Homologs in group_3649

Help

3 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
F4V73_RS08455 F4V73_RS08455 29.3 Morganella psychrotolerans - molecular chaperone
F4V73_RS10245 F4V73_RS10245 31.7 Morganella psychrotolerans - molecular chaperone
F4V73_RS13325 F4V73_RS13325 26.4 Morganella psychrotolerans - molecular chaperone

Distribution of the homologs in the orthogroup group_3649

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3649

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P45991 3.56e-16 79 28 8 218 3 hifB Chaperone protein HifB Haemophilus influenzae
P46004 7.64e-16 78 25 10 258 3 aggD Chaperone protein AggD Escherichia coli
P33407 2.32e-15 77 25 10 254 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P35757 1.65e-14 74 27 7 218 3 hifB Chaperone protein HifB Haemophilus influenzae
P37923 3.04e-14 73 30 10 214 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69966 5.89e-14 73 25 9 230 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 5.89e-14 73 25 9 230 3 psaB Chaperone protein PsaB Yersinia pestis
P75856 7.08e-14 72 28 8 207 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P62609 1.3e-13 71 27 8 205 1 focC Chaperone protein FocC Escherichia coli
P62610 1.3e-13 71 27 8 205 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P59590 1.87e-13 71 26 12 251 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8X5E4 4.12e-13 70 27 8 207 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P31697 1.02e-12 69 26 12 251 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P77249 1.98e-12 68 27 11 246 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P77616 3.03e-12 68 33 12 195 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P43661 2.58e-11 65 28 11 209 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33409 3.01e-11 65 28 5 175 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P53516 1.93e-10 63 25 7 202 3 afaB Chaperone protein AfaB Escherichia coli
P15319 2.11e-10 62 33 5 139 1 papD Chaperone protein PapD Escherichia coli
P26926 5.04e-10 62 26 11 231 1 caf1M Chaperone protein caf1M Yersinia pestis
P21646 9.37e-10 60 27 8 183 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
Q8X5K6 2.95e-09 59 25 7 185 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P75749 3.82e-09 59 27 3 139 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P53519 5.52e-09 58 23 5 218 3 cssC Chaperone protein CssC Escherichia coli
P53520 9.49e-09 58 26 5 179 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P42914 1e-08 57 29 3 127 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P53518 1.37e-08 57 23 5 219 3 cssC Chaperone protein CssC Escherichia coli
P33387 8.66e-08 55 24 10 258 3 sefB Chaperone protein SefB Salmonella enteritidis
P77599 7.86e-07 52 29 9 163 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P33128 1.66e-06 51 26 7 191 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P15483 9.22e-06 49 26 9 210 3 None Chaperone protein CS3-1 Escherichia coli
P25402 1.54e-05 48 25 11 226 3 fanE Chaperone protein FanE Escherichia coli
P25401 0.000116 46 27 7 132 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 0.000454 44 26 6 132 3 clpE Chaperone protein ClpE Escherichia coli

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS12530
Feature type CDS
Gene -
Product molecular chaperone
Location 2779505 - 2780320 (strand: -1)
Length 816 (nucleotides) / 271 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3649
Orthogroup size 4
N. genomes 2

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Protein Sequence

MLSFLRGRKKNIIQIVIFCLFFLSYSVTSKAVEKIENDTVDLTDFGKNGFSFVVKRYIYLESDIKGISISLKNNNNSAYLINSSILFNDDDKNVPIVNKDRERTPFMILPPLYRLEPSSEYSWNIRRISEGSNDMALPKDRESLFWIAFRAVPLKDSKIEEKKSVSLTITPTFFFKLIYRPESIMALENKDVIDDVIVEKVNENIVINNKSPLYMTFEYLKVGEVEIKNDGRAITVKPFSTVSVEAPKNVQGKLSWRFNDENFFIIKDKEY

Flanking regions ( +/- flanking 50bp)

TGGTGGATTATCAAATACATTTGAAAATAAAATAATTGTGGAGTGACTAAATGTTATCTTTTTTAAGAGGTAGAAAAAAAAATATTATCCAGATAGTCATATTCTGCCTATTTTTTCTATCTTATTCAGTCACATCGAAAGCAGTTGAAAAAATAGAAAACGATACTGTGGATCTAACAGATTTCGGGAAAAATGGTTTTTCTTTTGTAGTAAAAAGATATATCTATCTGGAAAGTGATATAAAAGGTATCTCTATCTCTTTAAAAAATAATAACAATAGTGCTTATTTAATTAATAGCTCTATTTTATTTAATGATGATGATAAAAATGTACCTATAGTGAATAAAGATCGTGAAAGAACACCTTTTATGATTTTACCACCTTTGTATCGTTTAGAACCCTCTAGTGAATATAGCTGGAATATTCGTCGTATTAGTGAAGGTTCTAATGATATGGCGTTACCAAAAGACAGAGAAAGCTTATTTTGGATTGCATTTAGAGCAGTTCCTCTTAAGGATAGTAAAATTGAGGAAAAGAAATCTGTGTCACTAACGATAACACCTACTTTCTTCTTCAAATTAATTTATAGACCTGAGTCAATAATGGCATTGGAAAATAAAGATGTTATTGATGATGTTATTGTTGAAAAGGTAAATGAGAACATAGTTATAAATAATAAATCACCACTTTATATGACTTTTGAATATTTAAAAGTGGGCGAGGTTGAAATAAAAAATGATGGTAGAGCAATAACGGTAAAACCATTCTCTACAGTATCAGTTGAAGCACCTAAAAATGTTCAAGGAAAGCTGAGTTGGAGATTCAATGATGAAAATTTCTTTATAATAAAAGATAAAGAATATTAACTTAACAATAATTCTTATTTATGGGTGGTCTTTGGGGTGGTTTATGAAAC