Homologs in group_1164

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06265 FBDBKF_06265 74.4 Morganella morganii S1 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
EHELCC_09310 EHELCC_09310 74.4 Morganella morganii S2 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
NLDBIP_09690 NLDBIP_09690 74.4 Morganella morganii S4 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
LHKJJB_08065 LHKJJB_08065 74.4 Morganella morganii S3 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
HKOGLL_07615 HKOGLL_07615 74.4 Morganella morganii S5 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
F4V73_RS15655 F4V73_RS15655 74.4 Morganella psychrotolerans rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA

Distribution of the homologs in the orthogroup group_1164

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1164

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2I2 0.0 566 100 0 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Proteus mirabilis (strain HI4320)
Q7N8V7 1.2e-163 457 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D0E0 1.48e-158 444 76 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DEY6 2.1e-158 444 76 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A4TQD8 1.64e-154 434 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis (strain Pestoides F)
Q1CMT2 1.64e-154 434 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZZ0 1.64e-154 434 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIK5 1.64e-154 434 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis
Q1C0H5 1.64e-154 434 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Antiqua)
B1JKY3 9.17e-154 432 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EQ8 9.17e-154 432 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K487 9.17e-154 432 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMC1 9.17e-154 432 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VGP6 2.69e-153 431 74 0 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A8G9P0 2.9e-153 431 75 0 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Serratia proteamaculans (strain 568)
A1JJF4 7.65e-150 422 74 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B5Y1Z4 1.73e-149 421 72 0 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Klebsiella pneumoniae (strain 342)
Q57TH0 1.78e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella choleraesuis (strain SC-B67)
A6T4I7 2.91e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TWT6 3.32e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella schwarzengrund (strain CVM19633)
Q8Z9J7 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella typhi
B5BL27 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi A (strain AKU_12601)
C0Q5E7 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi C (strain RKS4594)
A9MYM4 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PDD9 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TJ47 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella heidelberg (strain SL476)
B5RGC2 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1S8 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella enteritidis PT4 (strain P125109)
B5FI34 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella dublin (strain CT_02021853)
B5F771 3.54e-147 416 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella agona (strain SL483)
Q56016 7.07e-147 415 72 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8ALP9 1.96e-146 414 70 0 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MQG2 3.5e-146 413 71 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4T6L6 7.13e-146 412 71 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella newport (strain SL254)
B7LVU5 1.55e-145 411 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N7S6 2.4e-145 411 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7L4H4 2.63e-145 411 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain 55989 / EAEC)
A7ZHE4 3.27e-145 410 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O139:H28 (strain E24377A / ETEC)
B7MNR0 3.57e-145 410 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O81 (strain ED1a)
A4W6F7 6.04e-145 410 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Enterobacter sp. (strain 638)
Q83MG8 8.66e-145 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella flexneri
B6HZ32 9.35e-145 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain SE11)
Q3Z5V8 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella sonnei (strain Ss046)
Q0T8E4 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella flexneri serotype 5b (strain 8401)
Q326I2 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella boydii serotype 4 (strain Sb227)
B1LFY7 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain SMS-3-5 / SECEC)
P06992 1.33e-144 409 70 0 265 1 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12)
B1IRC5 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZW03 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O9:H4 (strain HS)
B1XC52 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12 / DH10B)
C4ZPX7 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0E8 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O8 (strain IAI1)
B7NHF7 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5YZ89 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA14 1.33e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O157:H7
Q1RGE6 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain UTI89 / UPEC)
Q8FL96 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLT6 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7A0 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O1:K1 / APEC
B7MAH6 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI99 1.57e-144 409 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q2NVX6 2.24e-144 408 70 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Sodalis glossinidius (strain morsitans)
B2U259 3.68e-144 408 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7MIA7 1.21e-143 407 69 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Cronobacter sakazakii (strain ATCC BAA-894)
Q32K43 1.34e-143 406 70 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella dysenteriae serotype 1 (strain Sd197)
P44749 8.68e-129 369 63 1 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UH57 9.47e-129 369 63 1 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain PittGG)
A5U9U3 9.47e-129 369 63 1 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain PittEE)
Q4QMZ9 1.53e-128 369 63 1 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain 86-028NP)
