Homologs in group_1164

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06265 FBDBKF_06265 100.0 Morganella morganii S1 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
EHELCC_09310 EHELCC_09310 100.0 Morganella morganii S2 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
NLDBIP_09690 NLDBIP_09690 100.0 Morganella morganii S4 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
HKOGLL_07615 HKOGLL_07615 100.0 Morganella morganii S5 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
F4V73_RS15655 F4V73_RS15655 92.2 Morganella psychrotolerans rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA
PMI_RS11545 PMI_RS11545 74.4 Proteus mirabilis HI4320 rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA

Distribution of the homologs in the orthogroup group_1164

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1164

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8V7 4.15e-168 468 80 0 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D0E0 1.69e-162 454 76 0 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57TH0 1.55e-161 452 79 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella choleraesuis (strain SC-B67)
A7MIA7 2.08e-161 451 78 0 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Cronobacter sakazakii (strain ATCC BAA-894)
C6DEY6 4.57e-161 451 75 0 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8ALP9 7.93e-161 450 78 0 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6T4I7 9.04e-161 450 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B4TWT6 1.53e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella schwarzengrund (strain CVM19633)
Q56016 1.69e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z9J7 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella typhi
B5BL27 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi A (strain AKU_12601)
C0Q5E7 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi C (strain RKS4594)
A9MYM4 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PDD9 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TJ47 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella heidelberg (strain SL476)
B5RGC2 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R1S8 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella enteritidis PT4 (strain P125109)
B5FI34 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella dublin (strain CT_02021853)
B5F771 1.71e-160 449 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella agona (strain SL483)
A9MQG2 4.58e-160 448 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8G9P0 4.77e-160 448 77 0 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Serratia proteamaculans (strain 568)
B5Y1Z4 6.09e-160 447 77 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Klebsiella pneumoniae (strain 342)
B4T6L6 2.79e-159 446 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Salmonella newport (strain SL254)
B7LVU5 3.26e-159 446 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7N7S6 4.89e-159 446 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A7ZHE4 5.39e-159 445 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O139:H28 (strain E24377A / ETEC)
B7L4H4 1.34e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain 55989 / EAEC)
B6HZ32 1.92e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain SE11)
Q3Z5V8 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella sonnei (strain Ss046)
Q0T8E4 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella flexneri serotype 5b (strain 8401)
Q326I2 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella boydii serotype 4 (strain Sb227)
B1LFY7 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain SMS-3-5 / SECEC)
P06992 2.32e-158 444 78 0 267 1 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12)
B1IRC5 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZW03 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O9:H4 (strain HS)
B1XC52 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12 / DH10B)
C4ZPX7 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0E8 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O8 (strain IAI1)
B7NHF7 2.32e-158 444 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q83MG8 3.4e-158 443 77 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella flexneri
B5YZ89 4.38e-158 443 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA14 4.38e-158 443 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O157:H7
B7MNR0 4.78e-158 443 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O81 (strain ED1a)
A4TQD8 6.26e-158 442 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis (strain Pestoides F)
Q1CMT2 6.26e-158 442 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZZ0 6.26e-158 442 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIK5 6.26e-158 442 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis
Q1C0H5 6.26e-158 442 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pestis bv. Antiqua (strain Antiqua)
B2U259 6.64e-158 442 77 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RGE6 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli (strain UTI89 / UPEC)
Q8FL96 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TLT6 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7A0 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O1:K1 / APEC
B7MAH6 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UI99 7.49e-158 442 78 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32K43 1.78e-157 441 77 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Shigella dysenteriae serotype 1 (strain Sd197)
B1JKY3 2.84e-157 441 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EQ8 2.84e-157 441 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K487 2.84e-157 441 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FMC1 2.84e-157 441 78 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4W6F7 3.18e-156 438 75 0 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Enterobacter sp. (strain 638)
B4F2I2 4.17e-156 438 75 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Proteus mirabilis (strain HI4320)
A1JJF4 1.52e-155 437 77 0 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2VGP6 1.15e-152 429 73 0 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NVX6 3.76e-152 428 74 0 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Sodalis glossinidius (strain morsitans)
Q4QMZ9 1.86e-132 379 65 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain 86-028NP)
P44749 3.35e-132 378 65 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UH57 3.54e-132 378 65 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain PittGG)
A5U9U3 3.54e-132 378 65 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus influenzae (strain PittEE)
Q65UX3 7.44e-131 375 65 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0KGT8 1.28e-130 374 66 0 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B0BTQ4 2.73e-129 371 65 1 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B0URM7 5.41e-129 370 64 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Histophilus somni (strain 2336)
