Homologs in group_1141

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06085 FBDBKF_06085 92.3 Morganella morganii S1 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
EHELCC_09130 EHELCC_09130 92.3 Morganella morganii S2 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
NLDBIP_09510 NLDBIP_09510 92.3 Morganella morganii S4 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
LHKJJB_08245 LHKJJB_08245 92.3 Morganella morganii S3 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
HKOGLL_07795 HKOGLL_07795 92.3 Morganella morganii S5 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
PMI_RS11355 PMI_RS11355 76.4 Proteus mirabilis HI4320 rlmM 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM

Distribution of the homologs in the orthogroup group_1141

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1141

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N8R4 0.0 612 77 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6QNZ6 0.0 610 77 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus sp. (strain Az29)
C7BKL0 0.0 605 76 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Photorhabdus asymbiotica subsp. asymbiotica (strain ATCC 43949 / 3105-77)
B4F2E7 0.0 597 76 0 365 3 rlmM Ribosomal RNA large subunit methyltransferase M Proteus mirabilis (strain HI4320)
B1JQE8 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667H7 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TLA5 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis (strain Pestoides F)
Q1CFD2 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Nepal516)
A9R2P6 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Angola)
Q8ZH78 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis
B2JZ47 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CAQ2 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFF7 0.0 587 74 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6CC07 0.0 584 75 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Musicola paradisiaca (strain Ech703)
A8GIF9 0.0 583 73 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Serratia proteamaculans (strain 568)
A1JPA5 0.0 578 73 0 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6CEU3 0.0 577 74 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Dickeya chrysanthemi (strain Ech1591)
B1LR00 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SMS-3-5 / SECEC)
B6I6K4 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain SE11)
B7N740 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ADR6 0.0 574 72 0 363 1 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12)
B1IU35 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3U1 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O9:H4 (strain HS)
B1XDL5 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / DH10B)
C4ZZW1 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain K12 / MC4100 / BW2952)
C6UCT5 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / REL606)
C5W8B2 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain B / BL21-DE3)
B7LXM2 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O8 (strain IAI1)
B7NVV4 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O7:K1 (strain IAI39 / ExPEC)
C6USC2 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5Z4C6 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ADR7 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O157:H7
B7LEY3 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain 55989 / EAEC)
A7ZQQ1 0.0 574 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O139:H28 (strain E24377A / ETEC)
Q31XI5 0.0 573 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 4 (strain Sb227)
Q83JW6 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri
Q0T154 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella flexneri serotype 5b (strain 8401)
B2TZC9 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A4WDY6 0.0 572 71 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Enterobacter sp. (strain 638)
Q8FEE5 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MYV7 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O81 (strain ED1a)
B7UHM2 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O127:H6 (strain E2348/69 / EPEC)
C5BHA4 0.0 572 73 1 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Edwardsiella ictaluri (strain 93-146)
Q1R7N4 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli (strain UTI89 / UPEC)
A1AEZ3 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O1:K1 / APEC
B7MLC7 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0TE53 0.0 572 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LVW4 0.0 571 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32CB2 0.0 570 72 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella dysenteriae serotype 1 (strain Sd197)
B5XUY0 0.0 570 71 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae (strain 342)
Q3YY51 0.0 569 71 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Shigella sonnei (strain Ss046)
A6TD87 0.0 569 71 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MR02 0.0 567 71 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Cronobacter sakazakii (strain ATCC BAA-894)
A8AP21 0.0 567 72 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C6DAH1 0.0 565 72 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B5RDV8 0.0 563 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q7CPW1 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XFI3 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella typhi
B4TUK1 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella schwarzengrund (strain CVM19633)