Q65UX3 4.57e-127 365 63 1 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CLL5 1.2e-126 364 62 1 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Pasteurella multocida (strain Pm70)
A0KGT8 3.13e-126 362 63 0 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A7MWC6 8.13e-125 359 61 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio campbellii (strain ATCC BAA-1116)
Q87ST6 1.08e-124 358 61 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B0URM7 3.16e-124 358 62 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Histophilus somni (strain 2336)
Q0I5C3 3.16e-124 358 62 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Histophilus somni (strain 129Pt)
C4K4K9 3.34e-123 355 61 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
B0BTQ4 3.04e-122 353 62 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3MZB7 4.5e-122 352 62 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3H0R3 9.79e-122 352 62 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q6LV41 1.29e-121 351 61 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Photobacterium profundum (strain SS9)
B5FGG5 1.41e-121 351 60 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio fischeri (strain MJ11)
Q5E865 1.41e-121 351 60 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EL48 1.99e-121 350 60 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio salmonicida (strain LFI1238)
Q9KUS2 6.79e-121 349 60 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F8N2 6.79e-121 349 60 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A1STS1 8.91e-121 348 62 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q7VM33 9.42e-121 349 60 1 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B1KGH9 9.78e-121 348 62 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella woodyi (strain ATCC 51908 / MS32)
Q7MP86 1.95e-120 348 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio vulnificus (strain YJ016)
Q8DED2 1.95e-120 348 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio vulnificus (strain CMCP6)
A3QBA3 2.33e-120 347 62 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FRV2 3.88e-120 347 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sediminis (strain HAW-EB3)
B8CSX5 1.95e-119 345 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella piezotolerans (strain WP3 / JCM 13877)
A1S9G5 1.12e-118 343 62 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B7VIE2 1.48e-118 343 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio atlanticus (strain LGP32)
A8H0V2 2.3e-118 342 63 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TV52 7.9e-118 341 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella halifaxensis (strain HAW-EB4)
Q07YJ8 9.33e-118 341 61 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella frigidimarina (strain NCIMB 400)
Q12K59 1.9e-117 340 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A0L064 3.83e-117 339 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain ANA-3)
Q0HS06 4.46e-117 339 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain MR-7)
Q0HLT2 3.72e-116 337 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain MR-4)
A1RMU8 3.93e-116 337 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain W3-18-1)
A4Y435 3.93e-116 337 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3D188 6.94e-116 336 60 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EB35 6.94e-116 336 60 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS223)
A9L438 7.58e-116 336 60 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS195)
A6WK59 7.58e-116 336 60 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS185)
Q8EB93 7.74e-116 336 61 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q5QVN7 1.02e-115 337 60 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3IFD1 7.7e-115 333 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudoalteromonas translucida (strain TAC 125)
C4L9L4 4.63e-114 332 57 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q47VJ8 3.68e-110 323 57 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1LSS2 1.1e-104 308 56 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Baumannia cicadellinicola subsp. Homalodisca coagulata
Q6F8A0 6.7e-95 283 53 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5P7J1 3.99e-92 276 52 2 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C1D9C2 2.55e-91 273 53 3 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Laribacter hongkongensis (strain HLHK9)
Q21MT0 8.29e-91 273 55 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A6VU53 1.08e-90 272 53 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Marinomonas sp. (strain MWYL1)
A1U6F8 1.61e-90 272 50 2 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1LRA1 6.96e-90 270 50 3 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q63X76 7.68e-90 270 51 3 272 1 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain K96243)
Q3JVW6 7.68e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 1710b)
A1V727 7.68e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain SAVP1)
Q62MM2 7.68e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain ATCC 23344)
A2S8N7 7.68e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain NCTC 10229)
A3MNW4 7.68e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain NCTC 10247)
A3N5X6 9.14e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 668)
A3NRM0 9.14e-90 270 51 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 1106a)
Q7P1U1 1.13e-89 269 53 3 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1GZB8 1.39e-89 269 52 2 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q5ZRF4 3.44e-89 268 50 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
A5IIC0 9.09e-89 267 50 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Corby)
Q5X0V1 9.09e-89 267 50 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Paris)
B4EBE8 1.44e-88 267 51 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q5WSM3 1.79e-88 266 49 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Lens)
Q39D37 6.7e-88 265 51 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0BC07 1.17e-87 265 50 3 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8Y219 1.22e-87 265 52 3 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q479U6 1.5e-87 264 51 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Dechloromonas aromatica (strain RCB)
Q9I5U5 2.65e-87 263 50 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A9AFE4 4.47e-87 263 50 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia multivorans (strain ATCC 17616 / 249)
Q1BTQ8 4.87e-87 263 51 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia orbicola (strain AU 1054)
B1JY71 4.87e-87 263 51 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia orbicola (strain MC0-3)