Q0I5C3 5.41e-129 370 64 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Histophilus somni (strain 129Pt)
B3H0R3 5.87e-129 370 64 1 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZB7 6.92e-129 370 64 1 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q9CLL5 2.91e-127 365 63 1 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Pasteurella multocida (strain Pm70)
A7MWC6 2.95e-126 362 65 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio campbellii (strain ATCC BAA-1116)
Q87ST6 3.55e-126 362 65 1 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1STS1 1.52e-124 358 65 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B6EL48 1.52e-123 356 63 2 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio salmonicida (strain LFI1238)
Q7VM33 3.09e-123 355 61 1 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Haemophilus ducreyi (strain 35000HP / ATCC 700724)
C4K4K9 1.23e-122 353 62 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q7MP86 1.32e-121 350 63 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio vulnificus (strain YJ016)
Q8DED2 1.32e-121 350 63 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio vulnificus (strain CMCP6)
Q9KUS2 1.75e-121 350 64 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F8N2 1.75e-121 350 64 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FGG5 2.16e-121 350 63 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio fischeri (strain MJ11)
Q5E865 2.16e-121 350 63 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7VIE2 2.55e-120 347 63 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Vibrio atlanticus (strain LGP32)
A3QBA3 1.22e-117 340 60 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q6LV41 2.55e-116 337 63 1 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Photobacterium profundum (strain SS9)
Q07YJ8 6.79e-116 336 62 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella frigidimarina (strain NCIMB 400)
B1KGH9 8.08e-116 336 60 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella woodyi (strain ATCC 51908 / MS32)
B0TV52 2.27e-114 332 60 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella halifaxensis (strain HAW-EB4)
A1S9G5 2.42e-114 332 62 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q5QVN7 3.96e-114 332 59 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q0HS06 8.92e-114 331 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain MR-7)
A8H0V2 9.83e-114 330 60 1 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A0L064 1.02e-113 330 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain ANA-3)
C4L9L4 1.56e-113 330 59 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q3IFD1 1.96e-113 330 58 1 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudoalteromonas translucida (strain TAC 125)
A8FRV2 3.49e-113 329 59 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sediminis (strain HAW-EB3)
A3D188 8.67e-113 328 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EB35 8.67e-113 328 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS223)
Q12K59 8.75e-113 328 60 1 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0HLT2 9.36e-113 328 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain MR-4)
Q8EB93 1.36e-112 328 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A1RMU8 1.8e-112 327 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella sp. (strain W3-18-1)
A4Y435 1.8e-112 327 60 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A9L438 1.97e-112 327 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS195)
A6WK59 1.97e-112 327 59 1 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella baltica (strain OS185)
B8CSX5 4.68e-112 326 60 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Shewanella piezotolerans (strain WP3 / JCM 13877)
Q47VJ8 1.06e-111 327 57 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q1LSS2 1.43e-109 320 59 0 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Baumannia cicadellinicola subsp. Homalodisca coagulata
Q6F8A0 1.18e-95 285 53 1 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8KA00 6.94e-95 283 49 1 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q2S9C3 4.19e-93 278 53 1 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Hahella chejuensis (strain KCTC 2396)
A1U6F8 6.78e-92 275 52 1 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q493R7 8.98e-92 275 49 2 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Blochmanniella pennsylvanica (strain BPEN)
Q5P7J1 2.45e-91 274 53 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
C1D9C2 4.86e-91 273 52 2 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Laribacter hongkongensis (strain HLHK9)
B1Y7L9 1.58e-90 272 51 4 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q39D37 6.06e-90 270 53 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B4EBE8 8.22e-90 270 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q1BTQ8 5.66e-89 268 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia orbicola (strain AU 1054)
B1JY71 5.66e-89 268 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia orbicola (strain MC0-3)
A0KAD1 5.66e-89 268 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia cenocepacia (strain HI2424)
Q5WSM3 6.3e-89 267 51 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Lens)
Q1GZB8 1.29e-88 266 53 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q479U6 1.64e-88 266 51 2 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Dechloromonas aromatica (strain RCB)
P57241 2.24e-88 266 47 1 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B1YWD5 2.29e-88 266 53 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia ambifaria (strain MC40-6)
Q1LRA1 4.12e-88 266 51 4 278 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0BC07 5.53e-88 265 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A9AFE4 7.42e-88 265 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia multivorans (strain ATCC 17616 / 249)
Q223E6 1.25e-87 264 52 5 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q5ZRF4 1.46e-87 264 50 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
C5CS95 2.18e-87 263 52 4 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Variovorax paradoxus (strain S110)
Q7VQK3 2.63e-87 263 47 2 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Blochmanniella floridana
Q1QZ31 2.71e-87 264 52 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A5IIC0 3.3e-87 263 50 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Corby)
Q5X0V1 3.3e-87 263 50 1 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Legionella pneumophila (strain Paris)
A3N5X6 1.21e-86 262 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 668)
A3NRM0 1.21e-86 262 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 1106a)