A9N2J6 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T4X5 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella newport (strain SL254)
B5QWR4 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella enteritidis PT4 (strain P125109)
C0PXG9 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi C (strain RKS4594)
B5FTY5 0.0 561 69 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella dublin (strain CT_02021853)
Q57KD6 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella choleraesuis (strain SC-B67)
B5BF35 0.0 561 69 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain AKU_12601)
Q5PEK5 0.0 561 69 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TGN7 0.0 561 69 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella heidelberg (strain SL476)
B5F4S7 0.0 561 70 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella agona (strain SL483)
Q6D8F7 0.0 560 72 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9MSA2 0.0 557 69 0 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VFX4 0.0 533 68 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q2NRJ6 0.0 530 68 0 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Sodalis glossinidius (strain morsitans)
Q5E7A8 4.84e-174 491 64 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain ATCC 700601 / ES114)
B6EGG2 7.1e-174 491 62 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio salmonicida (strain LFI1238)
B5FAT6 9.54e-174 490 64 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aliivibrio fischeri (strain MJ11)
Q6LN05 1.09e-173 490 63 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Photobacterium profundum (strain SS9)
Q8DFB2 4.32e-171 484 64 2 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain CMCP6)
A7N1H7 7.31e-171 483 64 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio campbellii (strain ATCC BAA-1116)
B7VJ92 2.23e-170 482 62 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio atlanticus (strain LGP32)
Q7MN36 3.9e-170 481 64 2 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio vulnificus (strain YJ016)
Q87RT2 4.21e-168 476 63 1 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1RLU3 6.53e-160 455 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain W3-18-1)
A9KTM5 1.43e-159 454 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS195)
A6WL14 1.43e-159 454 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS185)
A3D2C2 1.64e-159 454 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAT7 1.64e-159 454 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella baltica (strain OS223)
Q0HGM5 4.72e-159 453 59 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-4)
A4Y4Y0 5.1e-159 453 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A5UIV9 1.51e-158 452 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittGG)
Q0HSX8 8.47e-158 450 59 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain MR-7)
P45100 1.14e-157 449 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QLA4 1.28e-157 449 60 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain 86-028NP)
A0KZ99 6.54e-157 447 59 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sp. (strain ANA-3)
Q8EGQ9 6.83e-157 447 59 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A3N049 1.25e-156 447 60 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A5UCR5 5.72e-156 445 59 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus influenzae (strain PittEE)
B0BNW7 7.91e-156 445 60 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H1B0 7.91e-156 445 60 3 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3QGM9 1.18e-155 444 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8H6W1 3.23e-155 443 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A4SQK6 3.37e-155 443 61 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas salmonicida (strain A449)
A0KHE0 7.4e-155 442 60 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B1KQX8 9.19e-155 442 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella woodyi (strain ATCC 51908 / MS32)
B0TPH1 2.07e-154 441 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella halifaxensis (strain HAW-EB4)
A1S8C4 4.51e-154 440 60 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8FYK0 8.15e-153 437 58 3 365 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella sediminis (strain HAW-EB3)
Q7VLM7 3.38e-152 436 59 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9CN71 7.5e-152 435 59 3 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Pasteurella multocida (strain Pm70)
A6VQ01 9.51e-152 434 58 4 363 3 rlmM Ribosomal RNA large subunit methyltransferase M Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C4L9Y9 8.5e-151 432 59 2 367 3 rlmM Ribosomal RNA large subunit methyltransferase M Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q12L35 2.55e-149 429 56 1 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q07ZE4 4.12e-149 428 57 1 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Shewanella frigidimarina (strain NCIMB 400)
Q65U59 1.91e-148 426 59 4 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A1SV95 1.92e-147 424 54 2 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C6ANQ9 5.38e-147 422 57 3 360 3 rlmM Ribosomal RNA large subunit methyltransferase M Aggregatibacter aphrophilus (strain NJ8700)
Q0I256 2.29e-142 410 55 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 129Pt)
B0UVZ4 7.79e-141 407 55 2 359 3 rlmM Ribosomal RNA large subunit methyltransferase M Histophilus somni (strain 2336)
Q15TS0 1.53e-136 395 53 4 358 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3IKB2 2.23e-135 393 51 2 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudoalteromonas translucida (strain TAC 125)