A0KAD1 4.87e-87 263 51 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia cenocepacia (strain HI2424)
Q2S9C3 7.29e-87 263 50 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Hahella chejuensis (strain KCTC 2396)
A9M352 1.97e-86 261 50 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup C (strain 053442)
B1YWD5 3.39e-86 261 50 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia ambifaria (strain MC40-6)
B2AH89 3.74e-86 261 49 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
C5CS95 4.5e-86 260 51 3 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Variovorax paradoxus (strain S110)
Q0VMV2 5.12e-86 261 51 2 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2T114 1.2e-85 259 51 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9JVC2 2.05e-85 258 49 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KSW0 4.12e-85 258 49 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B2JCX3 4.34e-85 258 51 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q9K0B7 4.4e-85 258 49 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0KEA7 5.05e-85 258 49 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B1Y7L9 6.03e-85 258 50 5 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q8KA00 6.29e-85 258 46 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1QZ31 7.46e-85 258 51 2 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q475Q1 1.29e-84 257 49 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A4JHP7 1.49e-84 257 49 3 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q223E6 2.16e-84 256 50 5 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
B4RJV5 4.24e-84 255 49 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria gonorrhoeae (strain NCCP11945)
Q5F9W4 5.57e-84 255 49 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1WVT7 5.75e-84 255 51 2 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Halorhodospira halophila (strain DSM 244 / SL1)
Q3JAF3 7.64e-84 254 50 2 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q7VQK3 1.67e-83 254 45 2 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Blochmanniella floridana
A9I5F2 1.71e-83 254 51 4 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q493R7 8.03e-83 252 44 2 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Blochmanniella pennsylvanica (strain BPEN)
Q4FT44 1.59e-82 252 50 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q3SGF7 1.93e-82 251 51 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Thiobacillus denitrificans (strain ATCC 25259)
Q88QT6 2.03e-82 251 48 1 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1QAR8 4.16e-82 251 49 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P57241 1.45e-81 249 43 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q145L1 1.96e-81 249 48 3 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia xenovorans (strain LB400)
Q4ZMG5 4.52e-81 248 48 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas syringae pv. syringae (strain B728a)
B2SX63 6.16e-81 248 48 3 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q2YBP5 9.4e-81 246 49 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
B9MIF6 1.75e-80 246 49 5 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidovorax ebreus (strain TPSY)
Q48NT7 1.92e-80 246 47 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q88A46 2.19e-80 246 47 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4K4X5 2.63e-80 246 48 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1WD86 8.56e-79 241 48 5 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidovorax sp. (strain JS42)
Q3K5T2 1.03e-78 242 47 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas fluorescens (strain Pf0-1)
A1VUN7 9.41e-78 239 46 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Polaromonas naphthalenivorans (strain CJ2)
Q83AC2 1.7e-77 238 46 1 254 1 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B6J3A6 1.7e-77 238 46 1 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain CbuG_Q212)
Q87C85 2.25e-77 238 47 0 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q31F24 2.65e-77 238 46 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B6J641 3.57e-77 238 46 1 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain CbuK_Q154)
A4G256 3.74e-77 237 48 3 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Herminiimonas arsenicoxydans
A1WS95 4.43e-77 238 48 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Verminephrobacter eiseniae (strain EF01-2)
Q9PBJ6 5.68e-77 237 47 0 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xylella fastidiosa (strain 9a5c)
A9N9I7 7.74e-77 236 46 1 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain RSA 331 / Henzerling II)
A6SV13 1.43e-76 236 48 3 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Janthinobacterium sp. (strain Marseille)
A9KGZ8 2.77e-76 235 46 1 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain Dugway 5J108-111)
P59524 4.55e-76 234 45 2 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B0RUI3 1.85e-75 233 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain B100)
Q2KXA2 1.98e-75 233 46 5 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella avium (strain 197N)
Q8PCE3 2e-75 233 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UR39 2e-75 233 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain 8004)
Q3BX82 2.11e-75 233 46 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q7WG20 2.48e-75 233 49 5 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W4J6 5.6e-75 232 49 5 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8PP25 9.88e-75 231 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas axonopodis pv. citri (strain 306)
Q82W15 2.1e-74 230 46 2 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7VU11 3.88e-74 230 49 5 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5GWB9 9.7e-74 229 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SPT3 9.7e-74 229 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZI4 9.7e-74 229 45 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q60B77 1.25e-73 228 47 3 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B7J3R3 1.75e-73 228 47 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B5EL84 1.89e-73 228 47 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
A5EY68 5.46e-73 227 44 1 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Dichelobacter nodosus (strain VCS1703A)
A1TWF5 3.51e-71 222 45 4 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Paracidovorax citrulli (strain AAC00-1)
A2SC77 3.86e-71 222 48 3 249 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q9RED9 7.69e-67 212 46 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia sp.
