Homologs in group_3015

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17880 FBDBKF_17880 100.0 Morganella morganii S1 tam Trans-aconitate methyltransferase
EHELCC_06455 EHELCC_06455 100.0 Morganella morganii S2 tam Trans-aconitate methyltransferase
NLDBIP_06775 NLDBIP_06775 100.0 Morganella morganii S4 tam Trans-aconitate methyltransferase
LHKJJB_18885 LHKJJB_18885 100.0 Morganella morganii S3 tam Trans-aconitate methyltransferase
HKOGLL_04615 HKOGLL_04615 100.0 Morganella morganii S5 tam Trans-aconitate methyltransferase

Distribution of the homologs in the orthogroup group_3015

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3015

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P48633 0.0 1547 41 24 2019 3 irp2 High-molecular-weight protein 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A0A0H2ZGB9 0.0 658 30 30 1463 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGB9 6.79e-57 222 29 10 530 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain UCBPP-PA14)
G3XCV2 0.0 653 30 28 1467 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
G3XCV2 1.74e-57 224 29 10 530 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0DJH0 0.0 639 40 18 887 3 angR Anguibactin system regulator Vibrio anguillarum
P0DJH0 8.32e-16 87 33 1 134 3 angR Anguibactin system regulator Vibrio anguillarum
P0DJH0 1.51e-12 77 22 16 463 3 angR Anguibactin system regulator Vibrio anguillarum
Q6W4T3 0.0 638 40 18 887 1 angR Anguibactin system regulator Vibrio anguillarum (strain ATCC 68554 / 775)
Q6W4T3 8.9e-16 87 33 1 134 1 angR Anguibactin system regulator Vibrio anguillarum (strain ATCC 68554 / 775)
Q6W4T3 1.86e-12 76 22 16 463 1 angR Anguibactin system regulator Vibrio anguillarum (strain ATCC 68554 / 775)
Q7TYQ4 1.03e-176 581 34 15 988 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7TYQ4 1.42e-42 175 27 13 551 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQ63 1.08e-176 581 34 15 988 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ63 3.32e-43 177 28 13 551 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ62 2.36e-176 580 34 15 988 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQ62 6.6e-43 176 27 13 551 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q73XY1 1.18e-175 571 33 17 1002 3 mbtB Phenyloxazoline synthase MbtB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q73XY1 2.69e-45 184 29 13 530 3 mbtB Phenyloxazoline synthase MbtB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q1B6A7 2.75e-169 553 33 15 978 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
Q1B6A7 2.94e-43 177 31 9 408 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
Q1B6A7 1.2e-05 54 24 2 127 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
A0A0H2ZGJ4 2.49e-152 521 28 36 1427 1 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain UCBPP-PA14)
A0A0H2ZGJ4 2.25e-56 221 30 10 454 1 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HWG4 2.4e-142 492 33 18 923 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HWG4 3.87e-56 220 30 9 453 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HWG4 3.87e-08 62 30 3 111 2 pchF Pyochelin synthase PchF Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O68006 2.86e-138 486 31 24 984 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 2.81e-90 333 32 9 586 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.77e-69 265 26 30 972 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 7.34e-66 253 25 20 804 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 3.31e-64 248 24 20 911 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 5.65e-51 204 29 6 434 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 6.15e-33 144 25 11 442 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 5.88e-19 98 26 11 331 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 4.22e-18 95 21 14 442 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.7e-11 73 32 1 130 3 bacA Bacitracin synthase 1 Bacillus licheniformis
P94459 9.49e-81 301 25 23 956 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 3.49e-69 264 24 27 987 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 6.73e-46 187 23 20 896 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 3.04e-28 129 22 18 587 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 4.99e-24 115 22 21 711 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 3.13e-14 83 27 7 215 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
Q1IAL0 4.07e-80 296 26 25 994 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
Q1IAL0 9.08e-47 189 28 7 442 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
Q1IAL0 9.83e-28 127 24 13 441 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
Q1IAL0 2.29e-14 83 22 13 436 1 pmsD Pseudomonine synthase PmsD Pseudomonas entomophila (strain L48)
O30409 3.13e-78 293 26 26 992 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 8.98e-75 282 25 26 1021 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.68e-73 278 25 27 1024 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 8.07e-66 253 25 32 1035 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.08e-65 253 25 28 989 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.76e-51 205 22 26 940 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 5.63e-27 125 24 23 602 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.06e-25 120 22 15 584 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.15e-24 117 22 22 585 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 5.59e-24 115 23 17 540 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 3.18e-21 106 24 21 459 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.39e-10 71 35 5 155 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
P0C063 1.21e-76 288 27 24 899 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 8.23e-65 249 24 28 999 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 1.69e-60 235 23 26 987 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 2.7e-59 231 24 18 843 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 2.67e-24 116 23 17 577 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 6.61e-23 111 25 17 460 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 5.67e-22 108 25 16 447 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 3.09e-08 63 31 5 158 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C064 9.86e-76 285 27 22 848 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 1.07e-65 252 24 26 996 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 7.08e-61 236 23 26 987 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.32e-59 231 24 18 843 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.28e-24 116 23 17 577 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 4.24e-23 112 25 17 460 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 3.76e-22 109 23 22 580 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 2.94e-08 63 31 5 158 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P39845 5.36e-73 276 24 32 1014 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
P39845 6.94e-61 236 30 9 519 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
P39845 2.51e-26 122 25 18 449 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
P39845 6.66e-14 82 24 21 515 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
P27206 2.66e-71 271 24 23 991 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 9.52e-59 229 23 29 1021 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 5.82e-54 214 24 21 827 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 3.09e-30 135 24 23 625 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 4.95e-28 128 23 17 520 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 5.52e-27 125 25 8 428 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P27206 1e-07 61 19 13 380 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
Q70LM4 4.07e-69 263 26 20 852 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 2.22e-63 245 25 22 840 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 4.32e-60 234 25 29 955 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 6.53e-60 233 24 23 905 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 4.26e-19 99 22 20 594 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 4.15e-16 89 21 19 591 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 2.21e-13 80 25 16 375 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 6.85e-08 62 33 5 131 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 4.92e-05 52 23 8 258 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
P39846 2.74e-68 260 27 20 826 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 9.97e-58 226 22 20 922 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 8.9e-18 94 23 14 451 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 8.92e-16 88 22 19 499 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P9WER8 3.11e-68 261 25 29 1029 1 malA Malpinin synthetase Mortierella alpina
P9WER8 5.03e-61 237 26 22 752 1 malA Malpinin synthetase Mortierella alpina
P9WER8 7.44e-57 223 22 39 1067 1 malA Malpinin synthetase Mortierella alpina
P9WER8 4.68e-53 211 30 6 461 1 malA Malpinin synthetase Mortierella alpina
P9WER8 6.96e-53 210 30 11 460 1 malA Malpinin synthetase Mortierella alpina
P9WER8 4.21e-51 204 29 9 484 1 malA Malpinin synthetase Mortierella alpina
P9WER8 5.38e-50 201 24 20 731 1 malA Malpinin synthetase Mortierella alpina
P9WER8 2.48e-32 142 25 18 562 1 malA Malpinin synthetase Mortierella alpina
P9WER8 2.12e-19 100 27 7 276 1 malA Malpinin synthetase Mortierella alpina
P9WER8 2.41e-18 96 31 3 185 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.18e-16 91 21 12 464 1 malA Malpinin synthetase Mortierella alpina
P9WER8 5.01e-16 89 28 7 234 1 malA Malpinin synthetase Mortierella alpina
P9WER8 5.73e-16 89 31 2 174 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.41e-11 74 33 3 126 1 malA Malpinin synthetase Mortierella alpina
P39847 5.06e-68 259 24 25 985 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 2.07e-63 244 25 14 739 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 4.08e-26 122 24 16 445 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 3.08e-19 99 24 15 446 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 3.37e-06 56 21 12 367 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
O68008 1.8e-67 258 24 21 889 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 1.17e-64 249 23 25 977 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 4.13e-63 244 25 29 941 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 6.03e-57 224 23 19 860 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3.66e-51 204 23 19 840 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3.58e-31 139 23 19 637 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 5.3e-27 125 24 14 441 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 2.81e-22 109 27 13 351 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3.07e-21 106 27 7 300 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 9.61e-10 68 22 20 494 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 4.53e-07 59 25 2 137 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 1.66e-06 57 24 11 266 3 bacC Bacitracin synthase 3 Bacillus licheniformis
Q70LM7 4.95e-67 256 24 27 995 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
Q70LM7 5.04e-50 200 35 11 405 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
Q70LM7 4.24e-27 125 23 19 605 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
Q70LM7 6.01e-17 92 26 8 307 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
O31782 5.22e-67 257 26 27 902 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
O31782 5.76e-06 55 26 1 119 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
Q70LM5 1.39e-66 255 25 34 1045 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 5.35e-66 253 25 25 946 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 3.33e-65 251 26 28 912 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 2.02e-64 248 24 27 952 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 3.02e-64 248 27 29 874 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 6.25e-59 230 24 26 915 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 6.72e-25 118 24 22 602 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 6.37e-24 115 23 22 737 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.77e-24 114 22 22 610 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.18e-22 110 23 14 451 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.33e-14 84 21 17 482 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.69e-10 70 21 11 350 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 3.48e-05 53 23 5 259 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
D9XF49 3.09e-65 248 23 23 1018 1 phsB Phosphinothricin tripeptide synthase PhsB Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
D9XF49 1.31e-11 73 23 14 388 1 phsB Phosphinothricin tripeptide synthase PhsB Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
D9XF49 3.5e-08 62 29 2 121 1 phsB Phosphinothricin tripeptide synthase PhsB Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
Q70LM6 2.74e-64 248 26 18 847 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.25e-60 235 25 23 888 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2.68e-60 234 23 22 935 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 2e-54 215 24 26 946 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 7.18e-31 137 24 23 602 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 8.92e-22 107 22 19 588 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 3.58e-19 99 22 16 489 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 1.14e-16 91 23 13 451 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
O68007 7.31e-64 246 24 18 830 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 2.41e-63 244 24 25 888 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 6.56e-23 111 23 12 439 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 2.68e-19 99 24 16 466 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 7.5e-07 58 23 6 230 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 2.67e-06 57 22 8 255 3 bacB Bacitracin synthase 2 Bacillus licheniformis
Q9R9I9 5.29e-63 243 31 18 580 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 1.08e-47 193 21 21 907 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 7.11e-19 98 23 17 455 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 3.18e-07 59 29 3 133 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q04747 3.78e-62 241 24 28 1035 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 4.28e-62 240 23 30 988 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 2.7e-54 214 23 24 919 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 4.29e-30 135 27 18 486 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 1.58e-24 117 22 20 588 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 1.9e-17 93 24 15 428 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 0.000507 49 22 7 225 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q0VZ70 7.82e-62 239 25 24 877 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
Q0VZ70 1.73e-49 199 23 22 899 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
Q0VZ70 1.8e-18 97 23 14 460 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
Q0VZ70 5.51e-08 62 21 17 468 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
Q0VZ70 1.2e-07 61 27 1 128 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
O31827 1.87e-61 236 23 20 947 1 ppsE Plipastatin synthase subunit E Bacillus subtilis (strain 168)
O31827 8.57e-12 74 28 4 204 1 ppsE Plipastatin synthase subunit E Bacillus subtilis (strain 168)
P45745 5.76e-61 236 24 26 905 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 6.68e-51 203 28 9 447 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 6.18e-16 88 22 16 456 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 1.21e-09 67 26 2 128 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
Q8XBV9 8.91e-61 234 25 22 832 3 entF Enterobactin synthase component F Escherichia coli O157:H7
Q8XBV9 2.21e-05 53 31 2 131 3 entF Enterobactin synthase component F Escherichia coli O157:H7
P29698 7.61e-60 231 25 21 833 3 entF Enterobactin synthase component F Shigella flexneri
P29698 1.57e-05 54 31 2 131 3 entF Enterobactin synthase component F Shigella flexneri
P40806 1.91e-59 232 23 30 1008 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 1.09e-10 71 33 3 128 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 9.58e-08 61 23 8 308 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P40806 4.26e-07 59 21 24 632 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
P11454 8.71e-59 228 25 21 829 1 entF Enterobactin synthase component F Escherichia coli (strain K12)
P11454 6.14e-06 55 31 2 131 1 entF Enterobactin synthase component F Escherichia coli (strain K12)
O30408 5.88e-58 227 23 17 871 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 5.49e-54 214 22 21 885 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 8.52e-52 206 22 21 879 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 2.77e-23 112 22 28 707 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 4.28e-23 112 26 11 427 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 1.47e-19 100 23 18 581 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 4.65e-06 56 20 20 508 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