Q5QW15 7.87e-129 377 52 3 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q47YA5 9.84e-123 361 49 2 356 3 rlmM Ribosomal RNA large subunit methyltransferase M Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88L23 3.21e-120 354 50 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W6J0 5.07e-120 353 50 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KGD7 5.35e-120 353 50 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain GB-1)
B1J5D5 8.13e-118 348 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas putida (strain W619)
Q1I7B1 1.8e-117 347 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas entomophila (strain L48)
C1DEM7 8.83e-117 345 49 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q4KFD4 7.81e-116 343 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZQY7 2.2e-115 342 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. syringae (strain B728a)
Q884S1 6.25e-115 341 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XTK0 6.2e-114 338 48 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas mendocina (strain ymp)
Q48GK0 1.32e-113 337 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3K9C8 1.54e-113 337 48 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain Pf0-1)
C3K5G4 1.93e-113 337 49 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas fluorescens (strain SBW25)
A4VKM0 3.07e-111 331 47 5 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Stutzerimonas stutzeri (strain A1501)
Q02K46 3.46e-109 326 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V7T6 5.64e-109 325 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain PA7)
Q9I3F4 6.79e-109 325 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7UVG0 6.79e-109 325 47 4 355 3 rlmM Ribosomal RNA large subunit methyltransferase M Pseudomonas aeruginosa (strain LESB58)
B4RSU6 3.96e-108 324 43 1 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B3PKB3 8.11e-108 322 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Cellvibrio japonicus (strain Ueda107)
Q60CL4 3.49e-102 308 45 3 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A6VWM5 1.37e-101 306 44 5 353 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinomonas sp. (strain MWYL1)
Q1QUU9 3.52e-101 306 44 2 347 3 rlmM Ribosomal RNA large subunit methyltransferase M Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B2SPV7 4.31e-98 298 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZK8 6.51e-98 297 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q8PNZ9 6.58e-98 297 44 4 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas axonopodis pv. citri (strain 306)
Q8PCB8 7.82e-98 297 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RUG0 7.82e-98 297 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain B100)
Q4UR65 7.82e-98 297 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas campestris pv. campestris (strain 8004)
Q5GWE6 9.94e-98 296 45 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
C4ZJM0 7.55e-97 295 42 4 349 3 rlmM Ribosomal RNA large subunit methyltransferase M Thauera aminoaromatica
Q3BX58 8.81e-97 294 44 5 354 3 rlmM Ribosomal RNA large subunit methyltransferase M Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
A1K471 4.38e-96 293 42 5 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Azoarcus sp. (strain BH72)
Q21LL4 8.82e-93 284 43 3 345 3 rlmM Ribosomal RNA large subunit methyltransferase M Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q5P1Y4 6.91e-92 282 44 4 346 3 rlmM Ribosomal RNA large subunit methyltransferase M Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B2FPH5 1.31e-90 279 43 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain K279a)
A1U1J4 2.64e-90 278 41 6 364 3 rlmM Ribosomal RNA large subunit methyltransferase M Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B4SK51 5.42e-90 277 43 4 343 3 rlmM Ribosomal RNA large subunit methyltransferase M Stenotrophomonas maltophilia (strain R551-3)
Q9PFD0 3.84e-89 275 41 4 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain 9a5c)
B0U5D5 2.37e-88 273 41 4 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M12)
C5BR43 1.04e-86 268 42 5 357 3 rlmM Ribosomal RNA large subunit methyltransferase M Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q87AC0 5.26e-86 267 41 4 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9N9 5.26e-86 267 41 4 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Xylella fastidiosa (strain M23)
Q2SJS1 2.76e-79 251 37 3 344 3 rlmM Ribosomal RNA large subunit methyltransferase M Hahella chejuensis (strain KCTC 2396)
Q0A8J8 6.21e-79 249 41 6 350 3 rlmM Ribosomal RNA large subunit methyltransferase M Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WXL3 1.72e-78 247 41 10 351 3 rlmM Ribosomal RNA large subunit methyltransferase M Halorhodospira halophila (strain DSM 244 / SL1)
C1DB52 6.01e-75 238 37 6 352 3 rlmM Ribosomal RNA large subunit methyltransferase M Laribacter hongkongensis (strain HLHK9)
Q0VP88 3e-60 201 37 8 345 3 rlmM Ribosomal RNA large subunit methyltransferase M Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15825
Feature type CDS
Gene rlmM
Product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM
Location 171908 - 173005 (strand: 1)
Length 1098 (nucleotides) / 365 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000005
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1141
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01728 FtsJ-like methyltransferase
PF18125 RlmM ferredoxin-like domain
PF21239 Ribosomal RNA large subunit methyltransferase M, N-terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2933 Translation, ribosomal structure and biogenesis (J) J 23S rRNA C2498 (ribose-2'-O)-methylase RlmM