Q0AGQ8 1.88e-64 205 45 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q121Q5 4.44e-63 204 39 6 313 3 rsmA Ribosomal RNA small subunit methyltransferase A Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q8D3I1 2.67e-62 199 42 0 250 3 rsmA Ribosomal RNA small subunit methyltransferase A Wigglesworthia glossinidia brevipalpis
B0TZ54 7.13e-62 199 42 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A0Q5E0 2.46e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. novicida (strain U112)
A4IZF1 4.87e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKP7 4.87e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain OSU18)
B2SDQ1 4.87e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A218 4.87e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain LVS)
A7NDV3 4.87e-60 194 42 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
Q5NHI5 1.43e-58 190 41 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14IY7 1.43e-58 190 41 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain FSC 198)
A0LA32 5.51e-57 186 41 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q3A3G8 7.58e-56 183 40 3 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A9KL97 1.32e-55 183 37 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2W0V3 2.35e-54 180 42 6 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q97EX0 7.06e-54 179 37 3 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q2RME8 1.07e-53 178 36 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A6TJK9 3.08e-53 177 37 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Alkaliphilus metalliredigens (strain QYMF)
Q2RXA9 5.25e-53 177 43 7 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q74C12 1.07e-52 176 40 4 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B4RBS4 2.28e-52 175 38 3 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Phenylobacterium zucineum (strain HLK1)
Q181C1 4.45e-51 172 34 5 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridioides difficile (strain 630)
Q8UGD5 4.84e-51 171 39 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9A7N5 5.15e-51 171 39 3 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1GI39 9.16e-51 171 41 8 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Ruegeria sp. (strain TM1040)
A1B0G4 9.99e-51 171 40 7 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Paracoccus denitrificans (strain Pd 1222)
B4S787 1.14e-50 170 40 6 248 3 rsmA Ribosomal RNA small subunit methyltransferase A Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q39W34 1.16e-50 170 37 2 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A8LI73 1.59e-50 170 39 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7G9I5 1.59e-50 170 35 4 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q38V22 2.8e-50 170 37 5 280 3 rsmA Ribosomal RNA small subunit methyltransferase A Latilactobacillus sakei subsp. sakei (strain 23K)
A7FQA9 3.09e-50 169 36 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain ATCC 19397 / Type A)
B3EQT0 3.13e-50 169 41 6 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium phaeobacteroides (strain BS1)
Q251W8 6.21e-50 168 39 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfitobacterium hafniense (strain Y51)
B8FY38 6.21e-50 168 39 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q04C60 9.19e-50 169 38 6 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBR1 9.19e-50 169 38 6 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A4WRK3 9.65e-50 168 38 7 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B1ID54 1.07e-49 168 35 4 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Okra / Type B1)
A6U7I6 1.68e-49 167 39 8 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Sinorhizobium medicae (strain WSM419)
C1FQ40 1.91e-49 167 36 3 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Kyoto / Type A2)
Q74LI0 4.85e-49 167 37 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q0S4T6 5.34e-49 166 38 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus jostii (strain RHA1)
C1CMT3 5.89e-49 166 36 8 278 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain P1031)
Q67JB9 6.31e-49 166 39 5 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q8DND3 6.84e-49 166 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04II4 6.84e-49 166 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B2IM67 7.22e-49 166 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain CGSP14)
A7IJ80 9.65e-49 166 39 7 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q03VR7 1.03e-48 166 36 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
C3KXY4 1.75e-48 164 36 3 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain 657 / Type Ba4)
A8MK56 1.97e-48 165 35 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Alkaliphilus oremlandii (strain OhILAs)
Q5LQN0 2.21e-48 164 39 8 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
C1CA29 2.88e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain 70585)
C1CTN9 3.65e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain Taiwan19F-14)
Q97NN5 3.65e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZNY9 3.65e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
C1CGR5 3.73e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain JJA)
Q5L3V8 4.08e-48 164 36 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus kaustophilus (strain HTA426)
Q5FU61 4.11e-48 164 37 4 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Gluconobacter oxydans (strain 621H)