Q9R9J0 7.03e-58 227 25 22 823 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 7.45e-53 210 24 15 704 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 1.07e-50 203 25 23 760 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 1.79e-48 196 23 21 795 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 3.71e-26 122 22 19 590 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 6.22e-24 115 25 15 455 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 3.28e-23 112 23 23 608 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 2.38e-16 90 34 0 127 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 1.07e-07 61 23 18 401 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q2T4N2 1.31e-55 219 23 20 771 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9R9J1 3.01e-55 218 24 20 817 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 4.2e-22 108 22 21 584 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 2.03e-18 97 25 13 386 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
Q9R9J1 7.4e-11 72 20 12 490 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
D9XF47 4e-55 215 23 26 909 1 phsC Phosphinothricin tripeptide synthase PhsC Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
D9XF47 3.77e-12 75 29 3 158 1 phsC Phosphinothricin tripeptide synthase PhsC Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
D9XF47 4.87e-05 52 21 3 164 1 phsC Phosphinothricin tripeptide synthase PhsC Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
B0CN26 6.45e-55 214 23 23 877 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
B0CN26 2.93e-10 69 27 1 126 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
Q0E7C4 1.26e-53 212 24 26 872 3 vabF Vanchrobactin synthase VabF Vibrio anguillarum
Q0E7C4 2.98e-43 178 23 26 851 3 vabF Vanchrobactin synthase VabF Vibrio anguillarum
Q0E7C4 7.93e-14 81 23 13 440 3 vabF Vanchrobactin synthase VabF Vibrio anguillarum
Q0E7C4 9.57e-07 58 25 2 143 3 vabF Vanchrobactin synthase VabF Vibrio anguillarum
P09095 3.46e-52 205 28 8 466 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
P09095 6.47e-20 101 28 8 296 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
Q08787 8.41e-52 205 23 19 760 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
Q08787 1.27e-09 67 32 4 137 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
P0DUV4 9.44e-52 206 23 26 1006 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.79e-51 206 24 23 850 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.81e-48 196 24 24 841 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.88e-48 196 29 9 510 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.5e-46 189 31 9 449 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 6.74e-28 128 29 18 449 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 5.23e-18 95 31 5 199 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.05e-17 94 22 21 628 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 3.23e-17 92 21 19 603 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.3e-11 74 31 2 135 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV3 3.48e-51 204 25 25 892 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.81e-50 202 31 8 451 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.21e-49 199 22 27 1031 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 4.81e-48 194 24 23 801 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.93e-44 182 25 13 635 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 3.11e-27 125 25 13 452 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.49e-18 97 35 4 162 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 5.68e-15 85 27 8 250 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 9.6e-14 81 25 6 243 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 2.61e-11 73 32 2 131 1 mpcA Malpicyclin synthetase Mortierella alpina
Q09164 2.56e-50 202 23 28 986 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.61e-49 199 22 27 1035 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 5.58e-47 191 25 27 893 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 4.23e-46 188 25 30 896 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.5e-45 186 23 21 881 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.54e-45 186 25 31 895 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 3.66e-41 172 23 26 882 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 3.79e-38 162 22 32 1030 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 4.88e-38 161 23 22 900 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1e-37 160 22 24 917 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 2.27e-34 149 22 29 891 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 3.19e-23 112 22 20 607 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.06e-21 107 23 12 452 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.27e-21 107 23 19 627 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.55e-21 107 22 21 614 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.24e-18 97 22 11 453 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.24e-18 97 23 15 465 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.69e-17 94 21 15 507 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 3.88e-17 92 22 16 464 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 7.85e-17 91 23 16 449 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 3.62e-15 86 23 15 453 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 5.85e-11 72 21 12 457 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q52400 1.89e-49 191 30 8 459 1 syrB1 Syringomycin synthase SyrB1 Pseudomonas syringae pv. syringae
Q52400 0.000415 49 32 2 100 1 syrB1 Syringomycin synthase SyrB1 Pseudomonas syringae pv. syringae
A0A0S6XHH0 1.86e-48 196 24 17 781 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.78e-46 189 23 39 1051 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.73e-43 179 28 11 466 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.46e-42 176 24 24 828 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 3.58e-42 175 25 20 708 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 7.96e-42 174 25 25 781 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 5.05e-41 171 23 24 853 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.29e-40 169 25 27 721 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.29e-40 168 23 26 844 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 7.15e-36 154 23 28 842 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 6.23e-35 151 27 13 442 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.75e-32 142 28 13 456 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.92e-22 109 22 15 461 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 4.29e-15 85 22 14 389 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.63e-14 84 32 2 153 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.33e-11 73 29 4 159 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 2.51e-11 73 25 2 164 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.37e-10 71 26 2 146 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 6.35e-09 65 26 2 142 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 3.15e-08 63 21 13 330 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.25e-06 58 22 12 313 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.91e-06 57 26 8 235 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 9e-06 55 23 6 236 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
A0A0S6XHH0 1.3e-05 54 22 15 321 1 frbI FR901469 synthetase Fungal sp. (strain No.11243)
D4AU31 3.27e-47 191 31 10 448 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU31 1.59e-05 54 30 2 106 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
G3XNF4 6.24e-47 190 28 7 470 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XNF4 0.000488 49 28 2 110 1 ATPKS PKS-NRPS hybrid synthetase ATPKS Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
C7ZBE4 6.94e-47 191 23 38 1062 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.37e-26 124 27 19 463 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 2.11e-24 116 25 12 395 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.45e-23 114 25 13 446 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.51e-22 110 24 21 542 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 4.4e-15 85 21 24 641 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.16e-10 71 22 18 465 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 4.91e-07 59 25 2 144 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 1.82e-06 57 26 2 136 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 0.000308 50 22 7 189 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
Q7BQ71 8.53e-47 181 29 7 418 1 zmaJ Zwittermicin A synthase ZmaJ Bacillus cereus
P0C062 1.71e-46 187 30 7 424 1 grsA Gramicidin S synthase 1 Brevibacillus brevis
P0C062 4.55e-24 114 24 17 491 1 grsA Gramicidin S synthase 1 Brevibacillus brevis
P0C062 0.00064 48 22 15 407 1 grsA Gramicidin S synthase 1 Brevibacillus brevis
D1FVF0 4.18e-46 187 22 29 1042 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
D1FVF0 1.57e-18 97 23 15 479 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
D1FVF0 2.65e-12 76 21 14 468 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
D1FVF0 4.95e-09 65 29 3 126 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
J5JV76 1.37e-45 186 22 29 1042 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
J5JV76 6.65e-19 98 24 15 476 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
J5JV76 2.69e-12 76 21 14 468 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
J5JV76 4.91e-09 65 29 3 126 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
S0EN43 1.38e-45 186 23 32 1035 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EN43 1.02e-17 94 23 16 447 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EN43 2.1e-10 70 22 16 464 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EN43 4.42e-07 59 30 4 131 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EN43 0.000333 50 21 17 396 2 BEA1 Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A144KPJ6 1.57e-45 186 23 23 812 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 9.93e-42 173 23 34 1046 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 8.54e-39 164 29 14 449 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 6.38e-31 138 28 15 446 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 1.76e-17 94 22 15 487 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 3.75e-15 86 23 15 464 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 2.16e-07 60 22 14 343 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 1.5e-06 57 28 4 138 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
Q4KCY5 2.36e-45 176 30 11 457 1 pltF L-proline--[L-prolyl-carrier protein] ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P9WEZ4 2.9e-45 185 22 22 869 2 pytA Hybrid PKS-NRPS synthetase pytA Aspergillus terreus
Q9I1H0 3.26e-45 184 30 9 453 1 ambB AMB antimetabolite synthase AmbB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1H0 2.01e-17 93 22 25 609 1 ambB AMB antimetabolite synthase AmbB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C061 5.27e-45 182 30 7 424 1 grsA Gramicidin S synthase 1 Aneurinibacillus migulanus
P0C061 2.46e-23 112 25 18 472 1 grsA Gramicidin S synthase 1 Aneurinibacillus migulanus
A0A348AXX4 1.99e-44 182 25 28 898 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 8.65e-43 177 23 30 1040 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 6.99e-41 171 22 28 1017 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.04e-40 170 24 26 909 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.49e-40 170 22 31 1031 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.94e-40 168 22 33 1072 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 5.15e-40 168 22 31 1026 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.11e-39 165 23 29 870 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 6.1e-37 158 24 30 897 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.42e-25 119 23 22 615 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 8.82e-23 111 23 22 610 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.05e-22 109 22 23 661 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.55e-20 103 24 12 428 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.58e-20 102 22 14 455 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.27e-18 97 22 16 459 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.54e-17 94 22 17 470 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 5.01e-17 92 24 16 458 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 6.97e-16 88 22 15 455 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.06e-15 88 21 19 603 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.44e-08 64 23 15 369 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
P27742 2.86e-44 182 23 41 1084 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 4.36e-44 181 30 13 455 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 1.19e-30 137 21 35 1049 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 9.79e-19 97 22 22 592 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 1.24e-10 71 24 10 313 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P27742 2.48e-06 57 29 5 141 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q00869 3.53e-44 181 23 33 1033 1 ESYN1 Enniatin synthase Fusarium equiseti
Q00869 9.94e-21 104 25 13 431 1 ESYN1 Enniatin synthase Fusarium equiseti
Q00869 2.84e-09 66 25 7 206 1 ESYN1 Enniatin synthase Fusarium equiseti
Q00869 3.36e-08 63 20 21 619 1 ESYN1 Enniatin synthase Fusarium equiseti
E9F8M3 3.82e-44 181 29 9 441 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9F8M3 3.44e-05 53 31 2 105 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A0A1EA36 4.86e-44 181 23 33 1033 1 ESYN1 Enniatin synthetase Fusarium oxysporum
A0A0A1EA36 1.62e-19 100 24 13 431 1 ESYN1 Enniatin synthetase Fusarium oxysporum
A0A0A1EA36 8.61e-09 65 26 6 184 1 ESYN1 Enniatin synthetase Fusarium oxysporum
A0A0A1EA36 4.17e-08 62 20 21 619 1 ESYN1 Enniatin synthetase Fusarium oxysporum
G3J456 6.57e-44 181 23 26 911 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 6.32e-34 148 21 26 942 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 2.29e-26 123 25 16 492 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 2.78e-06 57 19 12 361 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
G3J456 1.18e-05 54 24 5 158 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
K0E4D7 9.06e-44 180 22 34 1043 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 2.1e-42 176 24 29 806 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 4.45e-38 161 24 25 745 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 2.3e-35 152 28 14 480 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 1.08e-33 147 24 28 781 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 9e-32 140 24 24 718 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 4.15e-14 82 23 15 498 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 2.6e-09 67 27 3 145 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 3.85e-09 66 29 3 134 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 1.02e-08 65 29 6 154 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 8.68e-07 58 23 6 265 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
K0E4D7 1.2e-06 58 23 16 386 1 ecdA Nonribosomal peptide synthetase ecdA Aspergillus rugulosus
J4KMC1 1.08e-43 180 30 10 514 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
Q81T97 1.14e-43 171 30 9 433 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis
C3LAH8 1.14e-43 171 30 9 433 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4I7 1.14e-43 171 30 9 433 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis (strain A0248)
B7IN64 1.24e-43 171 30 10 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain G9842)
Q6HLH7 1.57e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EM80 1.57e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain 03BB102)
Q73BD2 1.57e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JFV5 1.57e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain AH820)
A0RBJ0 1.57e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus thuringiensis (strain Al Hakam)
Q63E02 1.64e-43 171 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ZK / E33L)
A5ABG0 1.79e-43 179 22 23 896 1 pynA Hybrid PKS-NRPS synthetase pynA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P25464 1.83e-43 179 29 9 434 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 5.22e-41 171 28 19 552 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 6.24e-33 144 23 24 786 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 1.38e-18 97 22 20 592 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 9.5e-09 65 23 12 312 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
P25464 0.000499 49 29 5 135 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
Q81G39 1.94e-43 170 30 9 434 1 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HHC6 1.94e-43 170 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain B4264)
B9IUW2 2.06e-43 170 30 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain Q1)
B6HLU1 2.08e-43 179 29 16 515 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 3.3e-39 165 21 39 1072 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 1.67e-28 130 22 26 816 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 3.13e-21 106 22 21 612 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 1.33e-06 57 23 12 302 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLU1 2.21e-06 57 32 7 140 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
P19787 2.08e-43 179 29 16 515 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 3.3e-39 165 21 39 1072 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 1.67e-28 130 22 26 816 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 3.13e-21 106 22 21 612 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 1.33e-06 57 23 12 302 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
P19787 2.21e-06 57 32 7 140 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Penicillium chrysogenum