Q21MT0 1.24e-86 262 52 1 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B2AH89 3.44e-86 261 50 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q7P1U1 7.39e-86 259 50 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0KEA7 1.51e-85 259 49 4 277 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q63X76 2.45e-85 259 50 3 274 1 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain K96243)
Q3JVW6 2.45e-85 259 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia pseudomallei (strain 1710b)
A1V727 2.45e-85 259 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain SAVP1)
Q62MM2 2.45e-85 259 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain ATCC 23344)
A2S8N7 2.45e-85 259 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain NCTC 10229)
A3MNW4 2.45e-85 259 50 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia mallei (strain NCTC 10247)
B0RUI3 2.48e-85 258 50 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain B100)
A6VU53 2.5e-85 258 51 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Marinomonas sp. (strain MWYL1)
A4JHP7 2.94e-85 258 52 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q8PCE3 2.95e-85 258 50 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UR39 2.95e-85 258 50 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas campestris pv. campestris (strain 8004)
Q8Y219 9.84e-85 257 52 5 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9JVC2 1.06e-84 256 49 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9I5U5 1.63e-84 256 50 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1KSW0 1.9e-84 256 49 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q9K0B7 2.05e-84 256 49 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B4RJV5 7.35e-84 254 48 2 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria gonorrhoeae (strain NCCP11945)
Q5F9W4 1.08e-83 254 48 2 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A9M352 1.61e-83 253 49 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Neisseria meningitidis serogroup C (strain 053442)
Q3K5T2 1.95e-83 254 49 1 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas fluorescens (strain Pf0-1)
Q2T114 3.92e-83 253 50 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3JAF3 4.39e-83 253 51 4 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
A4G256 4.95e-83 252 52 3 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Herminiimonas arsenicoxydans
P59524 6.15e-83 252 46 1 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B2JCX3 6.68e-83 253 51 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q475Q1 9.66e-83 252 48 3 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q4K4X5 2.95e-82 251 49 1 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1WD86 6.21e-82 249 49 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidovorax sp. (strain JS42)
Q0VMV2 8.33e-82 250 50 2 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q3BX82 9.69e-82 249 50 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
B9MIF6 1.12e-81 249 49 5 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidovorax ebreus (strain TPSY)
Q8PP25 1.3e-81 249 49 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas axonopodis pv. citri (strain 306)
Q3SGF7 1.44e-81 248 52 2 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Thiobacillus denitrificans (strain ATCC 25259)
Q88A46 2.33e-81 248 48 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1WS95 5.64e-81 248 51 5 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Verminephrobacter eiseniae (strain EF01-2)
Q88QT6 5.96e-81 247 48 4 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87C85 6.87e-81 247 48 0 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A1VUN7 8.2e-81 247 49 5 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Polaromonas naphthalenivorans (strain CJ2)
A6SV13 1.15e-80 246 50 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Janthinobacterium sp. (strain Marseille)
Q48NT7 1.85e-80 246 48 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5GWB9 2.8e-80 245 49 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SPT3 2.8e-80 245 49 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZI4 2.8e-80 245 49 1 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A1WVT7 5.15e-80 245 49 2 249 3 rsmA Ribosomal RNA small subunit methyltransferase A Halorhodospira halophila (strain DSM 244 / SL1)
Q4ZMG5 1.48e-79 244 47 1 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Pseudomonas syringae pv. syringae (strain B728a)
Q9PBJ6 1.78e-79 243 48 0 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Xylella fastidiosa (strain 9a5c)
A9I5F2 2.7e-79 243 49 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q2YBP5 1.74e-78 241 47 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1TWF5 2.03e-78 240 48 4 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Paracidovorax citrulli (strain AAC00-1)
Q7WG20 4.67e-78 240 49 2 251 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B2SX63 7e-78 240 48 4 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q7W4J6 8.69e-78 239 49 2 251 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q83AC2 9.52e-78 239 47 1 253 1 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B6J3A6 9.52e-78 239 47 1 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain CbuG_Q212)
Q145L1 1.3e-77 239 48 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Paraburkholderia xenovorans (strain LB400)
B6J641 2.45e-77 238 47 1 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain CbuK_Q154)
A9N9I7 3.88e-77 237 47 1 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain RSA 331 / Henzerling II)
Q2KXA2 5.08e-77 237 47 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella avium (strain 197N)
Q31F24 5.58e-77 237 47 1 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7VU11 7.49e-77 237 49 2 251 3 rsmA Ribosomal RNA small subunit methyltransferase A Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
A9KGZ8 1.51e-76 236 47 1 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Coxiella burnetii (strain Dugway 5J108-111)
Q60B77 1.82e-76 236 50 2 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q4FT44 3.35e-76 236 48 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1QAR8 1.04e-75 234 48 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A2SC77 1.33e-74 231 51 3 249 3 rsmA Ribosomal RNA small subunit methyltransferase A Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A5EY68 3.71e-73 227 45 2 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Dichelobacter nodosus (strain VCS1703A)
Q82W15 5.04e-71 222 46 3 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B5EL84 3.01e-69 218 48 3 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J3R3 3.26e-69 217 48 3 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q121Q5 5.82e-69 219 42 6 310 3 rsmA Ribosomal RNA small subunit methyltransferase A Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q0AGQ8 5.62e-65 206 45 5 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q9RED9 7.28e-65 207 44 3 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Burkholderia sp.
