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli (strain K12 / DH10B)
P0AEA7 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O157:H7
A7ZII5 3.81e-08 57 26 2 160 3 cyoE Protoheme IX farnesyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
A1SBD7 4.13e-08 57 28 7 251 3 cyoE Protoheme IX farnesyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B6EQE1 4.57e-08 56 32 6 166 3 cyoE Protoheme IX farnesyltransferase Aliivibrio salmonicida (strain LFI1238)
A5CXZ0 4.66e-08 56 28 5 150 3 cyoE Protoheme IX farnesyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q73I75 5.06e-08 56 33 8 169 3 ctaB Protoheme IX farnesyltransferase Wolbachia pipientis wMel
Q3Z4X5 5.63e-08 56 26 2 160 3 cyoE Protoheme IX farnesyltransferase Shigella sonnei (strain Ss046)
Q5NI07 5.67e-08 56 24 4 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JF9 5.67e-08 56 24 4 244 3 cyoE Protoheme IX farnesyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q2SQU8 6.63e-08 56 28 9 221 3 cyoE Protoheme IX farnesyltransferase Hahella chejuensis (strain KCTC 2396)
B3CN58 6.87e-08 56 29 12 239 3 ctaB Protoheme IX farnesyltransferase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q4ZXC3 7.26e-08 56 25 2 161 3 cyoE Protoheme IX farnesyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q3KK91 7.62e-08 56 24 7 285 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudomonas fluorescens (strain Pf0-1)
Q5P2E3 7.95e-08 56 26 4 173 3 ctaB Protoheme IX farnesyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q6G4C6 9.72e-08 55 26 5 183 3 ctaB Protoheme IX farnesyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2JCG7 9.84e-08 55 29 10 266 3 ctaB Protoheme IX farnesyltransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q6MBY2 1.17e-07 55 27 6 185 3 ctaB Protoheme IX farnesyltransferase Protochlamydia amoebophila (strain UWE25)
B1KQ72 1.17e-07 55 27 4 162 3 cyoE2 Protoheme IX farnesyltransferase 2 Shewanella woodyi (strain ATCC 51908 / MS32)
Q9V2P5 1.24e-07 55 28 11 228 3 PYRAB00300 Digeranylgeranylglyceryl phosphate synthase Pyrococcus abyssi (strain GE5 / Orsay)
Q04444 1.31e-07 55 30 8 163 3 ctaB Protoheme IX farnesyltransferase Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
A8AK26 1.33e-07 55 26 2 160 3 cyoE Protoheme IX farnesyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0C3D1 1.43e-07 55 28 2 155 3 ctaB Protoheme IX farnesyltransferase Hyphomonas neptunium (strain ATCC 15444)
B0T0X6 1.44e-07 55 27 6 213 3 ctaB Protoheme IX farnesyltransferase Caulobacter sp. (strain K31)
C5BKU5 1.52e-07 55 23 10 291 3 cyoE Protoheme IX farnesyltransferase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q65K13 1.55e-07 55 29 5 143 3 ctaB Protoheme IX farnesyltransferase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q13CY5 1.62e-07 55 27 8 235 3 ctaB Protoheme IX farnesyltransferase Rhodopseudomonas palustris (strain BisB5)
Q6MR11 1.69e-07 55 23 8 228 3 ctaB Protoheme IX farnesyltransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
C0R2X3 1.7e-07 55 33 8 169 3 ctaB Protoheme IX farnesyltransferase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q8CXI8 1.8e-07 55 25 3 175 3 ctaB Protoheme IX farnesyltransferase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0HDH7 2.15e-07 54 25 5 197 3 cyoE2 Protoheme IX farnesyltransferase 2 Shewanella sp. (strain MR-4)
Q887G7 2.29e-07 54 24 2 161 3 cyoE Protoheme IX farnesyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5WZC7 2.41e-07 54 28 4 175 3 cyoE Protoheme IX farnesyltransferase Legionella pneumophila (strain Lens)
Q15WB8 2.69e-07 54 23 2 239 3 cyoE1 Protoheme IX farnesyltransferase 1 Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q6G0D0 2.7e-07 54 27 7 198 3 ctaB Protoheme IX farnesyltransferase Bartonella quintana (strain Toulouse)
Q5ZYG0 3.24e-07 54 28 4 175 3 cyoE Protoheme IX farnesyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IHI2 3.24e-07 54 28 4 175 3 cyoE Protoheme IX farnesyltransferase Legionella pneumophila (strain Corby)
Q2G9W3 3.65e-07 53 23 6 250 3 ctaB Protoheme IX farnesyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A4Z2D2 3.84e-07 53 27 7 226 3 ctaB Protoheme IX farnesyltransferase Bradyrhizobium sp. (strain ORS 278)
A8KYS6 4.15e-07 53 27 6 246 3 ctaB Protoheme IX farnesyltransferase Parafrankia sp. (strain EAN1pec)
Q83CV6 4.61e-07 53 22 7 289 3 cyoE Protoheme IX farnesyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NCT0 4.61e-07 53 22 7 289 3 cyoE Protoheme IX farnesyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KCC9 4.61e-07 53 22 7 289 3 cyoE Protoheme IX farnesyltransferase Coxiella burnetii (strain Dugway 5J108-111)