C8VPS9 2.39e-43 179 24 28 875 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 2.32e-38 162 22 24 912 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 9.99e-37 157 23 23 820 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 1.89e-28 130 22 25 790 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 3.29e-28 129 28 13 396 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 9.22e-13 78 21 25 542 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 2.11e-10 70 30 3 142 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 5.01e-08 62 21 9 335 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 4.47e-43 178 22 22 841 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 5.75e-35 151 22 24 814 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.05e-34 150 22 34 1026 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.72e-31 140 22 22 768 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.06e-30 137 22 28 805 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 5.47e-28 128 27 15 412 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.03e-11 74 25 7 243 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.34e-11 74 21 14 466 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 3.07e-09 66 23 11 314 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.1e-07 61 21 18 493 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 1.52e-07 60 25 4 183 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S3DQP3 4.58e-43 178 24 30 830 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 2.09e-34 149 23 25 771 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 1.64e-33 146 24 24 743 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 2.09e-32 143 29 13 416 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 1.5e-31 140 26 12 455 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 1.7e-30 136 27 10 438 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 1.35e-12 77 22 14 548 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 2.87e-09 66 28 4 148 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 3.16e-08 63 23 5 215 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 3.32e-08 63 26 3 158 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 1.58e-07 60 29 3 135 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3DQP3 2.27e-07 60 23 3 195 1 gloA Nonribosomal peptide synthetase gloA Glarea lozoyensis (strain ATCC 20868 / MF5171)
E9FCP4 5e-43 178 23 33 1040 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 2.01e-41 172 21 28 1050 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 5.62e-32 141 26 13 442 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 2.7e-31 139 24 11 470 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 6.18e-30 135 20 35 1089 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 1.76e-26 123 26 14 414 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 2.03e-18 97 22 11 455 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 1.24e-16 90 20 19 616 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.9e-13 79 26 7 223 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 8.36e-09 65 25 2 142 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 6.6e-07 58 21 17 481 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
A0A2I1D2N0 5.88e-43 177 23 32 927 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.48e-36 156 22 22 759 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 5.06e-34 148 22 29 932 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 5.69e-31 138 22 26 729 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 5.89e-29 131 27 13 410 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.26e-28 129 20 34 1034 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.29e-28 129 21 19 730 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.51e-19 99 25 8 308 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 3.58e-14 82 23 16 457 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1e-13 81 24 9 314 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 4.43e-13 79 24 11 315 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.74e-08 64 22 12 347 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 1.3e-06 58 19 15 462 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 2.88e-06 57 20 15 362 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 5.69e-05 52 24 7 240 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
B7HK95 6.61e-43 169 29 8 433 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain AH187)
A0A2V5GX43 8.1e-43 177 22 26 902 3 pyvA Hybrid PKS-NRPS synthetase pyvA Aspergillus violaceofuscus (strain CBS 115571)
A0A2I2F262 9.74e-43 176 30 9 446 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
A0A2I2F262 5.9e-10 68 35 3 120 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
A9VKV6 1.41e-42 167 29 9 434 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus mycoides (strain KBAB4)
Q4WVN4 1.98e-42 176 24 22 805 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 1.45e-39 166 21 29 1027 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.03e-39 166 23 23 836 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 7.39e-35 151 23 25 781 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.92e-30 135 27 10 439 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 5.73e-23 112 26 15 431 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 1.46e-10 70 33 3 133 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 2.91e-10 70 20 11 349 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 4.18e-06 56 21 11 326 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 9.23e-05 52 23 15 379 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 0.001 48 21 13 319 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
M1W0X8 2.34e-42 175 20 32 1082 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 3.62e-25 119 24 12 424 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 1.15e-13 81 23 12 418 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 4.83e-08 62 22 14 353 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 7.47e-08 62 19 14 485 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W0X8 5.53e-05 52 28 3 135 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
A0A167LUQ4 3.1e-42 175 24 32 894 3 fumoS Fumosorinone synthetase Cordyceps fumosorosea (strain ARSEF 2679)
B8NJG3 4.04e-42 175 25 29 801 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NJG3 3.91e-05 53 28 6 149 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NJG3 0.000501 49 22 16 376 3 lepA Hybrid PKS-NRPS synthetase lepA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
O94205 4.55e-42 174 20 34 1085 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 2.06e-24 116 25 13 423 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 2.23e-13 80 23 12 418 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 2.25e-09 67 22 11 348 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
O94205 5.29e-08 62 19 14 485 1 lpsA1 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
B8N0E8 6.26e-42 172 27 11 468 2 asaC Nonribosomal peptide synthetase asaC Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8N0E8 7.47e-06 55 25 7 179 2 asaC Nonribosomal peptide synthetase asaC Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 6.52e-42 174 24 30 898 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 4.96e-33 145 27 13 451 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 1.22e-32 144 30 11 384 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 3.36e-32 142 27 14 469 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 2.01e-31 139 26 14 467 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 2.73e-29 132 25 12 429 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 8.71e-18 94 19 20 581 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 1.28e-08 64 33 1 108 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 1.07e-07 61 22 24 550 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q5ATG8 6.8e-42 174 22 23 835 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5ATG8 1.23e-06 58 25 7 185 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A024F910 6.9e-42 174 27 10 466 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 6.32e-39 164 23 30 850 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.06e-38 164 24 26 781 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 6.26e-38 161 29 13 435 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 2.16e-35 152 23 20 804 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 2.26e-33 146 25 19 659 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 2.34e-10 70 21 14 369 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 4.81e-10 69 24 14 340 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 8.73e-10 68 29 2 133 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.02e-09 68 29 2 136 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 5.02e-07 59 21 14 364 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
A0A024F910 1.65e-06 57 23 8 248 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
P0DX16 1.06e-41 172 22 27 871 1 scoA Isonitrile lipopeptide synthase Streptomyces coeruleorubidus
P0DX16 1.06e-05 54 27 3 133 1 scoA Isonitrile lipopeptide synthase Streptomyces coeruleorubidus
A0A1L9WR63 1.75e-41 172 30 12 478 2 acrB Nonribosomal peptide synthetase acrB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WR63 2.9e-06 56 27 4 147 2 acrB Nonribosomal peptide synthetase acrB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A7GMR0 1.8e-41 164 30 8 396 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B8DEG2 3.1e-41 164 33 7 372 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4a (strain HCC23)
B8DEG2 0.000747 48 51 0 37 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4a (strain HCC23)
Q721J2 3.31e-41 164 32 8 372 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4b (strain F2365)
Q721J2 0.000674 48 51 0 37 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4b (strain F2365)
C1L1P5 3.99e-41 164 32 8 372 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4b (strain CLIP80459)
C1L1P5 0.000691 48 51 0 37 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serotype 4b (strain CLIP80459)
A0JJU1 4.12e-41 171 31 13 467 1 tenS Tenellin synthetase Beauveria bassiana
Q01886 5.62e-41 171 27 15 536 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 3.94e-36 155 24 22 748 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 2.02e-32 143 29 14 437 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 1.15e-25 120 26 14 461 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 8.41e-11 71 26 3 160 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 1.07e-08 64 28 2 131 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 6.97e-08 62 19 14 353 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q01886 4.08e-06 56 23 8 272 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
A0A8F4S6Z6 1.49e-40 169 23 29 880 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
P59591 1.87e-40 161 27 7 461 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZ94 1.87e-40 161 27 7 461 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8VM67 2.07e-40 161 27 7 461 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus agalactiae serotype III (strain NEM316)
Q4WT66 2.31e-40 169 28 14 460 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 4.02e-32 142 26 13 451 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 1.52e-28 130 23 14 529 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 1.2e-18 97 21 27 786 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 6.29e-11 72 22 10 304 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WT66 2.5e-06 57 24 2 133 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8Y8D4 3.17e-40 161 30 7 397 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92D47 3.58e-40 160 31 7 396 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92D47 0.000766 48 51 0 37 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0A411KUP8 4.23e-40 168 23 28 874 1 ucsA Hybrid PKS-NRPS synthetase ucsA Acremonium sp.
C0MBD6 4.34e-40 160 29 8 393 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus equi subsp. equi (strain 4047)
A0A7L9EYL1 7.39e-40 167 23 35 1020 1 xenE Hybrid PKS-NRPS synthetase xenE Xenoacremonium sinensis
G3GBU7 1.06e-39 167 22 32 1027 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
G3GBU7 3.03e-16 89 23 17 452 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
G3GBU7 1.15e-09 67 20 9 452 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
G3GBU7 2.6e-06 57 29 4 131 3 None Beauvericin nonribosomal cyclodepsipeptide synthetase BEA1 Gibberella intermedia
Q2PBY4 1.33e-39 166 21 32 1077 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 1.56e-25 120 24 12 424 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 1.3e-17 94 24 12 440 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 1.61e-10 70 20 17 492 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q2PBY4 2.22e-09 67 22 11 348 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea
Q0D159 2.7e-39 165 29 13 472 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0D159 1.57e-06 57 29 3 126 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0D159 0.00043 49 22 8 244 2 ATEG_00325 Hybrid PKS-NRPS synthetase ATEG_00325 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9CG49 3.32e-39 157 27 6 432 3 dltA D-alanine--D-alanyl carrier protein ligase Lactococcus lactis subsp. lactis (strain IL1403)
I1RF49 4.72e-39 165 26 14 542 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 4.08e-38 162 24 28 853 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 8.99e-38 160 27 11 452 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 5.24e-32 141 23 29 821 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 3.42e-24 115 24 12 469 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 1.16e-11 74 23 13 321 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 2.76e-09 66 26 14 342 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 4.39e-08 62 29 2 133 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 2.58e-07 60 20 16 504 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 0.000842 48 22 8 238 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P9WEP7 5.85e-39 164 22 37 1089 1 None PF 1022-synthetase Rosellinia sp.
P9WEP7 1.51e-21 107 24 16 463 1 None PF 1022-synthetase Rosellinia sp.
P9WEP7 4.1e-12 75 20 21 606 1 None PF 1022-synthetase Rosellinia sp.
P9WEP7 3.08e-10 69 27 4 150 1 None PF 1022-synthetase Rosellinia sp.
I1SAJ7 1.07e-38 164 23 30 896 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 6.7e-32 141 23 22 691 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.4e-31 140 26 13 445 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.33e-27 127 23 25 771 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.64e-27 127 26 13 410 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 2.21e-27 126 28 15 404 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 3.51e-23 112 24 18 509 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.3e-10 71 25 8 236 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 1.31e-10 71 23 5 224 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 9.29e-08 61 21 5 253 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 4.43e-06 56 23 10 295 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.000163 51 23 6 220 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.000245 50 22 13 316 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.00026 50 21 5 209 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.000271 50 20 11 335 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
S7Z800 1.34e-38 163 25 28 812 3 opdA Hybrid PKS-NRPs synthetase opdA Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A5K6CNB8 2.13e-38 161 28 8 422 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
A0A5K6CNB8 1.79e-06 57 36 2 102 1 posA Delta-poly-L-ornithine synthetase Acinetobacter baumannii (strain AB307-0294)
B8NTZ9 2.2e-38 161 26 8 453 2 lnaA Aldehyde reductase lnaA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q88VM6 2.5e-38 155 27 8 418 3 dltA D-alanine--D-alanyl carrier protein ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B6D9A8 2.57e-38 162 23 35 1054 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
B6D9A8 8.49e-17 91 24 18 467 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
B6D9A8 1.88e-08 63 20 15 475 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
B6D9A8 4.9e-08 62 27 3 135 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
P27743 3.05e-38 162 26 17 580 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Amycolatopsis lactamdurans
P27743 3.13e-38 162 27 19 541 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Amycolatopsis lactamdurans
P27743 3.66e-34 148 22 35 889 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Amycolatopsis lactamdurans
P27743 1.32e-13 80 21 27 612 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Amycolatopsis lactamdurans
C1CU95 3.44e-38 155 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain Taiwan19F-14)
B8ZQ14 3.44e-38 155 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q4WYG2 4.01e-38 161 20 31 1031 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYG2 1.38e-25 120 28 16 422 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYG2 2.06e-09 67 23 19 457 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYG2 6.81e-09 65 21 17 490 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
C1CNE9 4.67e-38 154 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain P1031)
P0A399 4.67e-38 154 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A398 4.67e-38 154 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04HZ7 4.67e-38 154 26 4 449 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q5BDY8 5.03e-38 161 21 35 1042 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 1.05e-26 124 25 16 486 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 1.03e-24 117 24 13 468 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 1.74e-06 57 25 4 195 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 8.66e-06 55 21 10 339 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 2.11e-05 53 20 15 359 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
