Homologs in group_1073

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06085 FBDBKF_06085 78.6 Morganella morganii S1 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
EHELCC_09130 EHELCC_09130 78.6 Morganella morganii S2 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
NLDBIP_09510 NLDBIP_09510 78.6 Morganella morganii S4 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
LHKJJB_08245 LHKJJB_08245 78.6 Morganella morganii S3 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
HKOGLL_07795 HKOGLL_07795 78.6 Morganella morganii S5 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
F4V73_RS15825 F4V73_RS15825 76.4 Morganella psychrotolerans rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM

Distribution of the homologs in the orthogroup group_1073

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1073

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F2E7 0.0 763 100 0 365 3 rlmM Ribosomal RNA large subunit methyltransferase M Proteus mirabilis (strain HI4320)
Q6QNZ6 0.0 620 79 0 364 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus sp. (strain Az29)
C7BKL0 0.0 619 79 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus asymbiotica subsp. asymbiotica (strain ATCC 43949 / 3105-77)
Q7N8R4 0.0 617 79 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DAH1 0.0 586 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C6CC07 0.0 582 76 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Musicola paradisiaca (strain Ech703)
B1JQE8 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667H7 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLA5 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis (strain Pestoides F)
Q1CFD2 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH78 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis
B2JZ47 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CAQ2 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFF7 0.0 578 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6CEU3 0.0 578 76 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Dickeya chrysanthemi (strain Ech1591)
A7MR02 0.0 578 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Cronobacter sakazakii (strain ATCC BAA-894)
A1JPA5 0.0 577 74 1 366 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A9R2P6 0.0 576 75 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Angola)
Q3YY51 0.0 576 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella sonnei (strain Ss046)
Q8FEE5 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MYV7 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O81 (strain ED1a)
B7UHM2 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R7N4 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain UTI89 / UPEC)
B1LR00 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SMS-3-5 / SECEC)
B6I6K4 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SE11)
B7N740 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ADR6 0.0 575 75 0 358 1 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12)
B1IU35 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TE53 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEZ3 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O1:K1 / APEC
A8A3U1 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O9:H4 (strain HS)
B1XDL5 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / DH10B)
C4ZZW1 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / MC4100 / BW2952)
C6UCT5 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / REL606)
C5W8B2 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / BL21-DE3)
B7LXM2 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O8 (strain IAI1)
B7NVV4 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O7:K1 (strain IAI39 / ExPEC)
C6USC2 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5Z4C6 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ADR7 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7
B7LEY3 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain 55989 / EAEC)
B7MLC7 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZQQ1 0.0 575 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O139:H28 (strain E24377A / ETEC)
C5BHA4 0.0 575 75 1 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Edwardsiella ictaluri (strain 93-146)
Q31XI5 0.0 574 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 4 (strain Sb227)
A8GIF9 0.0 574 71 0 364 3 rlmM Ribosomal RNA large subunit methyltransferase M Serratia proteamaculans (strain 568)
Q6D8F7 0.0 574 73 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q83JW6 0.0 573 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri
Q0T154 0.0 573 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri serotype 5b (strain 8401)
B2TZC9 0.0 573 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LVW4 0.0 573 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32CB2 0.0 572 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella dysenteriae serotype 1 (strain Sd197)
A6TD87 0.0 570 73 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XUY0 0.0 570 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae (strain 342)
A4WDY6 0.0 563 72 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Enterobacter sp. (strain 638)
A8AP21 0.0 560 72 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5RDV8 0.0 556 70 0 364 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7CPW1 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFI3 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhi
B4TUK1 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella schwarzengrund (strain CVM19633)
A9N2J6 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T4X5 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella newport (strain SL254)
B5QWR4 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella enteritidis PT4 (strain P125109)
B5BF35 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain AKU_12601)
C0PXG9 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi C (strain RKS4594)
Q5PEK5 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TGN7 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella heidelberg (strain SL476)
B5FTY5 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella dublin (strain CT_02021853)
Q57KD6 0.0 555 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella choleraesuis (strain SC-B67)
B5F4S7 0.0 554 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella agona (strain SL483)
A9MSA2 0.0 551 71 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VFX4 0.0 548 70 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NRJ6 0.0 512 66 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Sodalis glossinidius (strain morsitans)
A7N1H7 2.98e-178 501 66 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio campbellii (strain ATCC BAA-1116)
Q8DFB2 4.67e-178 501 66 2 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain CMCP6)
Q6LN05 2.39e-177 499 64 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Photobacterium profundum (strain SS9)
Q7MN36 6.04e-177 498 66 2 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain YJ016)
Q5E7A8 6.52e-177 498 65 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EGG2 1.02e-176 498 64 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio salmonicida (strain LFI1238)
B5FAT6 1.22e-176 498 65 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain MJ11)
Q87RT2 4.88e-176 496 66 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B7VJ92 6.98e-175 493 63 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio atlanticus (strain LGP32)
B0BNW7 3.43e-162 461 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1B0 3.43e-162 461 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3QGM9 1.76e-161 459 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A3N049 2.36e-161 459 61 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A1S8C4 1.29e-160 457 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TPH1 2.12e-159 454 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella halifaxensis (strain HAW-EB4)
