Homologs in group_4554
0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.
| Locus tag | Identity | Source | Gene | Product |
|---|
Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).
| Swissprot accession | Eval | Score | ID (%) | N gaps | Alignment length | Annot score | Gene | Description | Organism |
|---|---|---|---|---|---|---|---|---|---|
| Q0AI31 | 0.000217 | 40 | 32 | 1 | 80 | 3 | flhD | Flagellar transcriptional regulator FlhD | Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57) |
| Q82SD3 | 0.000431 | 39 | 31 | 1 | 80 | 3 | flhD | Flagellar transcriptional regulator FlhD | Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298) |
| O85806 | 0.000583 | 39 | 27 | 1 | 100 | 3 | flhD | Flagellar transcriptional regulator FlhD | Serratia marcescens |
| Source | Proteus mirabilis HI4320 |
|---|---|
| Locus tag | PMI_RS12010 |
| Feature type | CDS |
| Gene | - |
| Product | flagellar transcriptional regulator FlhD |
| Location | 2654467 - 2654766 (strand: 1) |
| Length | 300 (nucleotides) / 99 (amino acids) |
| Accession | NC_010554 |
|---|---|
| Length | 4063606 nucleotides |
| Topology | circular |
| Plasmid | False |
| Orthogroup | group_4554 | |
|---|---|---|
| Orthogroup size | 1 | |
| N. genomes | 1 |
| PF05247 | Flagellar transcriptional activator (FlhD) |
|---|
| KO | Description | Pathways | Modules |
|---|---|---|---|
| K02403 | flagellar transcriptional activator FlhD | Two-component system Quorum sensing Biofilm formation - Escherichia coli Flagellar assembly |
- |
MTTNQQDFYQLNLAYLHAARELARIDPQEAVLRFGLTRDVVDALINAGVDDLQRVATSSFMLFQPRGNQSQLIEMVKSKGTGIPRIAYLLSTLNNKGDA
AGAGTGCTTTCTATTTATCGCAATATTTTACATGAACTGGAGGTCCGTCAATGACAACCAATCAACAAGACTTCTATCAATTAAACTTGGCGTACCTGCACGCAGCACGGGAATTGGCGCGCATTGATCCGCAAGAGGCTGTCTTGCGCTTTGGACTTACACGCGATGTGGTTGATGCTCTGATTAATGCTGGTGTTGACGACCTGCAACGAGTAGCGACCTCATCATTCATGCTGTTTCAACCAAGGGGTAACCAAAGCCAACTGATTGAGATGGTGAAGAGCAAAGGCACAGGTATCCCAAGAATCGCTTATTTATTATCAACCCTAAACAACAAGGGGGATGCATGATTGATAACCTGTCCAAAAGTGAGCTGTTTACCCGAGCCTCGCTACTTATT