K3VDP2 6.15e-38 161 23 23 780 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 7.52e-38 160 23 25 816 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.4e-36 157 30 13 448 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 5.92e-36 154 24 11 538 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 8.39e-34 147 26 11 501 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 2.73e-31 139 28 15 428 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 4.46e-17 92 23 13 437 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 4.73e-10 69 23 18 376 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.69e-09 67 24 8 272 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.01e-06 58 24 4 165 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 1.35e-05 54 22 12 335 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
K3VDP2 7.94e-05 52 19 17 482 3 NRPS32 Nonribosomal peptide synthetase 32 Fusarium pseudograminearum (strain CS3096)
Q53526 6.33e-38 154 28 7 444 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9I1H3 6.41e-38 160 29 9 411 1 ambE AMB antimetabolite synthase AmbE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1H3 1.31e-18 97 21 24 709 1 ambE AMB antimetabolite synthase AmbE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
C1CB20 7.08e-38 154 26 4 446 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pneumoniae (strain 70585)
Q4WF61 9.03e-38 160 29 11 413 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 4.46e-21 105 29 16 431 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF61 0.000193 50 21 10 295 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A7ZA74 9.51e-38 153 29 8 374 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q4WAZ9 9.95e-38 160 30 16 472 2 NRPS14 PKS-NRPS hybrid synthetase psoA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A482N9V7 1.16e-37 160 26 13 518 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A482N9V7 0.000189 50 24 6 180 1 iccA Hybrid PKS-NRPS synthetase iccA Talaromyces variabilis
A0A8F4S8Q3 1.52e-37 159 24 23 824 1 gkaA Hybrid PKS-NRPS synthetase gkaA Penicillium citrinum
Q65DH1 1.89e-37 152 30 10 387 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q48SZ3 2.54e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
W7MLD7 2.93e-37 159 23 28 846 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
A2RE45 3.03e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JGF0 3.03e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8P0J9 3.03e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
A0A1W6BT53 3.31e-37 158 22 23 833 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
A0A1W6BT53 2.36e-32 142 26 20 561 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
A0A1W6BT53 4.65e-13 79 22 18 494 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
B5XLX5 3.71e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JLB7 3.74e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q5XBN5 3.74e-37 152 27 6 391 1 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q99ZA6 3.74e-37 152 27 6 391 1 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M1
Q1J667 3.81e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M4 (strain MGAS10750)
P0DA65 4.18e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA64 4.18e-37 152 27 6 391 3 dltA D-alanine--D-alanyl carrier protein ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
A0A481WNP4 6.54e-37 157 24 28 895 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
A0A481WNP4 2.26e-05 53 18 6 308 3 traA Hybrid PKS-NRPS synthetase traA Penicillium crustosum
S0DLP2 8.73e-37 157 30 12 420 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 3.99e-35 152 22 35 1044 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 1.46e-31 140 30 14 440 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 1.71e-29 133 29 9 385 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 7.99e-16 88 27 10 272 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 4.36e-13 79 21 23 623 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 1.77e-10 70 22 15 420 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 0.000404 49 21 13 325 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
P39581 1.15e-36 150 29 6 375 1 dltA D-alanine--D-alanyl carrier protein ligase Bacillus subtilis (strain 168)
A0AH92 1.15e-36 150 30 7 372 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AH92 0.000715 48 51 0 37 3 dltA D-alanine--D-alanyl carrier protein ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
M1W5Z4 1.72e-36 156 21 23 813 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 2.19e-24 116 25 11 426 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 1.6e-15 87 22 11 478 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 6.74e-11 72 22 13 363 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 2.74e-06 57 22 14 376 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
M1W5Z4 4.15e-05 52 28 3 135 3 lpsA2 D-lysergyl-peptide-synthetase subunit 1 Claviceps purpurea (strain 20.1)
P0DO30 1.97e-36 156 27 11 498 1 iliA Hybrid PKS-NRPS synthetase iliA Neonectria sp. (strain DH2)
Q5B7I4 2.1e-36 155 25 17 559 2 inpB Nonribosomal peptide synthase inpB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B7I4 2.08e-33 145 26 11 481 2 inpB Nonribosomal peptide synthase inpB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B7I4 1.8e-08 63 30 4 149 2 inpB Nonribosomal peptide synthase inpB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5B7I4 1.92e-07 60 30 5 151 2 inpB Nonribosomal peptide synthase inpB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10896 2.42e-36 155 22 21 754 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q10896 9.22e-11 71 33 1 102 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q10896 2.03e-09 67 26 6 280 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q10896 5.25e-06 55 21 17 449 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
G7XQ31 2.74e-36 155 23 29 769 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 3.32e-35 152 22 34 957 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 6.94e-27 124 27 13 420 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 7.3e-27 124 25 13 463 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 8.39e-13 78 22 10 319 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 3.99e-07 59 21 11 359 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 7.77e-06 55 27 4 137 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
A0A1M3T4K3 4.93e-36 155 23 28 761 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 6.73e-36 154 22 34 957 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 6.66e-27 124 27 13 420 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 2.49e-26 122 24 13 463 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 7.98e-13 78 22 10 319 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 4.02e-07 59 21 11 359 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 7.83e-06 55 27 4 137 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A319A6V2 5.14e-36 154 22 33 952 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 7.54e-32 141 22 27 774 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 1.91e-31 139 28 15 440 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 4.88e-27 125 24 19 551 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 5.7e-13 79 22 10 319 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 2.47e-09 67 21 9 346 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A317VEE1 5.68e-36 154 22 35 957 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 6.37e-33 144 23 28 776 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 2.42e-26 123 25 13 463 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 1.13e-25 120 26 16 424 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 4.36e-13 79 23 11 326 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 8.77e-09 65 21 12 357 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 3.32e-05 53 25 4 135 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
G0REX6 5.85e-36 154 27 13 511 1 iliA Hybrid PKS-NRPS synthetase iliA Hypocrea jecorina (strain QM6a)
A2QYX4 6.95e-36 154 22 33 952 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 9.94e-32 140 22 27 774 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 2.34e-31 139 28 15 440 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 5.62e-27 125 24 19 551 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 6.47e-13 78 22 10 319 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 9.07e-09 65 21 9 346 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A319BQC1 8.03e-36 154 22 34 960 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 1.44e-31 140 23 28 777 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 4.27e-27 125 28 15 423 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 5.43e-26 122 25 13 458 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 3.78e-13 79 24 10 320 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 5.1e-12 75 20 20 509 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 8.62e-09 65 22 11 350 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 1.64e-05 54 26 3 131 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A1B2CTC5 9.69e-36 154 22 35 1064 3 penN Nonribosomal peptide synthetase penN Penicillium thymicola
A0A1B2CTC5 4.83e-25 118 27 13 401 3 penN Nonribosomal peptide synthetase penN Penicillium thymicola
A0A1B2CTC5 2.98e-21 106 23 18 620 3 penN Nonribosomal peptide synthetase penN Penicillium thymicola
A0A1B2CTC5 4.72e-07 59 27 5 159 3 penN Nonribosomal peptide synthetase penN Penicillium thymicola
G4MVZ2 1.04e-35 154 23 29 842 1 ACE1 Polyketide synthase-nonribosomal peptide synthetase ACE1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
S7ZFK6 1.14e-35 153 23 34 912 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
S7ZFK6 6.23e-06 55 21 12 331 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum (strain 114-2 / CGMCC 5302)
A0A1W5T1U1 1.38e-35 153 23 36 915 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
A0A1W5T1U1 6.28e-06 55 21 12 331 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum
B2KWH8 2.13e-35 152 28 12 456 2 NPS1 Nonribosomal peptide synthase 1 Ajellomyces capsulatus
B2KWH8 9.49e-09 64 25 5 201 2 NPS1 Nonribosomal peptide synthase 1 Ajellomyces capsulatus
Q01757 2.34e-35 150 25 17 572 3 pcbAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase (Fragment) Streptomyces clavuligerus
A0A089FSA4 3.03e-35 152 26 10 473 3 prlS Hybrid PKS-NRPS synthetase prlS Fungal sp. (strain NRRL 50135)
E2JA29 3.22e-35 147 29 18 453 1 ddaD Dapdiamide synthesis protein DdaD Enterobacter agglomerans
E2JA29 5.93e-12 74 34 3 143 1 ddaD Dapdiamide synthesis protein DdaD Enterobacter agglomerans
Q4WAW3 6.51e-35 150 22 24 831 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAW3 1.2e-28 130 25 14 473 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAW3 1.02e-08 64 19 18 488 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WAW3 1.08e-06 58 22 9 279 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
G3XUF0 7.14e-35 151 23 34 943 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 7.88e-32 141 22 27 774 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 2.39e-31 139 28 15 440 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 5.19e-27 125 24 19 551 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 5.59e-13 79 22 10 319 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 2.38e-09 67 21 9 346 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
I1RVD9 7.57e-35 150 30 13 421 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 7.96e-33 144 22 29 822 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 4.06e-30 135 27 14 463 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 3.38e-13 79 22 17 470 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 6.92e-11 72 19 18 534 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RVD9 2.48e-08 63 26 3 134 3 NRPS7 Nonribosomal peptide synthetase 7 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A1U8QWA2 7.61e-35 150 27 12 441 1 ATRR Glycine betaine reductase ATRR Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1L9NGU5 8.65e-35 150 24 26 736 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 3.23e-34 149 22 35 962 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 3.84e-25 119 24 13 463 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 5.84e-25 118 27 14 418 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 2.68e-13 80 24 12 319 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 2.39e-07 60 19 9 368 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
Q5D6D7 8.65e-35 150 23 31 1005 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 1.3e-30 137 25 11 517 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 9.86e-27 124 26 14 445 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 4.23e-24 115 28 14 446 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 1.01e-08 65 22 19 510 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 7.04e-06 55 21 16 350 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
A0A411L027 1.22e-34 150 29 13 436 3 buaA Hybrid PKS-NRPS synthetase buaA Petromyces alliaceus
A0A179H164 1.32e-34 150 27 10 414 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.18e-34 149 23 28 825 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.49e-34 149 28 13 461 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 4.87e-31 138 29 14 409 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 6.07e-29 131 28 15 458 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.08e-28 130 29 15 416 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 7.03e-28 128 25 14 435 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 9.92e-28 127 26 14 422 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 8.08e-27 124 26 9 387 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.93e-13 80 22 15 463 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 5.71e-09 65 25 5 225 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.15e-08 64 21 16 475 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.91e-08 63 25 3 159 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 2.01e-07 60 26 3 156 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 4.18e-06 56 27 2 137 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 1.15e-05 54 27 4 148 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
M2YKT6 2.1e-34 149 22 29 884 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
M2YKT6 9.23e-06 55 25 4 147 2 hps1 Hybrid PKS-NRPS synthetase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
Q4WLW5 2.17e-34 149 25 16 524 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 8.48e-34 147 23 23 786 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 4.7e-26 122 29 16 420 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 6.15e-11 72 23 13 366 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 1.01e-09 68 19 13 435 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW5 3.15e-09 66 22 6 270 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
S0EEY3 3.94e-34 148 22 25 842 1 FUS1 Fusarin C synthetase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A2Z5XAL7 3.95e-34 148 25 15 570 1 phm1 Hybrid PKS-NRPS synthetase phm1 Pyrenochaetopsis sp.
Q4WZ44 4.02e-34 148 29 12 417 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WZ44 6.79e-25 118 26 16 525 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WZ44 5.08e-06 55 22 21 476 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WZ44 2.02e-05 53 21 17 446 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A395I3F8 4.42e-34 148 22 26 780 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 3.92e-32 142 22 38 965 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 3.41e-29 132 24 18 582 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 1.33e-28 130 28 13 439 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 2.65e-12 76 22 11 323 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 7.41e-11 72 21 21 559 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 6.57e-06 55 26 3 141 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
C9K7B5 4.92e-34 148 24 29 825 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 2.16e-30 136 29 11 417 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 5.02e-21 105 26 17 452 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 6.78e-10 68 27 5 172 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 2.87e-09 66 21 15 493 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
C9K7B5 1.16e-07 61 21 16 396 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
B9WZX0 5.17e-34 147 21 24 831 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
B9WZX0 1.22e-28 130 25 14 473 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
B9WZX0 3.15e-08 63 19 18 488 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
B9WZX0 1.02e-06 58 22 9 279 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
A0A1L9U7P9 5.31e-34 148 22 36 954 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 9.49e-34 147 23 26 796 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 1.97e-32 143 28 13 440 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 2.29e-27 126 25 13 477 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 3.79e-11 72 21 21 509 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 6.11e-11 72 21 9 346 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 2.27e-09 67 23 19 480 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 1.55e-06 57 26 4 136 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A0G0AID6 1.09e-33 147 23 30 922 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
A0A0G0AID6 6.13e-09 65 21 14 409 1 thnA Hybrid PKS-NRPS synthetase thnA Trichoderma harzianum