B6J085 4.61e-07 53 22 7 289 3 cyoE Protoheme IX farnesyltransferase Coxiella burnetii (strain CbuG_Q212)
B6J736 4.61e-07 53 22 7 289 3 cyoE Protoheme IX farnesyltransferase Coxiella burnetii (strain CbuK_Q154)
Q7N0K3 4.73e-07 53 45 0 61 3 cyoE Protoheme IX farnesyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q985X0 4.87e-07 53 32 7 149 3 ctaB2 Protoheme IX farnesyltransferase 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9WWR5 4.93e-07 53 24 5 201 3 cyoE Protoheme IX farnesyltransferase Pseudomonas putida
Q3IJQ0 5.63e-07 53 27 9 220 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudoalteromonas translucida (strain TAC 125)
B1YIW5 5.76e-07 53 29 3 124 3 ctaB Protoheme IX farnesyltransferase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
A6WC46 5.79e-07 53 25 8 271 3 ctaB Protoheme IX farnesyltransferase Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
Q0VN94 6.37e-07 53 26 11 241 3 cyoE Protoheme IX farnesyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q88PN3 6.45e-07 53 24 5 201 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYP1 6.45e-07 53 24 5 201 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q3K773 6.88e-07 53 25 2 163 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudomonas fluorescens (strain Pf0-1)
B0KPE4 7.07e-07 53 26 3 161 3 cyoE2 Protoheme IX farnesyltransferase 2 Pseudomonas putida (strain GB-1)
A4ILX0 7.93e-07 53 24 4 186 3 ctaB Protoheme IX farnesyltransferase Geobacillus thermodenitrificans (strain NG80-2)
Q9RM98 8.14e-07 53 25 4 215 3 ctaB Protoheme IX farnesyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q48M92 8.35e-07 52 24 2 161 3 cyoE Protoheme IX farnesyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q66DU5 8.54e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TPF3 8.54e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pestis (strain Pestoides F)
Q1CL75 8.54e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
Q0WCB5 8.54e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pestis
Q1C4J8 8.54e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
B1JHT2 8.74e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FLD4 8.74e-07 52 44 0 61 3 cyoE Protoheme IX farnesyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q11SZ7 8.78e-07 52 24 4 229 3 ctaB Protoheme IX farnesyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A4W799 9.24e-07 52 25 2 160 3 cyoE Protoheme IX farnesyltransferase Enterobacter sp. (strain 638)
A0JWQ8 9.46e-07 52 23 8 268 3 ctaB Protoheme IX farnesyltransferase Arthrobacter sp. (strain FB24)
A0L2I3 1.03e-06 52 24 5 197 3 cyoE2 Protoheme IX farnesyltransferase 2 Shewanella sp. (strain ANA-3)
Q5X7X6 1.09e-06 52 28 4 175 3 cyoE Protoheme IX farnesyltransferase Legionella pneumophila (strain Paris)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS13565
Feature type CDS
Gene ubiA
Product 4-hydroxybenzoate octaprenyltransferase
Location 3009695 - 3010549 (strand: -1)
Length 855 (nucleotides) / 284 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2420
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01040 UbiA prenyltransferase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0382 Coenzyme transport and metabolism (H) H 4-hydroxybenzoate polyprenyltransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MTHNKWQAYSRLMRIDKPIGALLLLWPTYWALWIAAKGFPDWHILIVFTLGVFSMRAAGCVINDFADRKIDGNVERTKNRPLPSGAVTEKESKIIFIVLVLFSFGLVLTLNTMTIWLSIAALALAWFYPFVKRFSNLPQLILGMAFGWSIPMGFAAVSETLPLVCWLLFLVNIIWSVVYDTQYAMVDRNDDLKIGVKSTAILFGRYDKIIIGILQLVMLALLVAIGVLLNMKGIYYWSLLLVTALFIYQQKLIAERERAPCFQAFMNNNYVGFVLFAGILFNYF

Flanking regions ( +/- flanking 50bp)

ATCACCTGTATATAAGCAGTAGTTAGGGGGAGCTAAAATTGGAGGGAAGTATGACGCACAATAAATGGCAGGCGTATAGCCGTTTAATGCGTATAGATAAGCCTATTGGAGCGCTATTATTACTTTGGCCAACGTATTGGGCATTATGGATCGCCGCTAAAGGCTTTCCTGACTGGCATATCCTGATTGTATTTACTCTAGGTGTGTTTTCCATGCGTGCCGCTGGGTGTGTAATAAATGACTTTGCTGACAGAAAAATTGATGGCAACGTTGAAAGAACTAAAAATAGACCATTACCTAGTGGTGCTGTAACGGAGAAAGAGAGCAAGATTATCTTTATTGTCTTGGTGCTGTTTTCGTTTGGATTAGTGCTTACGTTAAATACCATGACCATTTGGTTATCTATTGCCGCACTTGCACTCGCATGGTTTTATCCTTTTGTAAAACGTTTTAGTAATTTGCCTCAATTAATTTTAGGTATGGCCTTTGGTTGGTCTATCCCTATGGGATTTGCTGCAGTTTCTGAAACACTACCTTTAGTATGTTGGTTACTCTTTTTGGTCAATATTATCTGGTCTGTTGTGTATGACACTCAATATGCCATGGTCGATCGCAATGATGATTTAAAAATAGGGGTGAAATCGACAGCCATTCTGTTTGGTCGTTACGATAAAATCATTATTGGTATTTTACAGTTAGTGATGTTGGCATTATTAGTGGCGATTGGCGTTTTGCTGAATATGAAAGGGATCTATTATTGGTCATTGTTACTCGTGACAGCCCTGTTTATTTATCAACAGAAATTAATTGCTGAACGGGAAAGAGCCCCTTGTTTTCAAGCGTTTATGAATAATAATTATGTCGGTTTTGTTTTATTCGCAGGTATTTTATTTAATTATTTCTAATAAATATATTACCAGCACTAGCTGAGCACTGAAGTTGCATAAAAATAAAA