B1KRY8 4.31e-48 164 34 4 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Loch Maree / Type A3)
B1I8T7 5.55e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain Hungary19A-6)
B5E2H6 5.55e-48 164 36 6 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 19F (strain G54)
Q3B3D4 5.63e-48 163 41 6 248 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
C0QFJ2 5.92e-48 164 37 3 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q984S7 8.12e-48 163 40 7 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q3ARC0 9.99e-48 162 37 6 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium chlorochromatii (strain CaD3)
C1AXY5 1.35e-47 163 37 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus opacus (strain B4)
P72666 1.37e-47 162 36 7 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q92QZ1 1.47e-47 162 39 8 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium meliloti (strain 1021)
B5ZWD8 2.48e-47 162 38 7 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q8FQZ5 2.7e-47 162 37 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q5PAV9 3.4e-47 161 36 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma marginale (strain St. Maries)
B9KIG4 3.4e-47 161 36 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma marginale (strain Florida)
Q837A7 3.56e-47 162 32 2 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Enterococcus faecalis (strain ATCC 700802 / V583)
Q5FMG3 4.48e-47 161 38 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8YS62 5.14e-47 160 37 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C3M9C2 5.86e-47 161 36 6 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q1MJ01 6.38e-47 160 36 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
B3PUU6 9.19e-47 160 36 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium etli (strain CIAT 652)
Q11HG9 1.06e-46 160 38 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Chelativorans sp. (strain BNC1)
Q2GK91 1.13e-46 160 34 6 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma phagocytophilum (strain HZ)
A3CQN5 1.13e-46 160 35 5 277 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus sanguinis (strain SK36)
Q65PH9 1.18e-46 160 36 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B2G5I8 1.42e-46 160 36 5 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VI09 1.42e-46 160 36 5 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Limosilactobacillus reuteri (strain DSM 20016)
C5D363 1.67e-46 160 36 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus sp. (strain WCH70)
B0CC89 1.69e-46 159 37 5 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Acaryochloris marina (strain MBIC 11017)
B1HS82 2.18e-46 160 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Lysinibacillus sphaericus (strain C3-41)
Q9CHN8 2.44e-46 159 35 4 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactococcus lactis subsp. lactis (strain IL1403)
B9KST5 2.82e-46 159 36 7 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B8D0I2 2.95e-46 159 33 5 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q5M2L6 3.03e-46 159 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q49V02 3.11e-46 159 35 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5LY12 3.16e-46 159 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain CNRZ 1066)
A8GPG7 4.5e-46 158 37 5 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia akari (strain Hartford)
Q03IR2 5.82e-46 159 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q92F79 8.21e-46 158 34 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q2KA84 9.53e-46 157 36 6 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q164G1 9.89e-46 157 38 8 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3J2B9 1.36e-45 157 36 7 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
C6BSW3 1.48e-45 157 39 6 228 3 rsmA Ribosomal RNA small subunit methyltransferase A Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C1A383 1.52e-45 158 36 4 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus erythropolis (strain PR4 / NBRC 100887)
A8AUQ4 1.54e-45 157 34 5 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q1DAP2 1.63e-45 157 35 5 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Myxococcus xanthus (strain DK1622)
Q57E58 1.9e-45 157 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus biovar 1 (strain 9-941)
P59157 2.15e-45 156 37 6 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q7NJ41 2.36e-45 156 38 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q2N8W9 2.39e-45 157 37 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Erythrobacter litoralis (strain HTCC2594)
A3PJZ3 3.15e-45 156 36 7 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A8F909 3.7e-45 156 34 2 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus pumilus (strain SAFR-032)
Q8G1N0 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella suis biovar 1 (strain 1330)
A5VPL7 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RI23 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella melitensis biotype 2 (strain ATCC 23457)
A9MA55 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YN15 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus (strain 2308)
B2S4U1 4.94e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus (strain S19)
Q8YG94 6.12e-45 155 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A8YX55 7.73e-45 155 37 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus helveticus (strain DPC 4571)