P07702 1.24e-33 146 25 15 590 1 LYS2 L-2-aminoadipate reductase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A098D1P1 1.48e-33 147 27 12 434 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.06e-31 140 27 15 530 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.93e-31 139 22 23 731 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.45e-29 132 20 38 1037 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.98e-29 132 28 12 405 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.71e-25 119 26 14 449 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 4.61e-25 119 25 14 464 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 2.66e-13 80 20 15 470 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.15e-10 71 27 7 241 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.65e-09 66 28 2 135 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 3.54e-08 63 21 14 465 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 5.44e-07 59 21 8 323 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 5.48e-05 52 20 15 450 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A2V5H0B0 1.53e-33 147 23 24 784 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 1.96e-33 146 21 22 801 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.81e-33 145 22 27 844 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 5.71e-32 141 29 11 411 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 1.49e-29 133 22 19 707 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 1.13e-27 127 24 12 484 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 1.98e-20 103 23 15 487 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 4.42e-14 82 22 12 356 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.55e-13 80 23 11 301 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 6.07e-12 75 23 10 310 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.65e-11 73 21 19 459 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 9.71e-09 65 25 7 244 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 5.28e-08 62 20 15 460 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 4.68e-06 56 22 12 313 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 2.79e-05 53 22 7 261 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A2V5H0B0 5.37e-05 52 22 10 257 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
A0A0F7GFS4 2.28e-33 146 27 13 463 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
A0A0F7GFS4 4.33e-05 52 28 4 128 1 tasS Hybrid PKS-NRPS synthetase tasS Hapsidospora irregularis
O54154 4.38e-33 140 26 9 441 1 redM L-proline--[L-prolyl-carrier protein] ligase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0A2Z5TM64 5.04e-33 145 22 36 941 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A2Z5TM64 6.63e-05 52 21 6 245 3 himA Polyketide synthase-nonribosomal peptide synthetase hybrid himA Aspergillus japonicus
A0A318Z3U0 5.07e-33 145 23 30 778 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 7.23e-28 128 22 37 969 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 5.37e-26 122 27 14 425 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 1.41e-24 117 24 14 459 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 7.38e-13 78 23 10 319 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 2.47e-07 60 19 8 339 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 2.71e-05 53 25 3 125 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
Q6Q883 9.24e-33 144 30 13 414 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q6Q883 1.81e-16 90 24 13 425 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q6Q883 5.84e-10 68 21 16 463 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
Q6Q883 1.31e-05 54 28 4 131 2 sirP Nonribosomal peptide synthetase sirP Leptosphaeria maculans
A0A0C1E5J8 9.6e-33 144 28 15 478 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 1.86e-31 139 21 23 804 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 1.31e-26 124 25 13 469 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 1.17e-13 81 24 9 320 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 3.78e-11 72 29 3 146 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 7.11e-09 65 23 13 340 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
Q5B7I5 1.21e-32 143 23 26 782 2 inpA Nonribosomal peptide synthase inpA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
S4W172 1.22e-32 143 27 10 417 1 eqxS Equisetin synthetase eqxS Fusarium heterosporum
C8V7P4 1.36e-32 143 28 8 387 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8V7P4 7.82e-06 55 22 7 214 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A6G9KH54 1.43e-32 143 27 14 461 1 nanA Nonribosomal peptide synthetase nanA Aspergillus nanangensis
A0A6G9KH54 8.29e-31 137 24 18 571 1 nanA Nonribosomal peptide synthetase nanA Aspergillus nanangensis
A0A6G9KH54 1.73e-06 57 22 7 258 1 nanA Nonribosomal peptide synthetase nanA Aspergillus nanangensis
A0A6G9KH54 0.000244 50 23 3 149 1 nanA Nonribosomal peptide synthetase nanA Aspergillus nanangensis
Q9VDC6 1.56e-32 141 28 9 414 1 e Beta-alanyl-bioamine nonribosomal peptide synthetase ebony Drosophila melanogaster
P68878 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain MW2)
A8Z1J1 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAZ4 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain MSSA476)
A6QFE3 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain Newman)
Q5HHF2 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain COL)
Q2FZW6 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIE3 1.84e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain USA300)
Q6GIF6 2.12e-32 137 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain MRSA252)
Q4L4U5 2.76e-32 137 27 9 427 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus haemolyticus (strain JCSC1435)
B8NHE4 3e-32 141 27 12 440 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NHE4 9.97e-07 58 28 4 161 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A1CLY8 3.62e-32 142 22 27 852 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
A1CLY8 0.00021 50 28 3 125 3 ccsA Polyketide synthase-nonribosomal peptide synthetase Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
B8NWW5 3.82e-32 140 26 10 418 3 lnaA Aldehyde reductase lnbA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NWW5 0.000331 49 26 6 142 3 lnaA Aldehyde reductase lnbA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P0C397 4.9e-32 136 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus
P99107 4.9e-32 136 28 12 430 1 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain N315)
P68876 4.9e-32 136 28 12 430 1 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRB0 4.9e-32 136 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain JH9)
A6U039 4.9e-32 136 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain JH1)
A7X0D6 4.9e-32 136 28 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
P35854 7.74e-32 135 27 9 382 1 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus rhamnosus
D4AU56 1.02e-31 140 28 13 460 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU56 5.74e-24 115 27 17 458 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU56 2.37e-20 103 24 15 450 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU56 7.73e-19 98 21 29 744 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
D4AU56 0.000136 51 30 5 128 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q2YWQ8 1.12e-31 135 27 12 430 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
I1RN14 1.13e-31 140 28 14 450 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RN14 2.28e-27 126 28 11 422 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RN14 2.69e-26 122 27 15 437 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RN14 8.79e-08 61 29 2 102 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RN14 0.00023 50 24 5 162 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
K2QYX5 1.17e-31 140 25 12 512 1 mpsA Hybrid PKS-NRPS synthetase mpsA Macrophomina phaseolina (strain MS6)
Q0V6Q6 1.35e-31 140 20 21 857 1 phmA Polyketide synthase-nonribosomal peptide synthetase phmA Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q5HQN0 1.45e-31 134 27 9 406 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9P7T1 1.99e-31 139 30 20 518 1 sib1 Hydroxamate-type ferrichrome siderophore peptide synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7T1 1.94e-30 136 28 21 497 1 sib1 Hydroxamate-type ferrichrome siderophore peptide synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WEV1 2.51e-31 139 27 16 463 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
P9WEV1 3.56e-27 125 24 18 518 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
Q2UPA9 2.79e-31 139 31 13 387 1 aclP Nonribosomal peptide synthetase aclP Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A1DN09 2.84e-31 139 25 14 463 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 3.75e-27 125 26 14 448 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 2.5e-11 73 23 14 362 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DN09 4.37e-05 52 29 6 147 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P0DUL8 2.88e-31 138 24 7 412 1 None Non-canonical nonribosomal peptide synthetase hkm10 Aspergillus hancockii
O43103 3.51e-31 139 28 16 470 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
O43103 3.64e-19 99 24 11 449 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
O43103 4.86e-16 89 25 12 370 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
O43103 3.65e-07 59 19 17 526 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
O43103 0.000203 50 21 7 239 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
O43103 0.000288 50 18 18 480 3 SID2 Ferrichrome siderophore peptide synthetase Ustilago maydis (strain 521 / FGSC 9021)
A0A3T0QHT6 4.81e-31 138 28 13 464 1 pvhA Hybrid PKS-NRPS synthetase pvhA Talaromyces variabilis
Q8CT93 6.57e-31 132 27 9 406 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P9WEU9 6.7e-31 137 26 11 427 3 benZ Nonribisomal peptide synthetase benZ Aspergillus terreus
P9WEU9 4.29e-23 112 26 15 431 3 benZ Nonribisomal peptide synthetase benZ Aspergillus terreus
P9WEU9 6.61e-06 55 20 14 372 3 benZ Nonribisomal peptide synthetase benZ Aspergillus terreus
Q5W263 6.7e-31 132 26 12 463 1 pigI L-proline--[L-prolyl-carrier protein] ligase Serratia sp. (strain ATCC 39006)
S0DS59 8.4e-31 137 26 10 431 2 PKS-NRPS1 Trichosetin synthetase PKS-NRPS1 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
A0A0C1E6T8 9.28e-31 137 22 33 975 1 pboA Nonribosomal peptide synthetase pboA Aspergillus ustus
A0A0C1E6T8 1.17e-20 103 25 14 438 1 pboA Nonribosomal peptide synthetase pboA Aspergillus ustus
A0A0C1E6T8 8.1e-05 52 19 13 424 1 pboA Nonribosomal peptide synthetase pboA Aspergillus ustus
Q03AZ2 1.02e-30 132 27 11 416 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q9L9G0 1.07e-30 134 25 10 452 1 novH Novobiocin biosynthesis protein H Streptomyces niveus
Q9L9G0 2.91e-07 59 25 2 156 1 novH Novobiocin biosynthesis protein H Streptomyces niveus
B3WC77 1.16e-30 132 27 11 416 3 dltA D-alanine--D-alanyl carrier protein ligase Lacticaseibacillus casei (strain BL23)
A8NVB7 1.18e-30 136 25 23 650 1 CC1G_06235 Adenylate-forming reductase 06235 Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
A0A0E4AZP0 1.68e-30 136 26 9 416 3 fsa1 Hybrid PKS-NRPS synthetase fsa1 Fusarium sp. (strain FN080326)
Q52US9 1.76e-30 136 24 32 809 2 fso1 Nonribosomal peptide synthase fso1 Omphalotus olearius
Q52US9 4.31e-18 95 24 24 580 2 fso1 Nonribosomal peptide synthase fso1 Omphalotus olearius
Q5AR54 3.47e-30 135 23 23 707 1 asqK Nonribosomal peptide synthetase asqK Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AR54 2.1e-29 132 27 15 458 1 asqK Nonribosomal peptide synthetase asqK Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AR54 2.04e-10 70 24 8 252 1 asqK Nonribosomal peptide synthetase asqK Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AR54 3.37e-09 66 22 17 469 1 asqK Nonribosomal peptide synthetase asqK Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1DA59 3.94e-30 135 20 33 1042 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DA59 9.58e-27 124 25 9 432 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A1DA59 0.000165 50 25 4 146 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
P40976 4.69e-30 134 25 11 503 1 lys1 L-2-aminoadipate reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40976 4.59e-07 59 28 4 138 1 lys1 L-2-aminoadipate reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8NI19 6.64e-30 134 27 13 446 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 1.52e-26 123 29 13 412 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 7.06e-26 121 25 16 460 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 5.4e-08 62 30 1 135 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NI19 2.23e-06 57 24 3 166 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A319DV72 7.28e-30 134 25 18 530 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 4.35e-28 129 24 13 531 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 4.38e-28 129 24 14 461 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 3.44e-24 115 25 17 461 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 3.72e-11 72 21 8 317 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 5.28e-08 62 31 3 133 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
B6HJU6 8.47e-30 134 28 12 441 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 2.99e-22 109 25 14 501 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 2.69e-06 57 27 2 128 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HJU6 7.81e-06 55 24 2 130 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A2TBU4 8.6e-30 133 25 10 451 2 lpsB D-lysergyl-peptide-synthetase subunit 2 Epichloe festucae var. lolii
A2TBU4 1.13e-09 67 28 2 160 2 lpsB D-lysergyl-peptide-synthetase subunit 2 Epichloe festucae var. lolii
A0A1W6BT46 8.92e-30 134 26 17 513 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 8.26e-26 120 27 15 439 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 7.73e-06 55 19 8 231 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
C9K7C1 1.19e-29 132 24 12 521 2 AMT10 Nonribosomal peptide synthetase AMT10 Alternaria alternata
C9K7C1 5.95e-11 71 31 4 158 2 AMT10 Nonribosomal peptide synthetase AMT10 Alternaria alternata
Q4H424 2.96e-29 132 26 15 452 2 perA Peramine synthetase Epichloe festucae (strain Fl1)
Q4H424 4.04e-25 119 24 13 446 2 perA Peramine synthetase Epichloe festucae (strain Fl1)
Q4H424 3.74e-15 85 29 5 188 2 perA Peramine synthetase Epichloe festucae (strain Fl1)
Q4H424 2.21e-07 60 29 2 122 2 perA Peramine synthetase Epichloe festucae (strain Fl1)
P9WEU8 3.12e-29 131 26 15 462 3 benY Nonribisomal peptide synthetase benY Aspergillus terreus
P9WEU8 2.28e-07 60 20 14 388 3 benY Nonribisomal peptide synthetase benY Aspergillus terreus
Q6FMI5 3.4e-29 131 27 14 489 3 LYS2 L-2-aminoadipate reductase large subunit Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q6FMI5 1.4e-05 54 27 3 147 3 LYS2 L-2-aminoadipate reductase large subunit Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A8NS27 3.43e-29 131 25 13 505 1 CC1G_03009 Adenylate-forming reductase 03009 Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
Q4PEM9 3.72e-29 132 27 13 430 2 fer3 Siderophore peptide synthetase fer3 Ustilago maydis (strain 521 / FGSC 9021)
Q4PEM9 5.18e-22 108 25 15 448 2 fer3 Siderophore peptide synthetase fer3 Ustilago maydis (strain 521 / FGSC 9021)
Q4PEM9 1.51e-20 103 27 16 429 2 fer3 Siderophore peptide synthetase fer3 Ustilago maydis (strain 521 / FGSC 9021)
Q4PEM9 2.02e-10 70 20 17 475 2 fer3 Siderophore peptide synthetase fer3 Ustilago maydis (strain 521 / FGSC 9021)
A0A4P8WAE5 4.1e-29 132 22 35 978 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A4P8WAE5 7.79e-05 52 26 6 194 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A4P8WAE5 0.000261 50 20 11 313 3 pyiS Polyketide synthase-nonribosomal peptide synthetase pyiS Pyricularia grisea
A0A067MTM1 5.25e-29 131 23 44 969 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Botryobasidium botryosum (strain FD-172 SS1)
C0LTL9 8.4e-29 127 24 8 440 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
C0LTL9 5.71e-06 55 31 4 135 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
Q9X2N4 8.88e-29 126 29 9 390 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus xylosus
A0A1U9YHZ2 1.08e-28 130 27 16 465 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
A0A1U9YHZ2 9.49e-17 91 25 12 422 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
Q4WR82 1.08e-28 130 27 23 527 2 NRPS2 Nonribosomal peptide synthetase sidC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WR82 1.3e-25 120 26 17 521 2 NRPS2 Nonribosomal peptide synthetase sidC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WR82 2.25e-22 110 26 17 484 2 NRPS2 Nonribosomal peptide synthetase sidC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WR82 0.000484 49 19 13 377 2 NRPS2 Nonribosomal peptide synthetase sidC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q75BB3 1.1e-28 130 25 12 509 3 LYS2 L-2-aminoadipate reductase large subunit Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75BB3 8.44e-07 58 31 4 141 3 LYS2 L-2-aminoadipate reductase large subunit Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A0A166YZW0 1.58e-28 130 21 41 1062 1 ppzA Peramine synthetase ppzA Metarhizium rileyi (strain RCEF 4871)
A0A166YZW0 2.14e-23 113 25 16 423 1 ppzA Peramine synthetase ppzA Metarhizium rileyi (strain RCEF 4871)
A0A166YZW0 3.29e-15 86 30 2 149 1 ppzA Peramine synthetase ppzA Metarhizium rileyi (strain RCEF 4871)
A0A166YZW0 0.000483 49 27 3 121 1 ppzA Peramine synthetase ppzA Metarhizium rileyi (strain RCEF 4871)
A0A6J4B487 2.84e-28 129 28 15 458 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A6J4B487 4.07e-05 53 24 13 313 3 LUC5 Hybrid PKS-NRPS synthetase LUC5 Fusarium sp.