A0LA32 4.43e-64 204 45 2 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8D3I1 5.18e-63 201 42 0 250 3 rsmA Ribosomal RNA small subunit methyltransferase A Wigglesworthia glossinidia brevipalpis
A4IZF1 2.85e-61 197 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BKP7 2.85e-61 197 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain OSU18)
B2SDQ1 2.85e-61 197 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. mediasiatica (strain FSC147)
Q2A218 2.85e-61 197 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain LVS)
A7NDV3 2.85e-61 197 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A0Q5E0 3.9e-61 196 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. novicida (strain U112)
B0TZ54 4.76e-60 194 39 3 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q3A3G8 5.05e-60 194 42 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5NHI5 7.26e-60 193 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14IY7 7.26e-60 193 40 3 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Francisella tularensis subsp. tularensis (strain FSC 198)
A9KL97 1.62e-54 181 36 4 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q2RME8 4.91e-54 179 40 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B8D0I2 2.23e-53 178 35 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B4RBS4 2.11e-52 175 38 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Phenylobacterium zucineum (strain HLK1)
A8MK56 3.02e-52 174 36 3 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Alkaliphilus oremlandii (strain OhILAs)
Q3ARC0 1.94e-51 172 37 4 246 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium chlorochromatii (strain CaD3)
Q9A7N5 5.05e-51 171 40 3 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5L3V8 6.51e-51 171 38 3 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus kaustophilus (strain HTA426)
Q97EX0 9.54e-51 170 37 7 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A6TJK9 1.49e-50 170 35 2 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Alkaliphilus metalliredigens (strain QYMF)
Q2KA84 3.34e-50 169 39 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q74C12 4.95e-50 169 38 3 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3B3D4 7.56e-50 168 38 6 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q8UGD5 1.47e-49 167 39 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2RXA9 3.88e-49 167 41 6 255 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
A7GJV3 4.76e-49 166 38 7 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q39W34 5.97e-49 166 36 3 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2W0V3 5.99e-49 166 41 5 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
A7G9I5 6.72e-49 166 34 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B5ZWD8 7.9e-49 166 39 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A9VN54 9.87e-49 166 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus mycoides (strain KBAB4)
Q67JB9 1e-48 166 39 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B4S787 1.1e-48 164 37 8 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Prosthecochloris aestuarii (strain DSM 271 / SK 413)
Q68W66 1.31e-48 164 39 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A7FQA9 1.54e-48 165 34 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain ATCC 19397 / Type A)
Q65PH9 1.65e-48 165 35 2 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q6HPX5 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63HJ1 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ZK / E33L)
B9IZC4 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain Q1)
B7HPV2 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain AH187)
Q73FG7 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ATCC 10987 / NRS 248)
B7JK47 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain AH820)
Q81W00 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis
C3LJ13 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P9I6 2.59e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus anthracis (strain A0248)
Q181C1 2.78e-48 164 34 4 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridioides difficile (strain 630)
Q81JA5 2.98e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HIK9 2.98e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain B4264)
B7ISV1 2.98e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain G9842)
B1XIV9 3.12e-48 164 35 5 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
O05952 3.27e-48 164 38 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia prowazekii (strain Madrid E)
B3EQT0 3.7e-48 163 38 5 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium phaeobacteroides (strain BS1)
C1ESX0 4.44e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus cereus (strain 03BB102)
A0R8B4 4.44e-48 164 38 7 279 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus thuringiensis (strain Al Hakam)
B1ID54 5.89e-48 163 33 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Okra / Type B1)
C1F127 6.03e-48 163 36 3 246 3 rsmA Ribosomal RNA small subunit methyltransferase A Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B3PUU6 6.63e-48 163 38 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium etli (strain CIAT 652)
Q1MJ01 6.7e-48 163 38 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q38V22 6.91e-48 164 36 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Latilactobacillus sakei subsp. sakei (strain 23K)
A8GPG7 7.22e-48 163 39 5 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia akari (strain Hartford)
B1KRY8 7.23e-48 163 34 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Loch Maree / Type A3)
B2IM67 8.54e-48 163 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain CGSP14)