B9DVT4 1e-44 155 36 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
O05952 1.19e-44 154 37 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia prowazekii (strain Madrid E)
Q1WV73 1.21e-44 155 36 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Ligilactobacillus salivarius (strain UCC118)
Q04DR8 1.41e-44 155 36 3 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q9KGK4 1.45e-44 155 33 4 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q68W66 1.54e-44 154 37 4 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia typhi (strain ATCC VR-144 / Wilmington)
B0CL06 1.59e-44 154 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella suis (strain ATCC 23445 / NCTC 10510)
C1F127 1.77e-44 154 34 2 247 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q5WLW2 1.82e-44 155 35 5 280 3 rsmA Ribosomal RNA small subunit methyltransferase A Shouchella clausii (strain KSM-K16)
A6X265 1.84e-44 154 39 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q28RD6 1.92e-44 154 36 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Jannaschia sp. (strain CCS1)
Q215S4 2e-44 154 38 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain BisB18)
B9JUV4 2.43e-44 154 35 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A8HVI9 2.58e-44 154 39 9 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P59155 3.24e-44 154 33 6 278 3 rsmA Ribosomal RNA small subunit methyltransferase A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8P2N8 3.26e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q1JNI8 3.26e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDL6 3.26e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q9A1I0 3.4e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M1
Q5NMX2 3.47e-44 154 39 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q48VC6 3.51e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JIN6 3.51e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1J8J4 3.74e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M4 (strain MGAS10750)
B4UDZ6 3.97e-44 154 35 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter sp. (strain K)
B8J7H0 3.97e-44 154 35 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A1BFM9 4.33e-44 153 36 5 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8YAE2 4.63e-44 154 33 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A2RCH2 4.89e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5XDX4 4.89e-44 154 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q2G9Z2 5.08e-44 153 39 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A0AEZ3 6.25e-44 153 33 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A9VN54 6.37e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus mycoides (strain KBAB4)
Q6F2B4 6.52e-44 152 31 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
B8DGN7 6.73e-44 153 33 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4a (strain HCC23)
Q6HPX5 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63HJ1 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ZK / E33L)
B9IZC4 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain Q1)
B7HPV2 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain AH187)
Q73FG7 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JK47 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain AH820)
Q81W00 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis
C3LJ13 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9I6 6.94e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis (strain A0248)
Q81JA5 7.24e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HIK9 7.24e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain B4264)
B7ISV1 7.24e-44 153 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain G9842)
Q724M5 7.73e-44 153 33 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4b (strain F2365)
C1KYC1 7.73e-44 153 33 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4b (strain CLIP80459)
Q88Z93 7.93e-44 153 34 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A7GJV3 9.07e-44 153 34 4 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q72B41 1.03e-43 152 38 7 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DXR8 1.03e-43 153 35 3 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
C1ESX0 1.15e-43 152 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain 03BB102)
A0R8B4 1.15e-43 152 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus thuringiensis (strain Al Hakam)
Q8NRY1 1.31e-43 152 35 6 277 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0SQ34 1.58e-43 152 34 2 250 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain SM101 / Type A)
Q8XHG8 1.58e-43 152 34 2 250 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain 13 / Type A)
Q0TMD6 1.58e-43 152 34 2 250 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q1GT31 2.25e-43 151 37 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A4QCP0 2.57e-43 152 35 6 277 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium glutamicum (strain R)
Q8E3D7 2.65e-43 152 34 3 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype III (strain NEM316)
B9DLD0 3.01e-43 152 34 3 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus carnosus (strain TM300)
Q3M3F3 3.04e-43 151 35 6 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3JZA5 3.61e-43 151 34 3 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A5FLP4 3.78e-43 150 37 5 248 3 rsmA Ribosomal RNA small subunit methyltransferase A Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A1VD65 4.96e-43 150 38 7 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitratidesulfovibrio vulgaris (strain DP4)