A0A1E3B0T2 7.69e-28 127 27 12 426 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
A0A1E3B0T2 4.83e-25 118 26 13 418 1 criC Nonribosomal peptide synthetase criC Aspergillus cristatus
B6F209 8.25e-28 127 20 25 850 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
B6F209 0.000214 50 25 5 163 1 cpaA Cyclo-acetoacetyl-L-tryptophan synthase Aspergillus oryzae
A8NF97 9.41e-28 127 25 10 412 3 cpf1 Coprinoferrin synthetase Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
Q4WD47 1.1e-27 127 26 14 442 2 fsqF Nonribosomal peptide synthetase-like enzyme fsqF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A248AFK6 1.3e-27 127 26 9 387 1 NPS2 Nonribosomal peptide synthase NPS2 Ceriporiopsis subvermispora (strain B)
A0A248AFK6 0.000198 50 25 4 177 1 NPS2 Nonribosomal peptide synthase NPS2 Ceriporiopsis subvermispora (strain B)
Q8J0L6 1.63e-27 126 25 10 422 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea
Q8J0L6 6.54e-09 65 20 19 486 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea
Q0CG34 1.92e-27 126 29 13 398 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CG34 5.91e-24 115 22 26 731 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CG34 1.81e-05 53 27 3 131 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CG34 6.98e-05 52 23 9 251 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
M1W600 1.96e-27 125 27 11 421 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea (strain 20.1)
M1W600 1.02e-08 64 25 8 233 1 lpsB D-lysergyl-peptide-synthetase subunit 2 Claviceps purpurea (strain 20.1)
Q0CS64 2.65e-27 125 28 11 373 3 ataP Nonribosomal peptide synthetase ataP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CS64 1.48e-08 64 20 17 366 3 ataP Nonribosomal peptide synthetase ataP Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q12572 3.98e-27 125 24 12 497 3 LYS2 L-2-aminoadipate reductase large subunit Candida albicans
A0A1L9WUW3 5.8e-27 124 24 12 443 1 aneB Nonribosomal peptide synthase aneB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A1L9WUW3 4.24e-08 62 20 13 379 1 aneB Nonribosomal peptide synthase aneB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
A0A017SQ41 7.24e-27 124 26 13 415 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A017SQ41 2.87e-25 119 26 15 472 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
A0A017SQ41 2.31e-07 60 21 20 540 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
I1S2J4 8.74e-27 123 27 12 442 1 NRPS9 Nonribosomal peptide synthetase 9 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S2J4 2.99e-08 62 28 3 135 1 NRPS9 Nonribosomal peptide synthetase 9 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q4WF53 1.41e-26 123 27 12 421 2 NRPS4 Nonribosomal peptide synthase sidD Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF53 8.2e-09 65 25 8 260 2 NRPS4 Nonribosomal peptide synthase sidD Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WF53 8.28e-08 61 21 17 478 2 NRPS4 Nonribosomal peptide synthase sidD Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
I1RIV2 1.88e-26 123 27 12 451 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RIV2 1.9e-12 77 22 14 453 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RIV2 2.63e-05 53 21 7 259 2 NPS6 Nonribosomal peptide synthetase 6 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q5SBL6 1.9e-26 123 25 14 520 3 fsdS Fusaridione A synthetase fsdS Fusarium heterosporum
M1VVW6 1.93e-26 122 26 14 448 1 lpsC D-lysergyl-peptide-synthetase subunit 3 Claviceps purpurea (strain 20.1)
M1VVW6 1.27e-08 64 29 3 144 1 lpsC D-lysergyl-peptide-synthetase subunit 3 Claviceps purpurea (strain 20.1)
L7WU80 4.41e-26 122 24 13 503 1 notE' Nonribisomal peptide synthase notE' Aspergillus versicolor
L7WU80 4.22e-24 115 27 12 396 1 notE' Nonribisomal peptide synthase notE' Aspergillus versicolor
L7WU80 2.38e-12 76 22 17 450 1 notE' Nonribisomal peptide synthase notE' Aspergillus versicolor
L7WU80 2.06e-06 57 24 2 147 1 notE' Nonribisomal peptide synthase notE' Aspergillus versicolor
Q4WMK2 8.62e-26 120 23 11 443 3 NRPS9 Nonribosomal peptide synthetase 9 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B8NR69 1.07e-25 120 21 30 868 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 5.63e-24 115 25 15 471 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 1.1e-09 68 22 15 467 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NR69 4.5e-07 59 24 3 171 1 dtpA Nonribosomal peptide synthase dtpA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q6TNA5 1.22e-25 118 25 13 449 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
Q6TNA5 2.17e-07 59 33 2 104 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
O74298 2.02e-25 119 24 14 509 3 lys2 L-2-aminoadipate reductase large subunit Penicillium chrysogenum
O74298 9.41e-05 51 27 3 142 3 lys2 L-2-aminoadipate reductase large subunit Penicillium chrysogenum
L0E2Z1 2.07e-25 119 26 12 485 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 6.26e-24 114 23 12 462 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 0.000108 51 21 5 241 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
Q96V34 2.96e-25 119 26 15 426 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 1.38e-24 117 24 10 444 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 2.21e-24 116 27 12 440 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 1.3e-07 61 19 25 621 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 6.18e-06 55 31 5 129 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
Q96V34 9.7e-05 51 20 13 363 3 lpsA D-lysergyl-peptide-synthetase subunit 1 Epichloe festucae var. lolii
A0A125SUR3 5.06e-25 118 30 15 403 3 ACTTS4 Nonribosomal peptide synthetase ACTTS4 Alternaria alternata
A0A125SUR3 2.93e-12 76 23 10 358 3 ACTTS4 Nonribosomal peptide synthetase ACTTS4 Alternaria alternata
I1S3K7 1.08e-24 117 22 15 547 2 chry1 Nonribosomal peptide synthetase chry1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S3K7 6.36e-23 111 25 17 499 2 chry1 Nonribosomal peptide synthetase chry1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S3K7 1.46e-14 84 29 5 187 2 chry1 Nonribosomal peptide synthetase chry1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S3K7 1.01e-08 64 20 10 363 2 chry1 Nonribosomal peptide synthetase chry1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B6HLP9 1.19e-24 117 27 16 436 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLP9 3.94e-19 99 23 10 431 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLP9 4.92e-10 69 29 6 182 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLP9 4.37e-09 65 22 11 371 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q2PBY5 1.36e-24 117 25 14 448 1 lpsC D-lysergyl-peptide-synthetase subunit 3 Claviceps purpurea
Q2PBY5 5.57e-09 65 30 3 143 1 lpsC D-lysergyl-peptide-synthetase subunit 3 Claviceps purpurea
F2RB81 1.53e-24 116 26 10 420 1 cmlP Non-ribosomal peptide synthetase CmlP Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
K7NCP5 1.89e-24 116 26 15 455 1 sidN Nonribosomal peptide synthase sidN (Fragment) Epichloe festucae var. lolii
A0A0U1LQE6 1.93e-24 116 20 21 751 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 2.28e-24 116 26 10 418 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.49e-22 110 24 15 489 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.43e-19 100 25 14 403 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.41e-15 87 23 12 427 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 5.53e-10 68 21 5 283 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 1.01e-07 61 25 3 157 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 8.63e-06 55 28 3 135 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
F4K1G2 2.51e-24 115 24 11 438 2 At5g35930 Putative acyl-activating enzyme 19 Arabidopsis thaliana
E1ACQ0 3.23e-24 115 23 16 565 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
E1ACQ0 2.09e-21 106 25 13 403 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
E1ACQ0 5.59e-06 55 21 7 268 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
K7NCX6 3.4e-24 115 26 14 454 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain E2368)
K7NCX6 2.52e-21 106 26 18 483 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain E2368)
K7NCX6 3.27e-17 92 25 19 555 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain E2368)
G2Q9A5 3.91e-24 115 25 18 549 1 mycA Hybrid PKS-NRPS synthetase mycA Thermothelomyces thermophilus (strain ATCC 42464 / BCRC 31852 / DSM 1799)
L0E2U2 3.92e-24 115 24 14 442 1 phqB Nonribisomal peptide synthase phqB Penicillium fellutanum
L0E2U2 6.75e-22 108 27 15 434 1 phqB Nonribisomal peptide synthase phqB Penicillium fellutanum
K7NCV2 7.88e-24 114 26 15 456 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain Fl1)
K7NCV2 2.21e-23 113 27 19 484 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain Fl1)
K7NCV2 3.12e-18 96 23 27 763 2 sidN Nonribosomal peptide synthase sidN Epichloe festucae (strain Fl1)
A2R6H0 3.48e-23 112 24 14 460 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 2.14e-21 106 22 26 702 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 1.77e-06 57 23 5 233 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A0A1R3RGK1 4.01e-23 112 24 12 476 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK1 1.31e-18 97 25 17 444 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
A0A1R3RGK1 4.29e-09 65 20 13 435 1 otaB Nonribosomal peptide synthetase otaB Aspergillus carbonarius (strain ITEM 5010)
M1WCQ3 4.77e-23 112 26 11 387 2 tcpP Nonribosomal peptide synthetase tcpP Claviceps purpurea (strain 20.1)
M1WCQ3 8.78e-20 101 25 17 425 2 tcpP Nonribosomal peptide synthetase tcpP Claviceps purpurea (strain 20.1)
A0A7L8UVC9 1.3e-22 110 20 25 870 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
Q2UEK2 2.67e-22 109 25 14 463 1 astA Nonribosomal peptide synthetase astA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q2UEK2 5.59e-07 58 26 3 165 1 astA Nonribosomal peptide synthetase astA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5D6D3 4.95e-22 108 24 14 437 2 NPS6 Nonribosomal peptide synthetase 6 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D3 9.7e-06 55 26 4 186 2 NPS6 Nonribosomal peptide synthetase 6 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q4WLW8 5.84e-22 107 24 20 486 1 fmqC Nonribosomal peptide synthetase fmqC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WLW8 2.23e-06 57 23 6 195 1 fmqC Nonribosomal peptide synthetase fmqC Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
F9X9V1 1.33e-21 107 26 19 480 3 NRPS2 Nonribosomal peptide synthetase 2 Zymoseptoria tritici (strain CBS 115943 / IPO323)
F9X9V1 7.29e-21 105 24 14 445 3 NRPS2 Nonribosomal peptide synthetase 2 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q09MP5 1.42e-21 107 24 14 437 3 NPS6 Nonribosomal peptide synthetase 6 Cochliobolus miyabeanus
Q5RG49 3.8e-21 105 24 15 461 3 aasdh Beta-alanine-activating enzyme Danio rerio
Q5RG49 4.23e-06 55 28 2 107 3 aasdh Beta-alanine-activating enzyme Danio rerio
Q53005 4.37e-21 103 30 7 278 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P96575 1.83e-20 101 23 15 486 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
Q4WMJ7 8.73e-20 101 24 10 393 1 gliP Nonribosomal peptide synthetase gliP Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WMJ7 2.24e-12 76 27 2 202 1 gliP Nonribosomal peptide synthetase gliP Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WMJ7 9.15e-05 51 25 2 132 1 gliP Nonribosomal peptide synthetase gliP Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2HEW5 2.64e-19 99 23 18 529 2 cheA PKS-NRPS hybrid synthetase cheA Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
P94547 3.37e-19 97 25 19 490 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
G4N137 4.06e-19 99 23 9 401 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q2HBN0 5.72e-19 98 27 16 432 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q2HBN0 0.000105 51 29 2 105 1 cghG Hybrid PKS-NRPS synthetase cghG Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q84P24 1.37e-18 95 27 11 296 1 4CLL6 4-coumarate--CoA ligase-like 6 Arabidopsis thaliana
Q09MP4 5.34e-18 95 24 15 438 2 NPS6 Nonribosomal peptide synthetase 6 (Fragment) Alternaria brassicicola
Q09MP4 3.34e-06 56 26 6 196 2 NPS6 Nonribosomal peptide synthetase 6 (Fragment) Alternaria brassicicola
Q09MP4 4.05e-06 56 20 13 450 2 NPS6 Nonribosomal peptide synthetase 6 (Fragment) Alternaria brassicicola
S5M744 7.28e-18 92 23 11 404 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 7.28e-18 92 23 11 404 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
A8FGK6 9.19e-18 92 25 16 424 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
Q00868 2.63e-17 92 25 11 377 1 None Enniatin synthase (Fragment) Gibberella pulicaris
Q00868 1.24e-08 64 29 3 131 1 None Enniatin synthase (Fragment) Gibberella pulicaris
Q4WYP0 3.3e-17 92 22 14 468 3 NRPS6 Nonribosomal peptide synthetase 6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYP0 7.26e-06 55 25 5 202 3 NRPS6 Nonribosomal peptide synthetase 6 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B2KWI3 4.12e-17 91 24 13 467 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
A7Z809 6.96e-17 89 25 20 454 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
C0SPB0 1.61e-16 89 23 13 444 3 ytcI Uncharacterized acyl--CoA ligase YtcI Bacillus subtilis (strain 168)
Q4WR83 2.02e-16 89 24 19 479 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q65FT5 2.31e-16 88 24 16 445 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P38135 2.55e-16 88 23 16 465 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
Q8XBV3 8.33e-16 86 26 17 441 3 entE Enterobactin synthase component E Escherichia coli O157:H7
S7RK07 1.05e-15 87 25 10 393 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Gloeophyllum trabeum (strain ATCC 11539 / FP-39264 / Madison 617)
P10378 2.43e-15 85 26 17 441 1 entE Enterobactin synthase component E Escherichia coli (strain K12)
O07610 2.48e-15 85 20 10 447 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q0K844 3.4e-15 84 27 8 303 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A0RK73 4.01e-15 84 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
P23971 4.72e-15 84 24 17 444 1 menE 2-succinylbenzoate--CoA ligase Bacillus subtilis (strain 168)
A0A3G9H9I5 9.32e-15 83 21 13 470 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
B7JDD6 9.59e-15 83 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
Q6HC29 1.03e-14 82 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8H151 1.18e-14 83 23 17 493 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
B2HIL4 1.44e-14 83 23 22 503 1 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
O07619 1.56e-14 82 24 17 466 2 yhfT Uncharacterized acyl--CoA ligase YhfT Bacillus subtilis (strain 168)
Q336M7 1.74e-14 82 27 14 300 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
P95141 1.77e-14 82 22 20 527 1 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8J2R0 2.29e-14 82 25 9 292 3 FUM10 Acyl-CoA synthetase FUM10 Gibberella moniliformis (strain M3125 / FGSC 7600)
Q5P603 2.31e-14 82 28 10 288 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B7HTW3 2.49e-14 81 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
B2HIN2 2.49e-14 82 24 22 479 1 fadD26 Long-chain-fatty-acid--AMP ligase FadD26 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q8GQN9 2.91e-14 81 25 18 428 1 bclA Benzoate--CoA ligase Thauera aromatica
M4IS90 3.44e-14 81 22 16 504 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
C8VTR6 4.54e-14 81 25 9 299 3 AN10074 Putative acyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q26304 5.07e-14 81 23 16 467 1 None Luciferin 4-monooxygenase Luciola mingrelica
Q7TXK5 5.96e-14 81 22 20 527 3 fadD29 4-hydroxyphenylalkanoate adenylyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q4L235 7.3e-14 81 22 15 452 1 AASDH Beta-alanine-activating enzyme Homo sapiens
P0DX14 1.07e-13 79 22 14 476 1 scoC Fatty acid--[acyl-carrier-protein] ligase ScoC Streptomyces coeruleorubidus
Q9AJS8 1.22e-13 79 26 13 321 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
Q81K97 1.23e-13 79 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
C3LB87 1.23e-13 79 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 1.23e-13 79 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
Q72YK9 1.42e-13 79 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
P69451 1.44e-13 79 21 17 480 1 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli (strain K12)
P69452 1.44e-13 79 21 17 480 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O74976 1.5e-13 79 25 9 295 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8RU95 2.85e-13 79 25 10 335 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
O24146 3.56e-13 78 21 12 489 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
Q816I1 4.08e-13 77 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q632I5 4.49e-13 77 24 17 411 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
Q10S72 4.58e-13 78 27 11 286 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
A9MQH7 5.64e-13 77 21 15 476 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B9J2F2 5.87e-13 77 25 17 409 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
Q80WC9 6.05e-13 78 23 15 451 1 Aasdh Beta-alanine-activating enzyme Mus musculus
Q80WC9 0.000149 50 29 5 117 1 Aasdh Beta-alanine-activating enzyme Mus musculus
Q6YYZ2 1.09e-12 77 26 12 284 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
Q84P23 1.12e-12 76 24 10 327 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
G3J9P0 1.25e-12 77 26 14 364 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
A0R4Q2 1.35e-12 76 23 12 462 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q53FZ2 1.35e-12 76 24 17 455 1 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Homo sapiens
Q8XDR6 1.6e-12 76 21 17 480 3 fadD Long-chain-fatty-acid--CoA ligase Escherichia coli O157:H7
A0A336U965 2.1e-12 76 24 20 458 1 melA Aspulvinone E synthetase melA Aspergillus terreus
Q0S7V5 2.23e-12 75 20 9 468 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
O24145 2.29e-12 75 23 11 376 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
A0A2H5AIX5 2.5e-12 75 21 7 339 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
Q8VYJ1 3.29e-12 75 25 7 303 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
Q9ULC5 3.51e-12 75 23 17 484 1 ACSL5 Long-chain-fatty-acid--CoA ligase 5 Homo sapiens
Q9S777 3.53e-12 75 23 9 367 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
P86832 3.73e-12 75 22 13 429 1 fcbA2 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P86831 3.73e-12 75 22 13 429 1 fcbA1 4-chlorobenzoate--CoA ligase Arthrobacter sp.