Q11HG9 9.25e-48 162 38 8 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Chelativorans sp. (strain BNC1)
Q5FU61 9.7e-48 163 37 5 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Gluconobacter oxydans (strain 621H)
Q8DND3 1.01e-47 163 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04II4 1.01e-47 163 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q251W8 1.09e-47 162 39 6 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfitobacterium hafniense (strain Y51)
B8FY38 1.09e-47 162 39 6 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C1FQ40 1.15e-47 162 34 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain Kyoto / Type A2)
A8LI73 2.25e-47 162 39 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
C5D363 2.46e-47 162 38 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus sp. (strain WCH70)
C3KXY4 2.62e-47 161 34 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium botulinum (strain 657 / Type Ba4)
Q837A7 3.01e-47 162 35 6 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Enterococcus faecalis (strain ATCC 700802 / V583)
A6U7I6 3.16e-47 161 38 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Sinorhizobium medicae (strain WSM419)
C1CTN9 3.75e-47 161 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain Taiwan19F-14)
Q97NN5 3.75e-47 161 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZNY9 3.75e-47 161 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
Q9KGK4 3.82e-47 161 36 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C1CA29 4.13e-47 161 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain 70585)
P59157 5.09e-47 160 37 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
C1CGR5 6.02e-47 161 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain JJA)
Q0SQ34 6.39e-47 161 34 2 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain SM101 / Type A)
Q8XHG8 6.39e-47 161 34 2 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain 13 / Type A)
Q0TMD6 6.39e-47 161 34 2 260 3 rsmA Ribosomal RNA small subunit methyltransferase A Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P59155 1.29e-46 160 32 3 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1I8T7 1.68e-46 160 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain Hungary19A-6)
B5E2H6 1.68e-46 160 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae serotype 19F (strain G54)
C0QFJ2 2.71e-46 159 38 4 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q1WV73 2.87e-46 159 35 3 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Ligilactobacillus salivarius (strain UCC118)
A8HVI9 3.32e-46 159 40 10 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2LSQ6 3.36e-46 159 34 2 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Syntrophus aciditrophicus (strain SB)
A1B0G4 3.7e-46 159 39 7 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Paracoccus denitrificans (strain Pd 1222)
B9DLD0 3.83e-46 159 36 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus carnosus (strain TM300)
Q57E58 4.34e-46 158 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus biovar 1 (strain 9-941)
Q92QZ1 5.1e-46 158 38 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhizobium meliloti (strain 1021)
C1CMT3 5.84e-46 158 34 2 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pneumoniae (strain P1031)
Q03IR2 6.16e-46 158 34 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M2L6 6.43e-46 158 34 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LY12 6.57e-46 158 34 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus thermophilus (strain CNRZ 1066)
Q88Z93 6.61e-46 159 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q04C60 6.9e-46 158 36 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GBR1 6.9e-46 158 36 5 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P72666 8.25e-46 158 35 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1GI39 1.09e-45 157 39 8 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Ruegeria sp. (strain TM1040)
A4IJB8 1.21e-45 158 36 2 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Geobacillus thermodenitrificans (strain NG80-2)
Q8G1N0 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella suis biovar 1 (strain 1330)
A5VPL7 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
C0RI23 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella melitensis biotype 2 (strain ATCC 23457)
A9MA55 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q2YN15 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus (strain 2308)
B2S4U1 1.35e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella abortus (strain S19)
B0CL06 1.63e-45 157 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella suis (strain ATCC 23445 / NCTC 10510)
Q03T56 1.69e-45 157 37 6 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
B0CC89 1.92e-45 156 37 8 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Acaryochloris marina (strain MBIC 11017)
C3M9C2 2.26e-45 157 36 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q984S7 2.48e-45 156 39 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q9CHN8 2.99e-45 157 33 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactococcus lactis subsp. lactis (strain IL1403)
A4WRK3 3.09e-45 156 37 8 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q03VR7 3.81e-45 156 34 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A8EZN3 4.27e-45 155 37 6 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia canadensis (strain McKiel)
Q8DXR8 4.61e-45 156 35 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
A1BFM9 5.67e-45 155 36 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q8FQZ5 6.54e-45 155 36 6 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q04DR8 7.14e-45 155 34 3 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q5WLW2 7.42e-45 155 35 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Shouchella clausii (strain KSM-K16)