B1KQX8 2.84e-159 453 61 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella woodyi (strain ATCC 51908 / MS32)
A8H6W1 8.23e-159 452 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A4Y4Y0 1.02e-158 452 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A5UCR5 1.48e-158 452 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittEE)
A1RLU3 3e-158 451 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain W3-18-1)
Q0HSX8 3.38e-158 451 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-7)
Q0HGM5 5.41e-158 450 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-4)
A9KTM5 6.24e-158 450 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS195)
A6WL14 6.24e-158 450 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS185)
A5UIV9 6.55e-158 450 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittGG)
A3D2C2 6.66e-158 450 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAT7 6.66e-158 450 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS223)
P45100 1.16e-157 449 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0KHE0 1.34e-157 449 62 1 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7VLM7 2.36e-157 449 61 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A0KZ99 2.58e-157 449 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain ANA-3)
Q4QLA4 3.09e-157 448 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain 86-028NP)
A4SQK6 1.15e-156 447 62 1 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas salmonicida (strain A449)
Q65U59 1.01e-155 444 61 4 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q07ZE4 1.28e-155 444 59 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella frigidimarina (strain NCIMB 400)
Q8EGQ9 2.33e-155 444 59 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A6VQ01 4.94e-155 443 59 3 361 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C6ANQ9 6.8e-153 437 59 4 361 3 rlmM Ribosomal RNA large subunit methyltransferase M Aggregatibacter aphrophilus (strain NJ8700)
Q3IKB2 9.32e-153 437 57 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas translucida (strain TAC 125)
A8FYK0 1.5e-152 436 58 2 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sediminis (strain HAW-EB3)
Q9CN71 2.13e-152 436 58 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Pasteurella multocida (strain Pm70)
C4L9Y9 4.96e-152 435 60 1 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q12L35 7.95e-152 435 58 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q0I256 1.7e-145 419 57 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 129Pt)
B0UVZ4 3.76e-145 418 57 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 2336)
Q5QW15 5.52e-139 402 56 3 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1SV95 1.42e-136 396 53 3 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q15TS0 2.39e-133 387 54 3 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q47YA5 2.49e-127 373 50 2 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0KGD7 5.16e-119 351 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain GB-1)
A4XTK0 3.18e-118 349 50 4 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas mendocina (strain ymp)
Q88L23 4.66e-118 348 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6J0 2.72e-117 347 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
C1DEM7 3.26e-116 344 50 5 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B1J5D5 2.09e-114 339 48 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain W619)
Q1I7B1 4.24e-114 338 48 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas entomophila (strain L48)
B3PKB3 1.07e-112 335 47 3 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Cellvibrio japonicus (strain Ueda107)
A4VKM0 3.95e-111 331 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Stutzerimonas stutzeri (strain A1501)
Q884S1 4e-111 331 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4ZQY7 5.19e-111 331 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. syringae (strain B728a)
C3K5G4 8.75e-111 330 48 5 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain SBW25)
Q48GK0 1.17e-110 330 47 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3K9C8 2.11e-110 329 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain Pf0-1)
Q4KFD4 2.68e-110 329 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1QUU9 1.66e-107 322 46 2 347 3 rlmM Ribosomal RNA large subunit methyltransferase M Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B4RSU6 1.68e-107 322 45 2 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A6V7T6 2.38e-107 321 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain PA7)
Q9I3F4 1.07e-106 320 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVG0 1.07e-106 320 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain LESB58)
Q02K46 1.72e-106 319 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain UCBPP-PA14)
A6VWM5 7.32e-106 317 46 4 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinomonas sp. (strain MWYL1)
Q60CL4 5.92e-104 313 46 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A1K471 8.46e-101 305 44 3 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Azoarcus sp. (strain BH72)
C5BR43 6.22e-98 297 44 5 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Teredinibacter turnerae (strain ATCC 39867 / T7901)
C4ZJM0 1.86e-97 296 43 3 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Thauera aminoaromatica
Q21LL4 5.88e-96 292 44 4 345 3 rlmM Ribosomal RNA large subunit methyltransferase M Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8PNZ9 7.4e-96 292 44 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas axonopodis pv. citri (strain 306)
Q5P1Y4 4.79e-95 290 44 4 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A1U1J4 5.11e-95 290 42 5 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B2SPV7 1.08e-94 289 43 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q8PCB8 1.6e-94 288 44 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RUG0 1.6e-94 288 44 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain B100)
Q4UR65 1.6e-94 288 44 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain 8004)
Q2NZK8 1.78e-94 288 43 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BX58 2.09e-94 288 43 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5GWE6 2.46e-94 288 43 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2FPH5 5.69e-89 275 44 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain K279a)
B4SK51 1.39e-87 271 43 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain R551-3)
Q9PFD0 1.01e-84 263 40 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain 9a5c)
B0U5D5 1.49e-84 263 40 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M12)
Q87AC0 2.09e-82 258 40 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9N9 2.09e-82 258 40 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M23)
C1DB52 7.22e-77 243 38 5 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Laribacter hongkongensis (strain HLHK9)
Q2SJS1 2.32e-76 243 36 3 344 3 rlmM Ribosomal RNA large subunit methyltransferase M Hahella chejuensis (strain KCTC 2396)
Q0A8J8 3.49e-76 242 41 6 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WXL3 8.82e-75 238 39 10 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Halorhodospira halophila (strain DSM 244 / SL1)
Q0VP88 1.86e-63 209 39 12 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11355
Feature type CDS
Gene rlmM
Product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
Location 2499238 - 2500335 (strand: -1)
Length 1098 (nucleotides) / 365 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1073
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01728 FtsJ-like methyltransferase
PF18125 RlmM ferredoxin-like domain
PF21239 Ribosomal RNA large subunit methyltransferase M, N-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2933 Translation, ribosomal structure and biogenesis (J) J 23S rRNA C2498 (ribose-2'-O)-methylase RlmM