M4IQR7 4.66e-12 74 24 15 465 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
Q5REV5 5.03e-12 74 23 16 452 2 ACSM3 Acyl-coenzyme A synthetase ACSM3, mitochondrial Pongo abelii
Q1IAK8 5.46e-12 74 25 16 433 1 pmsE Pseudomonine synthase PmsE Pseudomonas entomophila (strain L48)
P96843 9.01e-12 73 22 8 327 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8VCW8 1.4e-11 73 27 8 308 1 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Mus musculus
P0DUL9 1.92e-11 73 25 17 383 1 None Nonribosomal peptide synthetase hkm11 Aspergillus hancockii
P0DUL9 4.86e-10 68 23 3 228 1 None Nonribosomal peptide synthetase hkm11 Aspergillus hancockii
A0A0S2E7V8 2.15e-11 73 25 12 341 1 invA3 Inactive atromentin synthetase invA3 Paxillus involutus
A9VM74 2.54e-11 72 23 14 403 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
Q5R9G9 3.62e-11 72 27 11 307 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Pongo abelii
G3XMC0 3.68e-11 72 21 17 458 2 azaF Acyl-CoA ligase azaF Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
Q6ETN3 3.68e-11 72 23 9 326 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
Q0CRX1 3.81e-11 72 24 20 458 1 melA Aspulvinone E synthetase melA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q973W5 4.46e-11 72 20 13 483 1 STK_07830 3-hydroxypropionyl-coenzyme A synthetase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
P9WQD1 4.68e-11 71 22 18 485 1 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQD0 4.68e-11 71 22 18 485 3 acsA Acetyl-coenzyme A synthetase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59871 4.68e-11 71 22 18 485 3 acsA Acetyl-coenzyme A synthetase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P38137 5.97e-11 71 21 9 323 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6ZAC1 7.53e-11 70 24 8 286 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
A7GU88 8.5e-11 70 24 14 408 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8ZRX4 9.02e-11 70 21 13 463 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TIH0 9.02e-11 70 21 13 463 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella heidelberg (strain SL476)
B5FHG5 9.02e-11 70 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella dublin (strain CT_02021853)
Q8Z9L4 9.26e-11 70 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella typhi
B4TWR4 9.58e-11 70 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella schwarzengrund (strain CVM19633)
B5BL55 9.67e-11 70 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PIL0 9.67e-11 70 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A2QTE5 1.05e-10 70 24 10 278 3 epaB Phenylacetyl-CoA ligase epaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q9L9F6 1.06e-10 70 26 13 324 1 novL 8-demethylnovobiocic acid synthase Streptomyces niveus
B5F750 1.1e-10 70 21 13 463 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella agona (strain SL483)
Q4R4Z9 1.18e-10 70 26 10 307 2 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Macaca fascicularis
Q7ZYC4 1.21e-10 70 21 22 546 2 acsbg2 Long-chain-fatty-acid--CoA ligase ACSBG2 Xenopus laevis
W3X8X8 1.27e-10 71 20 15 483 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A9MYJ6 1.67e-10 69 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T6J6 1.88e-10 69 20 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella newport (strain SL254)
A0A0S2E7W3 2.02e-10 70 24 10 337 2 invA6 Inactive atromentin synthetase invA6 Paxillus involutus
Q84P21 2.04e-10 69 22 7 295 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
B5R1R0 2.29e-10 69 21 13 463 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella enteritidis PT4 (strain P125109)
Q84HC5 2.44e-10 69 22 15 468 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
Q9CAP8 2.57e-10 69 24 12 338 1 LACS9 Long chain acyl-CoA synthetase 9, chloroplastic Arabidopsis thaliana
Q838K1 2.66e-10 68 24 5 286 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q96CM8 2.68e-10 69 27 11 307 1 ACSF2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Homo sapiens
Q6GLK6 2.74e-10 69 21 16 452 2 acsf3 Malonate--CoA ligase ACSF3, mitochondrial Xenopus laevis
Q4G176 2.87e-10 68 21 19 465 1 ACSF3 Malonate--CoA ligase ACSF3, mitochondrial Homo sapiens
Q9P7D7 2.96e-10 69 25 16 408 3 lcf2 Long-chain-fatty-acid--CoA ligase 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
M4IQS1 3.04e-10 68 22 13 436 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
C0Q4L3 3.53e-10 68 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella paratyphi C (strain RKS4594)
Q01158 3.65e-10 68 21 13 427 2 None Luciferin 4-monooxygenase Aquatica lateralis
Q57TJ0 3.85e-10 68 21 13 459 3 caiC Crotonobetaine/carnitine--CoA ligase Salmonella choleraesuis (strain SC-B67)
A4YGR1 4.08e-10 68 22 10 331 1 Msed_1456 3-hydroxypropionyl-coenzyme A synthetase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
P63521 4.4e-10 68 20 17 480 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63522 4.4e-10 68 20 17 480 3 fadD Long-chain-fatty-acid--CoA ligase Salmonella typhi
Q9SJD4 4.56e-10 68 24 16 350 1 LACS8 Long chain acyl-CoA synthetase 8 Arabidopsis thaliana
A8ALR6 4.77e-10 68 23 11 329 3 caiC Crotonobetaine/carnitine--CoA ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A0A0S2E7W7 5.62e-10 68 25 11 331 1 invA5 Atromentin synthetase invA5 Paxillus involutus
P41636 5.68e-10 68 25 11 294 2 4CL 4-coumarate--CoA ligase Pinus taeda
M4IRL6 6.12e-10 67 22 18 491 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
P9WQ55 6.67e-10 67 22 12 453 1 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ54 6.67e-10 67 22 12 453 3 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O24540 7.14e-10 67 23 9 342 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
Q5HRH4 7.17e-10 67 22 11 384 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ67 7.2e-10 67 22 11 384 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P46450 9.31e-10 67 24 11 317 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0S1RUN4 9.66e-10 67 24 12 341 1 invA2 Atromentin synthetase invA2 Paxillus involutus
Q9M0X9 9.73e-10 67 21 15 474 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
Q499N5 1.03e-09 67 26 10 321 2 Acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Rattus norvegicus
Q9CMW1 1.26e-09 67 23 17 477 3 acsA Acetyl-coenzyme A synthetase Pasteurella multocida (strain Pm70)
Q9LU36 1.34e-09 67 22 11 367 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
Q42982 1.35e-09 67 22 11 380 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q84P25 1.45e-09 66 25 12 296 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
Q54P79 1.48e-09 66 23 11 326 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
O25686 1.49e-09 67 25 11 320 3 acsA Acetyl-coenzyme A synthetase Helicobacter pylori (strain ATCC 700392 / 26695)
P9WQ51 2.18e-09 66 22 12 459 1 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ50 2.18e-09 66 22 12 459 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TWB7 2.18e-09 66 22 12 459 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
C5D6U5 2.18e-09 65 26 12 293 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
P13129 2.2e-09 66 22 15 429 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
Q0S4D9 2.4e-09 66 25 11 306 1 casG Steroid-24-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
P9WQ61 2.45e-09 66 24 14 402 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 2.45e-09 66 24 14 402 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 2.45e-09 66 24 14 402 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O35547 2.48e-09 66 33 3 106 1 Acsl4 Long-chain-fatty-acid--CoA ligase 4 Rattus norvegicus
Q8K0L3 2.53e-09 65 19 14 447 1 Acsm2 Acyl-coenzyme A synthetase ACSM2, mitochondrial Mus musculus
P31685 2.69e-09 65 21 10 387 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12835
Feature type CDS
Gene -
Product non-ribosomal peptide synthetase
Location 2834947 - 2841051 (strand: 1)
Length 6105 (nucleotides) / 2034 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3015
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme
PF00550 Phosphopantetheine attachment site
PF00668 Condensation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1020 Secondary metabolites biosynthesis, transport and catabolism (Q) Q EntF, seryl-AMP synthase component of non-ribosomal peptide synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04784 yersiniabactin nonribosomal peptide synthetase Biosynthesis of siderophore group nonribosomal peptides -