Q74LI0 1.24e-44 155 34 4 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8E3D7 1.63e-44 155 35 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype III (strain NEM316)
Q3JZA5 1.65e-44 155 35 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q49V02 1.96e-44 155 36 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A6X265 2.39e-44 154 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q5FMG3 2.41e-44 154 36 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A3CQN5 2.47e-44 154 34 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus sanguinis (strain SK36)
C6BSW3 2.98e-44 153 36 9 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C4K2J5 3.72e-44 154 35 5 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia peacockii (strain Rustic)
Q6F2B4 3.91e-44 153 32 4 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
A8GT85 3.97e-44 154 35 6 293 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia rickettsii (strain Sheila Smith)
Q5PAV9 4.19e-44 153 36 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma marginale (strain St. Maries)
B9KIG4 4.19e-44 153 36 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma marginale (strain Florida)
Q0S4T6 4.42e-44 154 37 5 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus jostii (strain RHA1)
Q1GT31 5.05e-44 153 38 8 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A8AUQ4 5.29e-44 153 36 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8YG94 5.89e-44 153 38 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C1AXY5 6.36e-44 153 36 6 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus opacus (strain B4)
Q8KE87 8.81e-44 152 36 6 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B8DGN7 9.93e-44 153 32 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4a (strain HCC23)
Q4UMV1 1.05e-43 151 39 3 221 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A1VD65 1.1e-43 152 35 6 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitratidesulfovibrio vulgaris (strain DP4)
Q92F79 1.27e-43 152 32 2 276 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B9KST5 1.27e-43 152 37 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B1HS82 1.4e-43 152 35 3 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Lysinibacillus sphaericus (strain C3-41)
A7IJ80 1.53e-43 152 37 9 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A2RCH2 1.64e-43 152 35 6 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M5 (strain Manfredo)
Q5XDX4 1.64e-43 152 35 6 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
B4UDZ6 1.67e-43 152 35 5 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter sp. (strain K)
B8J7H0 1.67e-43 152 35 5 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
A8F909 1.75e-43 152 35 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus pumilus (strain SAFR-032)
C3PPC3 1.95e-43 152 35 6 288 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia africae (strain ESF-5)
A0AEZ3 2.19e-43 152 32 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8P2N8 2.34e-43 152 35 6 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M18 (strain MGAS8232)
B6JGM4 2.49e-43 151 40 8 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q4L3F0 2.5e-43 152 35 4 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus haemolyticus (strain JCSC1435)
A1US65 2.55e-43 151 37 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q03HF6 2.62e-43 152 34 2 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q724M5 2.71e-43 152 32 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4b (strain F2365)
C1KYC1 2.71e-43 152 32 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serotype 4b (strain CLIP80459)
Q72B41 2.83e-43 151 35 6 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1RK29 3.21e-43 150 36 6 265 1 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia bellii (strain RML369-C)
Q8YS62 3.22e-43 151 36 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q48VC6 3.74e-43 151 35 6 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JIN6 3.74e-43 151 35 6 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M2 (strain MGAS10270)
A8GXS7 3.81e-43 150 36 6 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia bellii (strain OSU 85-389)
Q8YAE2 4.02e-43 151 32 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2N8W9 4.09e-43 151 37 7 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Erythrobacter litoralis (strain HTCC2594)
C0MF36 4.68e-43 151 34 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. zooepidemicus (strain H70)
B4U0U9 4.68e-43 151 34 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B9DVT4 4.83e-43 151 34 3 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q92GV0 4.93e-43 151 35 5 285 3 rsmA Ribosomal RNA small subunit methyltransferase A Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3J2B9 5.22e-43 150 38 8 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A9IRW8 5.34e-43 150 37 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q8CQU5 5.87e-43 151 35 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRR2 5.87e-43 151 35 3 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C0M8P2 6.05e-43 150 34 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus equi subsp. equi (strain 4047)
Q9A1I0 7.25e-43 150 34 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M1
P37468 7.55e-43 150 35 5 271 1 rsmA Ribosomal RNA small subunit methyltransferase A Bacillus subtilis (strain 168)
B7GFH0 1.05e-42 150 36 4 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q1JNI8 1.09e-42 150 34 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDL6 1.09e-42 150 34 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q2IFT9 1.16e-42 150 35 5 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaeromyxobacter dehalogenans (strain 2CP-C)