A1US65 4.99e-43 150 36 4 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
C0M8P2 5.96e-43 150 35 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. equi (strain 4047)
Q8CQU5 6.3e-43 151 34 3 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRR2 6.3e-43 151 34 3 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q07LF4 6.41e-43 150 37 7 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain BisA53)
Q6AL71 7.29e-43 150 38 0 218 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfotalea psychrophila (strain LSv54 / DSM 12343)
C0MF36 7.78e-43 150 35 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. zooepidemicus (strain H70)
B4U0U9 7.78e-43 150 35 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
P0DF13 9.23e-43 150 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF12 9.23e-43 150 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q2IFT9 9.82e-43 150 35 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter dehalogenans (strain 2CP-C)
A8EZN3 9.83e-43 149 36 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia canadensis (strain McKiel)
A9IRW8 1.52e-42 149 37 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q2LSQ6 1.54e-42 149 34 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Syntrophus aciditrophicus (strain SB)
B1XIV9 1.81e-42 149 34 4 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
B7J2F3 1.96e-42 149 33 7 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Borreliella burgdorferi (strain ZS7)
O51536 1.96e-42 149 33 7 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A6L1N4 2.11e-42 149 35 4 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B2J0A6 2.51e-42 149 36 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B3Q9S4 2.6e-42 149 38 7 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain TIE-1)
Q6N5B4 2.6e-42 149 38 7 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NIA2 4.02e-42 149 36 7 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B3QMU5 4.11e-42 148 36 5 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q03HF6 4.9e-42 149 34 2 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
B7JWJ7 5.15e-42 148 36 8 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Rippkaea orientalis (strain PCC 8801 / RF-1)
Q4L3F0 5.98e-42 148 33 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus haemolyticus (strain JCSC1435)
A0QBW0 7.1e-42 149 35 6 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium avium (strain 104)
P9WH07 8.05e-42 149 36 6 267 1 ksgA Ribosomal RNA small subunit methyltransferase A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH06 8.05e-42 149 36 6 267 3 ksgA Ribosomal RNA small subunit methyltransferase A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U153 8.05e-42 149 36 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AM01 8.05e-42 149 36 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KHE8 8.05e-42 149 36 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P66661 8.05e-42 149 36 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8EU92 8.25e-42 147 33 5 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Malacoplasma penetrans (strain HF-2)
Q0SMR8 1.03e-41 147 33 7 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Borreliella afzelii (strain PKo)
A4IJB8 1.25e-41 147 36 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus thermodenitrificans (strain NG80-2)
B6JGM4 1.53e-41 147 38 7 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
P59156 1.57e-41 147 33 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6G438 1.63e-41 147 37 4 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q741W2 1.87e-41 147 35 6 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8G6I3 1.88e-41 147 34 5 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum (strain NCC 2705)
Q2S0I2 1.99e-41 147 36 3 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Salinibacter ruber (strain DSM 13855 / M31)
Q8A0H8 2.11e-41 146 36 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A8GT85 2.35e-41 147 34 6 293 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia rickettsii (strain Sheila Smith)
Q5YPY6 2.5e-41 147 34 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Nocardia farcinica (strain IFM 10152)
Q89MU0 2.84e-41 146 36 8 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8KE87 3.35e-41 145 39 4 220 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q98RJ3 3.53e-41 145 33 5 251 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycoplasmopsis pulmonis (strain UAB CTIP)
B3EIC2 3.65e-41 145 37 5 249 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q03T56 4.03e-41 146 38 5 229 3 rsmA Ribosomal RNA small subunit methyltransferase A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B7GPE3 5.32e-41 146 33 4 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
C4K2J5 5.34e-41 146 34 5 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia peacockii (strain Rustic)
Q2JVW2 5.39e-41 145 35 6 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus sp. (strain JA-3-3Ab)
Q1RK29 5.6e-41 145 35 6 263 1 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia bellii (strain RML369-C)
A8GXS7 6.3e-41 145 35 6 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia bellii (strain OSU 85-389)
P37468 7.38e-41 145 36 5 275 1 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus subtilis (strain 168)