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06968 23S rRNA (cytidine2498-2'-O)-methyltransferase [EC:2.1.1.186] - -

Protein Sequence

MNKIALYCRPGFEKECAAEITDKAGRLEIFGFPRVKENSGYVIFECYQPDDADRIVKEIPFKELIFARQMIVVGELLKHLPENDRITPIIGMLTGIVDRAGELRVEVPDNDEAKELMKFCRKFTVPLRSALRQEKLLLAKENRGRPVIHILFIAPGCCYAGYSYSNNNSSFYMGIPRLKFPSDAPSRSTLKLEEAFHMFIPYEEWEERLEGGLHAVDLGACPGGWTYQLVKHSMRVQAVDNGTMAESLMDTGQVRHLREDGFKFEPSSKNITWLVCDMVEKPAKVAALMTTWMANGWCRESIFNLKLPMKKRYEEVSHILEKMAAELKAQDINVLIHAKQLYHDREEITVHIQRVWGAYNPDRVF

Flanking regions ( +/- flanking 50bp)

GGTTTGTGTATTAATCGGCGCAGTGCGTCTAAGGAAAGTGGCTTCCGGCCATGAATAAAATTGCATTATATTGCCGTCCGGGCTTTGAAAAAGAGTGTGCAGCCGAGATCACGGATAAAGCCGGACGCCTTGAGATTTTCGGATTCCCGCGTGTCAAAGAGAACAGCGGGTATGTCATTTTTGAATGTTATCAGCCGGATGATGCTGATCGCATTGTAAAAGAGATCCCGTTTAAAGAATTGATTTTTGCCCGCCAGATGATTGTGGTGGGTGAATTACTCAAGCATTTACCGGAAAACGATCGCATTACACCGATTATCGGAATGCTGACCGGAATTGTGGATCGCGCGGGTGAACTGCGTGTTGAAGTGCCGGATAATGACGAAGCGAAAGAGCTGATGAAGTTCTGCCGTAAGTTTACCGTTCCGCTGCGTTCAGCACTGCGTCAGGAGAAATTACTGCTGGCAAAAGAGAACCGTGGTCGTCCGGTTATTCACATCTTATTTATTGCGCCGGGTTGTTGCTATGCGGGTTATTCATATTCTAATAATAACTCTTCATTCTATATGGGCATCCCGCGCCTGAAATTCCCGTCAGATGCGCCGAGCCGTTCCACACTGAAGCTGGAAGAGGCTTTCCACATGTTTATTCCTTACGAAGAGTGGGAAGAGCGTCTGGAAGGCGGGCTGCATGCGGTGGATCTGGGCGCTTGCCCCGGCGGCTGGACGTATCAGCTGGTGAAACACAGTATGCGCGTACAGGCTGTGGATAACGGCACGATGGCAGAAAGCCTGATGGATACCGGACAGGTACGCCATCTTCGCGAGGACGGATTTAAGTTTGAACCGTCGTCGAAAAATATCACCTGGCTGGTGTGTGATATGGTTGAAAAACCGGCAAAAGTTGCGGCGTTAATGACAACCTGGATGGCGAACGGCTGGTGTCGCGAATCTATTTTCAATTTAAAACTGCCGATGAAAAAGCGCTATGAAGAAGTGTCACATATCCTGGAAAAGATGGCTGCAGAGCTGAAAGCTCAGGATATTAATGTGCTTATTCATGCCAAGCAGCTATATCATGACCGCGAAGAGATAACGGTTCATATTCAGCGTGTTTGGGGTGCGTACAATCCGGATCGGGTCTTCTGATTATACCCTTATTCATTCAAACCGCAGGTGCGTTGGCTGCATCCTGAATG