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06968 23S rRNA (cytidine2498-2'-O)-methyltransferase [EC:2.1.1.186] - -

Protein Sequence

MNKVALYCRPGFEKECAAEITDKAGQIGVYGFSRVKEGSGYVIFECYQEGDADKIARDVDFRGLIFARQLFVCGELLKNLPPEDRITPIIDQLKGSTEKAGELRVEVADTNESKELLKFCRKFTVPLRNQLRKEKILLKVENYSRPVIHVFFIAPGCCYVGYSYSFNNSPFYMGIPRLKFPADAPSRSTLKLEEAFHVFIPYEEWEERLASGMSAVDLGACPGGWTYQLVKRSMMVHAVDNGPMAPSLMETGQVRHHQADGFKFEPTSKNITWLVCDMVEKPAKVAALMTTWIVNEWCREAIFNLKLPMKKRYEEVAHILDKIRAELAEKGINAKIQAKHLYHDREEITVHIQNIWAAYRPDREF

Flanking regions ( +/- flanking 50bp)

GATTTTAATTTTTATTGGCGCTTTGCGTCTAAGGACACCGGCATCTCGCCATGAATAAAGTAGCATTATATTGTCGCCCTGGTTTTGAAAAAGAGTGCGCGGCGGAGATAACGGATAAGGCAGGACAAATAGGTGTTTATGGCTTTTCTCGAGTGAAAGAGGGAAGTGGTTACGTCATTTTTGAATGCTATCAAGAAGGTGATGCAGATAAAATTGCTCGTGATGTGGATTTTAGAGGACTTATTTTTGCACGCCAATTATTTGTTTGTGGTGAATTATTAAAGAACTTACCACCAGAAGATCGTATTACTCCCATTATTGACCAGCTAAAAGGTAGTACAGAAAAAGCAGGTGAGTTACGTGTTGAAGTCGCTGATACCAATGAAAGCAAAGAGTTATTAAAATTTTGCCGCAAATTCACTGTTCCTTTGCGTAATCAATTACGTAAAGAAAAGATCTTATTAAAAGTTGAAAATTATAGCCGTCCGGTGATCCATGTCTTTTTTATTGCTCCGGGATGTTGTTACGTGGGCTATTCCTATAGCTTTAATAACTCGCCATTCTATATGGGGATCCCTCGCTTAAAATTCCCAGCCGATGCACCAAGTCGTTCAACTTTAAAACTTGAAGAAGCGTTCCATGTTTTTATTCCTTATGAAGAGTGGGAAGAGCGCTTAGCCAGTGGGATGAGTGCGGTTGATCTTGGGGCGTGTCCCGGAGGATGGACTTACCAATTAGTTAAACGTAGCATGATGGTGCATGCCGTTGATAATGGTCCTATGGCTCCTTCTTTAATGGAAACAGGGCAAGTGCGCCACCATCAAGCTGATGGCTTTAAGTTTGAGCCGACGTCAAAGAATATTACTTGGCTGGTGTGTGATATGGTTGAGAAGCCTGCCAAAGTGGCTGCATTAATGACAACGTGGATAGTTAATGAATGGTGTCGTGAAGCAATCTTCAACTTAAAATTACCGATGAAAAAGCGTTATGAAGAAGTTGCGCATATCCTTGATAAAATTAGAGCTGAATTAGCTGAGAAAGGCATTAATGCTAAAATTCAGGCTAAGCATTTGTATCATGACAGAGAAGAGATCACGGTACATATCCAAAATATCTGGGCTGCTTATCGTCCTGATCGCGAGTTTTAACTTCATAGAGTTAAGTTCATCTTTTGATGAGTAAATCATTAACAGGCTAA