A3PJZ3 1.47e-42 149 37 8 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q5LQN0 1.76e-42 149 38 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P59156 1.88e-42 149 33 4 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q6G438 2.17e-42 149 36 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q8NRY1 2.59e-42 149 35 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q2GK91 2.77e-42 148 33 4 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Anaplasma phagocytophilum (strain HZ)
Q3A8X5 2.8e-42 149 37 4 252 3 rsmA Ribosomal RNA small subunit methyltransferase A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q6G052 3.55e-42 148 36 4 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Bartonella quintana (strain Toulouse)
Q1J8J4 4.39e-42 149 33 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M4 (strain MGAS10750)
C0R5G4 5.01e-42 148 36 7 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia sp. subsp. Drosophila simulans (strain wRi)
Q2S0I2 5.34e-42 148 34 3 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Salinibacter ruber (strain DSM 13855 / M31)
A8YX55 7.54e-42 148 34 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Lactobacillus helveticus (strain DPC 4571)
A4QCP0 9.71e-42 147 35 5 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium glutamicum (strain R)
C1A383 1.01e-41 148 36 5 262 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B3QMU5 1.41e-41 147 36 5 236 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
P0DF13 1.78e-41 147 33 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF12 1.78e-41 147 33 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B7JWJ7 1.93e-41 146 33 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rippkaea orientalis (strain PCC 8801 / RF-1)
B2J0A6 2.15e-41 146 35 8 278 3 rsmA Ribosomal RNA small subunit methyltransferase A Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q5NMX2 2.2e-41 146 36 7 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1DAP2 2.9e-41 146 35 5 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Myxococcus xanthus (strain DK1622)
Q215S4 4.54e-41 145 37 9 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain BisB18)
A2C1Z5 4.93e-41 145 35 7 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Prochlorococcus marinus (strain NATL1A)
B2G5I8 4.97e-41 146 33 4 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VI09 4.97e-41 146 33 4 275 3 rsmA Ribosomal RNA small subunit methyltransferase A Limosilactobacillus reuteri (strain DSM 20016)
Q3M3F3 6.29e-41 145 35 6 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q6AL71 9.17e-41 145 39 2 220 3 rsmA Ribosomal RNA small subunit methyltransferase A Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B1N079 1.11e-40 145 34 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Leuconostoc citreum (strain KM20)
B3Q9S4 1.14e-40 145 41 9 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain TIE-1)
Q6N5B4 1.14e-40 145 41 9 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q46L58 1.34e-40 144 34 6 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Prochlorococcus marinus (strain NATL2A)
Q7NJ41 1.45e-40 144 35 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q89MU0 1.71e-40 144 37 9 269 3 rsmA Ribosomal RNA small subunit methyltransferase A Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5N2S8 1.81e-40 144 35 4 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31RH6 1.81e-40 144 35 4 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B9E8V8 1.86e-40 144 33 4 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Macrococcus caseolyticus (strain JCSC5402)
B3EIC2 2.01e-40 143 36 4 235 3 rsmA Ribosomal RNA small subunit methyltransferase A Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q8G6I3 3.37e-40 144 33 5 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum (strain NCC 2705)
Q164G1 3.71e-40 143 36 7 263 3 rsmA Ribosomal RNA small subunit methyltransferase A Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q4FMR0 4.05e-40 142 35 8 248 3 rsmA Ribosomal RNA small subunit methyltransferase A Pelagibacter ubique (strain HTCC1062)
Q2JVW2 4.68e-40 143 32 5 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Synechococcus sp. (strain JA-3-3Ab)
Q07LF4 4.71e-40 143 38 9 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Rhodopseudomonas palustris (strain BisA53)
B1WRJ7 5.77e-40 142 31 5 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Crocosphaera subtropica (strain ATCC 51142 / BH68)
A6L1N4 5.93e-40 142 34 6 254 3 rsmA Ribosomal RNA small subunit methyltransferase A Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
B9JUV4 6.21e-40 142 34 7 267 3 rsmA Ribosomal RNA small subunit methyltransferase A Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q8EU92 7.59e-40 142 32 5 256 3 rsmA Ribosomal RNA small subunit methyltransferase A Malacoplasma penetrans (strain HF-2)
B3DP38 7.79e-40 143 33 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum (strain DJO10A)
Q8RDC8 9.35e-40 142 34 4 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B7GPE3 9.53e-40 143 33 4 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
B3CPY6 1.07e-39 141 35 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia pipientis subsp. Culex pipiens (strain wPip)
A5D673 1.46e-39 142 37 2 272 3 rsmA Ribosomal RNA small subunit methyltransferase A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q0AQC3 1.53e-39 142 37 7 264 3 rsmA Ribosomal RNA small subunit methyltransferase A Maricaulis maris (strain MCS10)
Q73IR3 1.61e-39 142 35 7 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia pipientis wMel