Virulence factor Annotation(s)

VF gene ID Protein VF ID Category
VFG044299 non-ribosomal peptide synthetase VF1251 Nutritional/Metabolic factor

Protein Sequence

MKILSDINNIKELCSKQINIDKNKFSDKDNLIKLGLDSIGFMQCLYIFQKNGYAITLKDLYLNPTIKGWYKILKKSDINKKERKDNIYTHKTIKNAGEFSLTPIQHAYFVGRLNKQTLGGVACQIYQEFDGTPKFTPESLEKALVLLSKRHPMLNIVFHQQGTQFWSPNPNRKYVTYHDFSKLPKDEYEKKLLQLREKLSHQVLNVESGQLIDFHMISLPNNRYRLCTNIDMLIADGTSYSLLFTELCLLLSGEILPQLDEHYDFYHYLQDKKQYENKESAYQYWKNKIPNLPDSPLLPLYMDPEKINKIKIKRLSWTFSSKEWKNFSNLAKENNITPSIALATCFSSVLARWTGQNSLLLNFTLFDRKPLAPAVNNIIADFTNVILLEMKTDNRPLISLSKDNQNTFIEAWQHSDYSGIDIIRDLRKNGTHPYGCPVVFTSHINQPLIDKNIESVLGSIGWGISQTPQVWLDHMAINKSGNIVLQWDYNNDLFRNDVITTIFDVYISRIRQLANDPNAWIETQPDLIPKKQLKNRISVIKKDNSLLPHTLHKSIFHNYSNSSKIAVIDIDSQEWSYKKLLSKATILSDQIIQQGYKPEDRIGVCMPKGVGQIISVLAILLMGGTYVPIDVLQPEERINRIAKNAQLSLLIVSDSDPSYSIYATFCNRIVWQKVQPSENKPLHNIDISPHQAAYVIYTSGSTGEPKGVVVSHASAMNTCLDLNRRYNISDKDRVLAISALHFDLSVYDIFGVLNAGGTLVLVKEDERRNPDAWLRLINQHKITLWNSVPALFDMLLTYAEGIGSSIPQSLLLIYLSGDWIGLDLPTRYYNFCPDGQIVAMGGATEAAIWSNYFNVTTLDPSWSSIPYGYPLSNQRYRIVNARGEDCPDWVSGELWIGGAGVALGYLNDPEKTAQQFVKQNGENWYKTGDMGRYLPGGILEFLGRRDRQVKIGGYRIEPGEIDAAFNKLQGVQNAITLCLGNGNKEKALHSFVILNSGNYQDIISSNSTFSPLYYLRSTPINVQQQSQETAIIAGFLYDYLTEQNIDFDNLLSEKKSADDHSIIASYQSLMANWLNLIAQYPQTTLNSPPTNSTQRTLIENLQRHKNNLTDILKGKKSALTLFDDPYWSPEQVTMRIDGMHYSLENLLQQIRELHHSLKRPIKIIQLGARSGISANYILQRLPTNMVTLLLTDESLSMVTQANQNLSDYQNSYAEPLTEVFLHKNRYSADIIWMNNYLHRLDSPQKEIQKFVSLCAPSGMIFIQEVLHAPAQSLISISLLQQNGSDPADELLTAKKCKDIFSASTATYKSEGVNGEILTQLYQAPEKIYLPDKNKLEHDLRQFLPDYMIPKHIYFLTEFPLTANGKIDNQSLKLYCQEYQEEYLNQQPINGKEQIIITIWQKLLGTNKIHRHSHFFREGGDSLVAIRLISDLNHIGYQVELEHIFAYPILSDFAQNIKQSEVFEKQPAISHNEAYRYNPFPLTDIQQAYLVGRQNNFTLGGVGTHFFVHFIAENLDVPKLERTINQLISRHDMLRGVIINGQQQVLKKVPYYSVKTHYIPTEKSDSFLVLRAQLANIVYDPEIWPLFTIQVIKTKEQPDHIFISLDNLFLDGMSMQIFFSELKTLYMEPNHQFIPLDITFRDYIDCDAYPINTQNDWEYWLTRLPQLPPAPQLPLIKDPAQIVQPRFSRLQTSLSTSVWQALQQVAQQNNVTPAALLIAAYCATLSAWSKSPELTINLTLFNRHPVHPQINEVLGDFTSLQLLDWYTCDLWSNSISMMQKRLHKDMQHRSVSAIKVMREMAIQRQMSHIEIPVVFTCALGYKHDEGFLSHHSWLKPVWGISQTPQTWLDHQVYESDGELYLNWDFVEQLFDYTTIFSMFQQYEHILTKLATEPQSWQLPLNKLIPRCNNLVITPVFNAKNNQNTHYKQSTDTQKTGQTIQKLQQLVKQVIGITLAPETNFFEAGASSLQLVQLHAALQKNGYSHITITDLFASPNLSTLAQLLWQNTSPTCEQYSDRDKHKNKRKKRLQLRTHSR

Flanking regions ( +/- flanking 50bp)

GTACCAATGGCAATCCTCCGCCATAAATAACTCATAATTAAGGTATAGAAATGAAAATATTAAGTGATATTAATAACATAAAAGAATTATGTTCCAAGCAAATAAACATTGACAAAAATAAATTTTCAGATAAGGACAATCTGATAAAATTAGGTCTTGATTCAATTGGATTTATGCAATGTTTATATATTTTCCAAAAAAATGGTTATGCTATAACATTAAAAGATTTGTATTTAAATCCAACAATAAAAGGATGGTATAAAATATTAAAAAAATCAGATATAAATAAAAAAGAAAGAAAAGATAATATATATACACATAAAACAATAAAAAATGCTGGTGAGTTTTCACTTACACCTATACAACATGCCTATTTTGTCGGCCGTTTGAATAAACAAACTCTTGGTGGTGTTGCTTGCCAAATTTATCAAGAATTTGATGGCACCCCTAAATTTACTCCGGAAAGTCTAGAGAAAGCATTAGTATTATTATCAAAACGTCATCCCATGTTGAATATAGTATTTCACCAACAGGGTACACAATTTTGGTCTCCTAACCCAAATAGAAAATATGTTACATATCATGATTTTAGTAAATTACCAAAAGATGAGTATGAGAAAAAACTTTTACAATTACGGGAAAAATTAAGCCATCAGGTACTAAATGTTGAAAGCGGTCAGTTAATTGATTTTCACATGATATCGCTACCTAACAACAGATATCGTTTATGTACTAATATTGATATGTTGATTGCAGATGGTACAAGTTATTCATTACTCTTTACTGAACTTTGTTTATTATTGAGCGGAGAAATACTGCCTCAGTTAGATGAGCACTATGACTTTTACCATTATTTACAAGATAAAAAACAGTATGAAAACAAAGAATCAGCATATCAATATTGGAAAAATAAAATCCCAAACCTACCAGACTCTCCTCTTCTGCCATTATATATGGATCCAGAAAAAATAAATAAAATAAAAATTAAACGCCTTAGCTGGACATTTAGCTCAAAAGAATGGAAAAACTTTAGTAATTTGGCTAAAGAAAATAATATTACACCTTCCATTGCATTAGCAACCTGTTTCTCATCTGTACTTGCAAGATGGACTGGCCAAAATAGCTTATTACTCAACTTTACATTATTTGATAGAAAGCCATTAGCCCCTGCAGTTAATAATATTATAGCTGATTTTACTAATGTCATTCTTTTAGAAATGAAAACAGACAATCGACCATTAATTTCATTATCTAAAGACAATCAAAATACATTTATTGAAGCTTGGCAACATTCTGATTATTCTGGTATTGATATCATTAGAGACCTTCGTAAAAATGGCACCCATCCTTATGGGTGTCCTGTTGTCTTTACTAGCCATATTAATCAACCACTTATTGATAAAAATATAGAATCTGTATTAGGTTCTATAGGATGGGGAATATCACAAACCCCACAAGTTTGGCTTGATCACATGGCAATTAACAAAAGTGGAAATATTGTTTTACAGTGGGATTATAACAATGACTTGTTCCGGAATGATGTTATAACAACAATATTTGATGTTTATATTTCTCGTATACGCCAACTTGCCAACGATCCTAATGCCTGGATTGAAACCCAACCTGATTTAATTCCTAAAAAACAATTAAAAAATAGAATATCAGTTATCAAAAAAGATAATTCACTATTACCACATACACTGCATAAGTCTATTTTCCATAATTATTCAAATTCATCAAAAATTGCTGTCATTGATATCGACTCTCAGGAATGGAGCTACAAAAAATTATTATCTAAAGCAACAATACTCAGTGATCAAATAATACAACAAGGTTATAAACCAGAAGACAGAATTGGTGTATGTATGCCAAAAGGAGTAGGGCAAATCATTAGCGTTCTGGCTATTTTATTAATGGGGGGAACTTATGTTCCGATTGATGTACTACAACCAGAAGAACGTATAAACCGCATTGCTAAAAATGCTCAGCTTTCATTACTCATCGTATCTGATAGCGATCCATCCTATTCAATCTATGCTACATTTTGTAACAGGATTGTTTGGCAAAAAGTTCAACCCTCCGAGAATAAACCACTACACAATATAGATATATCTCCTCATCAAGCAGCTTATGTTATTTATACTTCAGGTTCTACTGGAGAGCCTAAAGGTGTTGTTGTATCCCATGCCAGCGCAATGAATACCTGCCTTGATCTCAATCGGCGATATAACATTTCAGACAAAGATCGGGTACTTGCCATATCAGCACTACATTTTGATCTGTCTGTTTATGATATTTTCGGTGTTTTAAATGCCGGAGGGACTCTTGTATTAGTTAAAGAAGATGAGCGCCGTAATCCTGATGCATGGTTACGACTTATTAACCAACATAAAATAACACTTTGGAACAGCGTACCTGCACTGTTTGATATGTTACTAACCTATGCAGAAGGAATAGGGTCATCCATTCCACAATCGCTGCTATTAATCTATCTCTCTGGAGATTGGATTGGGCTTGATCTCCCGACACGTTACTATAATTTCTGCCCTGATGGACAAATAGTCGCCATGGGAGGTGCCACAGAAGCCGCTATTTGGTCTAACTATTTTAATGTCACAACATTAGACCCATCCTGGAGCTCGATACCTTATGGATATCCTTTATCCAACCAACGTTATCGTATTGTTAATGCTAGAGGAGAAGATTGCCCTGATTGGGTATCAGGAGAACTTTGGATTGGTGGTGCAGGCGTTGCGTTAGGCTACCTAAACGATCCCGAAAAAACAGCACAACAGTTTGTAAAACAAAATGGTGAAAATTGGTATAAAACAGGTGATATGGGAAGATATCTCCCTGGCGGTATACTTGAATTTTTAGGAAGACGTGACCGCCAAGTTAAGATTGGCGGATACCGTATAGAACCAGGGGAAATTGATGCTGCATTCAATAAGCTTCAGGGTGTGCAAAATGCGATTACACTATGCCTTGGTAATGGTAATAAAGAAAAAGCATTACACTCTTTTGTGATACTAAATTCGGGTAATTACCAGGATATTATCAGTTCAAATAGCACCTTTTCTCCCCTCTACTATCTGCGCTCAACCCCAATAAATGTACAACAACAATCCCAAGAAACGGCAATCATAGCTGGATTTTTATATGATTATCTTACTGAACAAAATATTGATTTCGACAACCTCTTGTCAGAAAAAAAATCAGCAGATGACCATAGCATTATCGCTAGCTATCAGTCATTAATGGCTAATTGGCTAAATTTAATAGCACAATATCCACAAACTACACTCAATTCCCCCCCAACTAATAGTACCCAGCGAACGCTAATAGAAAATTTGCAGCGCCACAAAAACAATTTAACAGACATACTCAAAGGTAAAAAATCAGCTCTAACACTATTTGATGATCCCTATTGGTCACCAGAACAAGTCACTATGCGTATTGATGGAATGCACTACTCCTTAGAAAATTTACTACAACAAATAAGAGAACTTCATCATTCACTAAAAAGGCCAATAAAAATCATTCAATTAGGTGCTAGAAGCGGTATTTCAGCAAATTATATTCTGCAACGATTACCCACTAATATGGTTACCCTACTGCTAACTGATGAGTCTCTTTCAATGGTAACGCAAGCTAACCAAAATTTATCAGATTATCAAAATAGTTATGCTGAGCCTCTTACAGAAGTATTTCTTCATAAAAATCGATATAGTGCAGATATCATTTGGATGAACAATTATCTTCATCGATTAGACAGCCCACAAAAAGAGATACAAAAATTCGTTTCACTCTGTGCTCCGAGTGGAATGATTTTTATACAAGAAGTGTTACATGCCCCTGCACAATCACTGATAAGCATCTCTTTATTACAACAAAATGGTAGTGATCCTGCTGATGAATTATTAACAGCAAAAAAATGCAAAGATATCTTTAGCGCTTCTACTGCGACTTATAAAAGTGAAGGAGTTAACGGCGAAATATTGACACAGTTATACCAAGCACCAGAAAAAATTTATTTACCAGATAAAAATAAGCTAGAGCATGATTTGCGCCAATTTTTACCAGACTATATGATCCCAAAACATATTTATTTTCTAACTGAGTTCCCCTTAACCGCAAATGGCAAAATAGATAACCAATCATTAAAATTGTATTGTCAGGAATACCAAGAAGAATACCTAAATCAACAACCTATCAATGGTAAAGAACAGATCATCATAACAATATGGCAAAAGCTCCTTGGCACCAACAAGATACACCGTCACAGTCATTTCTTTCGTGAAGGGGGAGATAGCCTAGTTGCTATTCGATTGATCTCTGATTTAAACCATATTGGCTACCAAGTTGAACTGGAGCATATCTTTGCTTATCCGATCCTTTCTGATTTTGCACAAAATATAAAGCAGAGCGAAGTTTTCGAAAAACAGCCAGCAATTTCACATAACGAGGCGTATAGATACAATCCATTTCCACTCACTGATATTCAGCAAGCTTACTTAGTTGGACGGCAAAATAATTTTACACTTGGGGGTGTTGGTACACATTTTTTTGTCCATTTTATAGCGGAAAATTTAGATGTACCTAAATTAGAACGTACAATTAATCAGTTGATTTCTCGTCATGATATGTTACGTGGTGTCATTATTAATGGACAACAACAAGTACTTAAAAAAGTTCCTTATTATTCCGTTAAAACGCATTATATCCCTACAGAAAAAAGTGACTCTTTTCTAGTATTACGAGCTCAACTTGCTAACATTGTTTATGATCCAGAAATTTGGCCTTTATTTACTATTCAAGTTATCAAAACCAAAGAACAACCAGATCATATTTTTATTAGCCTTGATAACTTATTCCTTGATGGAATGAGTATGCAGATATTTTTCAGTGAGCTAAAAACACTGTATATGGAGCCAAATCACCAATTTATCCCTCTAGATATTACTTTTCGAGATTATATTGATTGTGATGCCTATCCGATTAACACACAAAATGATTGGGAATATTGGTTAACGCGTTTACCACAATTACCACCAGCCCCACAATTGCCACTAATAAAAGATCCAGCACAGATTGTGCAACCTCGCTTCTCGCGTTTACAAACATCATTATCTACTTCTGTTTGGCAAGCACTACAACAAGTTGCTCAGCAAAATAATGTTACGCCAGCAGCACTTTTGATTGCTGCTTATTGCGCCACATTATCCGCATGGAGTAAAAGCCCTGAGTTAACAATTAATTTGACATTATTTAATCGGCATCCTGTACATCCTCAAATAAATGAAGTACTTGGTGATTTTACCTCATTACAATTACTCGATTGGTATACCTGTGATCTTTGGTCAAACAGTATCTCAATGATGCAAAAACGTTTACATAAAGATATGCAACATCGTAGTGTTTCAGCCATTAAAGTAATGCGTGAAATGGCAATTCAACGACAGATGTCTCATATAGAGATACCTGTCGTTTTTACCTGTGCATTGGGCTATAAACATGATGAAGGTTTTCTTTCTCATCATTCATGGCTAAAACCTGTTTGGGGAATATCACAAACACCACAAACATGGCTAGATCATCAAGTATATGAGTCAGACGGTGAATTATATTTAAACTGGGATTTTGTCGAACAATTATTTGACTACACAACCATTTTTTCCATGTTCCAGCAATATGAACATATACTCACTAAACTGGCTACTGAACCACAATCTTGGCAATTGCCACTAAATAAACTTATACCAAGATGCAATAATCTCGTCATCACCCCAGTTTTCAATGCCAAAAATAATCAAAACACACATTATAAACAATCTACTGATACACAAAAAACAGGTCAGACAATACAAAAACTACAACAACTTGTTAAGCAAGTTATTGGAATAACGTTAGCACCTGAAACAAATTTTTTCGAAGCAGGTGCCAGCTCTTTACAATTGGTTCAACTTCATGCAGCACTACAAAAAAATGGCTATAGCCATATTACAATTACTGATCTGTTCGCTAGTCCAAATCTAAGTACATTAGCGCAATTGCTTTGGCAAAACACTTCACCAACATGTGAGCAATATTCCGACCGAGACAAACACAAAAACAAGAGAAAGAAACGGTTACAACTACGAACTCATAGTAGATAAAGGATATTAATCATGCTGAATTTTGAAACTTTCTATGGTAATAGTGAACC