Q4JU23 8.14e-41 146 36 7 283 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium jeikeium (strain K411)
B3DP38 9.65e-41 145 33 4 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum (strain DJO10A)
B1N079 9.93e-41 145 34 5 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Leuconostoc citreum (strain KM20)
Q64Y97 1.35e-40 144 36 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides fragilis (strain YCH46)
Q5LHC9 1.35e-40 144 36 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
C0R5G4 1.37e-40 144 35 7 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q2GGH6 2.02e-40 143 33 6 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C3PPC3 2.22e-40 144 34 5 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia africae (strain ESF-5)
Q3YS70 2.31e-40 143 33 6 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Ehrlichia canis (strain Jake)
Q4UMV1 2.52e-40 142 38 3 222 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q3A8X5 2.53e-40 144 35 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q1QKW0 3.74e-40 143 35 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q92GV0 4.63e-40 144 34 6 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q6G052 4.7e-40 143 37 6 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella quintana (strain Toulouse)
A1A3W3 5.82e-40 143 34 3 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A5EIA8 8.03e-40 142 36 9 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B9E8V8 9.93e-40 142 33 2 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Macrococcus caseolyticus (strain JCSC5402)
A9A0E0 1.07e-39 142 32 4 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A1UL32 1.33e-39 142 35 6 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium sp. (strain KMS)
A3Q5I0 1.33e-39 142 35 6 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium sp. (strain JLS)
Q135P2 1.42e-39 142 37 9 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain BisB5)
Q6ME80 1.85e-39 141 35 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Protochlamydia amoebophila (strain UWE25)
Q30ZP0 1.97e-39 141 36 8 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B1WRJ7 2.06e-39 141 32 4 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2IX80 2.26e-39 141 37 8 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain HaA2)
A4T6P3 3.09e-39 142 33 7 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycolicibacterium gilvum (strain PYR-GCK)
Q5N2S8 3.45e-39 140 35 5 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RH6 3.45e-39 140 35 5 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A1TEH3 4.36e-39 141 34 7 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A4YT90 4.96e-39 140 36 9 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Bradyrhizobium sp. (strain ORS 278)
Q1IZ94 4.98e-39 140 36 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q1B416 5.77e-39 140 34 6 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium sp. (strain MCS)
Q1ILA1 5.92e-39 140 32 2 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Koribacter versatilis (strain Ellin345)
B7GFH0 6.16e-39 140 34 5 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q73IR3 9.39e-39 140 36 7 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia pipientis wMel
Q3SRZ8 1.24e-38 139 36 8 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A6GVR5 1.37e-38 139 34 5 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q11UL8 1.61e-38 138 35 7 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q660T2 2.36e-38 139 31 6 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11545
Feature type CDS
Gene rsmA
Product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA
Location 2547238 - 2548056 (strand: 1)
Length 819 (nucleotides) / 272 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1164
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00398 Ribosomal RNA adenine dimethylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0030 Translation, ribosomal structure and biogenesis (J) J 16S rRNA A1518 and A1519 N6-dimethyltransferase RsmA/KsgA/DIM1 (may also have DNA glycosylase/AP lyase activity)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02528 16S rRNA (adenine1518-N6/adenine1519-N6)-dimethyltransferase [EC:2.1.1.182] - -

Protein Sequence

MNNRVHQGHFARKRFGQNFLTDSYIIESIVESIYPQPGEAVIEIGPGLGALTEPVGERMDKMTVVEIDRDLAARLEVHPTLKDKLTIIQQDAMTIDFAQLAKERQQPLRVFGNLPYNISTPLMFHLFSFADAISDMTFMLQKEVVNRLVASHGSKTYGRLSVMAQYHCQVIPIIEVPPSSFKPAPKVDSAVVRLIPYKEKPYPVTDIAMLSRITSQAFNQRRKTLRNSLGGLLTAEDMLALDIDPTARAENISVEQYCKVANWLSSQQQHAE

Flanking regions ( +/- flanking 50bp)

CAGTTTTCGCACCGCATTAAATTTAGCCATTAATATGATACAAAATTGTAATGAATAATAGAGTCCATCAGGGGCACTTTGCCCGCAAACGCTTCGGGCAGAACTTTTTAACAGACAGCTATATTATTGAAAGTATTGTTGAATCTATTTATCCACAACCCGGTGAAGCCGTTATTGAAATCGGTCCTGGTTTAGGCGCGCTTACTGAGCCGGTGGGGGAAAGAATGGATAAAATGACGGTCGTCGAAATTGACCGTGATTTAGCTGCACGCTTAGAAGTTCACCCTACATTAAAAGATAAGCTAACCATTATTCAGCAAGATGCGATGACGATTGATTTTGCCCAATTAGCAAAAGAGCGTCAGCAACCTCTGCGGGTTTTTGGTAACCTACCTTATAATATTTCAACGCCATTAATGTTCCATCTATTTAGTTTTGCTGATGCCATTTCTGACATGACTTTTATGTTGCAAAAAGAGGTGGTTAATCGCCTAGTGGCAAGTCATGGTAGTAAAACTTATGGCCGCTTAAGTGTCATGGCACAATACCACTGCCAAGTCATTCCTATTATTGAAGTGCCACCAAGCTCATTTAAGCCAGCCCCGAAAGTAGATTCTGCCGTTGTGCGTCTGATCCCTTATAAGGAAAAACCCTATCCGGTGACAGATATTGCTATGTTAAGCCGTATCACATCACAAGCCTTTAATCAGCGCCGTAAAACGTTACGTAATAGCTTAGGTGGACTACTTACAGCAGAAGATATGCTGGCATTAGATATTGATCCCACTGCACGCGCAGAAAATATTTCTGTTGAGCAATACTGTAAAGTGGCAAACTGGTTATCATCACAACAGCAACACGCTGAGTGAAATAGCGCACACTAGACCTAGGAGGTATTATGTTTACTTCATCCAAAGTG