Q98RJ3 1.82e-39 140 33 7 249 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycoplasmopsis pulmonis (strain UAB CTIP)
Q2GGH6 2.13e-39 140 34 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q8A0H8 5.47e-39 140 34 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q64Y97 1.57e-38 139 34 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides fragilis (strain YCH46)
Q5LHC9 1.57e-38 139 34 6 257 3 rsmA Ribosomal RNA small subunit methyltransferase A Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q30ZP0 2.39e-38 138 35 8 274 3 rsmA Ribosomal RNA small subunit methyltransferase A Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A0QBW0 2.6e-38 139 34 6 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycobacterium avium (strain 104)
Q28RD6 2.79e-38 139 33 7 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Jannaschia sp. (strain CCS1)
Q1QKW0 5.65e-38 137 36 9 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
B2V963 7.04e-38 137 34 6 253 3 rsmA Ribosomal RNA small subunit methyltransferase A Sulfurihydrogenibium sp. (strain YO3AOP1)
Q2G9Z2 7.06e-38 137 35 5 266 3 rsmA Ribosomal RNA small subunit methyltransferase A Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q4JU23 1.08e-37 137 34 7 282 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium jeikeium (strain K411)
B7J2F3 1.39e-37 136 31 7 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Borreliella burgdorferi (strain ZS7)
O51536 1.39e-37 136 31 7 258 3 rsmA Ribosomal RNA small subunit methyltransferase A Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q5GSM9 1.41e-37 136 34 7 261 3 rsmA Ribosomal RNA small subunit methyltransferase A Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q741W2 1.48e-37 137 34 6 270 3 rsmA Ribosomal RNA small subunit methyltransferase A Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P66663 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain MW2)
A8Z0Y8 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBZ5 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain MSSA476)
P66662 1.62e-37 137 32 2 273 1 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain N315)
Q932G1 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HII3 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain COL)
A5IQ45 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain JH9)
Q2G0T0 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJE9 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain USA300)
A6TYW7 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain JH1)
A7WYP0 1.62e-37 137 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q7V7W0 1.67e-37 136 34 7 271 3 rsmA Ribosomal RNA small subunit methyltransferase A Prochlorococcus marinus (strain MIT 9313)
Q2YVV2 1.76e-37 137 34 4 265 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9RU68 2.02e-37 136 38 7 259 3 rsmA Ribosomal RNA small subunit methyltransferase A Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6QEE6 2.09e-37 136 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain Newman)
Q6GJH8 2.28e-37 136 32 2 273 3 rsmA Ribosomal RNA small subunit methyltransferase A Staphylococcus aureus (strain MRSA252)
Q6NIA2 2.63e-37 136 33 6 268 3 rsmA Ribosomal RNA small subunit methyltransferase A Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q8TQU8 2.84e-37 135 34 5 258 3 rsmA Probable ribosomal RNA small subunit methyltransferase A Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P9WH07 2.96e-37 137 35 6 259 1 ksgA Ribosomal RNA small subunit methyltransferase A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH06 2.96e-37 137 35 6 259 3 ksgA Ribosomal RNA small subunit methyltransferase A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_08065
Feature type CDS
Gene rsmA
Product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
Location 129352 - 130164 (strand: -1)
Length 813 (nucleotides) / 270 (amino acids)
In genomic island -

Contig

Accession ZDB_364
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1164
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00398 Ribosomal RNA adenine dimethylase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0030 Translation, ribosomal structure and biogenesis (J) J 16S rRNA A1518 and A1519 N6-dimethyltransferase RsmA/KsgA/DIM1 (may also have DNA glycosylase/AP lyase activity)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02528 16S rRNA (adenine1518-N6/adenine1519-N6)-dimethyltransferase [EC:2.1.1.182] - -

Protein Sequence

MNTRVHQGHFARKRFGQNFLTDQFIIDSIVASINPQPGQAIVEIGPGLAALTEPVADRMDKMTVIEIDRDLAARLASHPFLQSKLTIIQQDAMTVDFTALAQERGQPLRVFGNLPYNISTPLMFHLFTFTNAISDMNFMLQKEVVNRLVAGPGSKTYGRLSVMAQYYCQVVPVLDVPPTAFRPAPKVDSAVVRLIPHRENPYVLKDVALLSRVTTQAFNQRRKTIRNSLGDLFSPETLTELGIDPATRAENISVAQYCLMANYLAEHPAS

Flanking regions ( +/- flanking 50bp)

AGCTTTATCACCGCATTAAATTTAGCGATTACAATGATTAAAAACAGTCAATGAATACACGAGTCCATCAGGGGCATTTTGCCCGTAAACGTTTCGGGCAGAACTTCTTAACCGATCAATTTATTATCGACAGTATTGTCGCGTCGATTAACCCGCAACCCGGCCAGGCGATTGTTGAAATCGGGCCGGGACTGGCTGCCCTGACTGAGCCGGTCGCCGATCGCATGGACAAAATGACGGTCATTGAAATTGACCGTGATCTGGCCGCCCGTCTGGCCAGCCATCCGTTTTTACAAAGCAAACTGACCATTATTCAGCAGGATGCCATGACCGTGGATTTCACGGCACTGGCACAGGAACGCGGCCAGCCGCTGCGGGTGTTCGGTAACCTGCCGTACAATATCTCCACGCCGCTGATGTTCCATCTGTTCACGTTCACTAACGCAATCAGTGACATGAACTTTATGCTGCAAAAAGAAGTGGTTAACCGTCTGGTTGCCGGTCCGGGCAGCAAAACATACGGCCGTCTGAGTGTCATGGCACAGTATTACTGCCAGGTCGTTCCGGTTCTGGATGTGCCGCCGACGGCATTCCGCCCGGCACCAAAAGTGGATTCAGCGGTTGTCCGTCTGATCCCGCACCGCGAAAATCCGTATGTACTGAAAGACGTCGCGCTGCTCAGCCGTGTAACCACGCAGGCCTTTAACCAGCGCCGCAAAACGATCCGCAACAGCTTAGGTGATCTGTTCAGTCCGGAAACCCTGACTGAGCTGGGTATTGATCCGGCCACCCGTGCAGAAAATATCAGTGTTGCGCAATACTGTCTGATGGCCAATTACCTGGCGGAACATCCCGCCTCATAGGGGATTCATCATGAATAACGACCCGAGAATTTGTATTCAGGTTCAGAGTG