Homologs in group_2386

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18990 FBDBKF_18990 63.5 Morganella morganii S1 truD tRNA pseudouridine(13) synthase TruD
EHELCC_18735 EHELCC_18735 63.5 Morganella morganii S2 truD tRNA pseudouridine(13) synthase TruD
NLDBIP_18570 NLDBIP_18570 63.5 Morganella morganii S4 truD tRNA pseudouridine(13) synthase TruD
LHKJJB_18605 LHKJJB_18605 63.5 Morganella morganii S3 truD tRNA pseudouridine(13) synthase TruD
HKOGLL_18340 HKOGLL_18340 63.5 Morganella morganii S5 truD tRNA pseudouridine(13) synthase TruD
F4V73_RS13900 F4V73_RS13900 66.4 Morganella psychrotolerans truD tRNA pseudouridine(13) synthase TruD

Distribution of the homologs in the orthogroup group_2386

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2386

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F225 0.0 729 100 0 350 3 truD tRNA pseudouridine synthase D Proteus mirabilis (strain HI4320)
Q7N8K5 1.79e-159 453 64 1 346 3 truD tRNA pseudouridine synthase D Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JJT6 2.41e-158 450 63 0 348 3 truD tRNA pseudouridine synthase D Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DDG0 2.34e-155 442 64 0 338 3 truD tRNA pseudouridine synthase D Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B1JJF6 3.79e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EC1 3.79e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pseudotuberculosis serotype I (strain IP32953)
A7FLX6 3.79e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4TPZ9 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pestis (strain Pestoides F)
Q1CLR4 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pestis bv. Antiqua (strain Nepal516)
A9R117 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBP8 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pestis
B2K579 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C476 4.47e-155 442 62 0 348 3 truD tRNA pseudouridine synthase D Yersinia pestis bv. Antiqua (strain Antiqua)
Q6D1B5 6.83e-155 441 63 0 338 3 truD tRNA pseudouridine synthase D Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8G9Z4 2.89e-152 435 62 1 348 3 truD tRNA pseudouridine synthase D Serratia proteamaculans (strain 568)
B2VFZ5 4.95e-149 426 61 1 338 3 truD tRNA pseudouridine synthase D Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9MF30 1.58e-147 422 60 0 338 3 truD tRNA pseudouridine synthase D Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZMF8 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TTV9 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella schwarzengrund (strain CVM19633)
B5BEY2 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella paratyphi A (strain AKU_12601)
C0PXA5 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella paratyphi C (strain RKS4594)
A9N2D1 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEG3 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TFW5 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella heidelberg (strain SL476)
B5RDQ1 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QW16 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella enteritidis PT4 (strain P125109)
B5FTS3 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella dublin (strain CT_02021853)
B5F409 9.53e-146 418 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella agona (strain SL483)
Q8Z473 1.52e-145 417 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella typhi
B4T455 8.12e-145 416 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella newport (strain SL254)
C5BGI9 8.28e-145 416 61 0 344 3 truD tRNA pseudouridine synthase D Edwardsiella ictaluri (strain 93-146)
Q57KJ6 1.03e-144 416 59 0 338 3 truD tRNA pseudouridine synthase D Salmonella choleraesuis (strain SC-B67)
B7LWL0 8.01e-142 408 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6TD37 2.42e-140 404 57 1 350 3 truD tRNA pseudouridine synthase D Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8FEJ7 3.75e-140 404 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R7U6 4.56e-140 404 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain UTI89 / UPEC)
A1AET9 4.56e-140 404 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O1:K1 / APEC
B7MKL9 4.56e-140 404 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O45:K1 (strain S88 / ExPEC)
B6I6D5 6.69e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain SE11)
Q3YYB7 7.14e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Shigella sonnei (strain Ss046)
Q57261 7.14e-140 403 57 0 338 1 truD tRNA pseudouridine synthase D Escherichia coli (strain K12)
B1XCS1 7.14e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain K12 / DH10B)
C4ZZP9 7.14e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain K12 / MC4100 / BW2952)
A7ZQI9 7.14e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32CI5 7.22e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Shigella dysenteriae serotype 1 (strain Sd197)
B7N6X5 7.79e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7UHG4 8.41e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q83QE3 9.8e-140 403 57 0 338 3 truD tRNA pseudouridine synthase D Shigella flexneri
Q31XA7 1.19e-139 403 57 0 338 3 truD tRNA pseudouridine synthase D Shigella boydii serotype 4 (strain Sb227)
B7LXF7 1.57e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O8 (strain IAI1)
Q0TEB3 1.66e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B1LQ65 1.93e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain SMS-3-5 / SECEC)
B7MZ46 2.22e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O81 (strain ED1a)
Q0T1H6 3.05e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Shigella flexneri serotype 5b (strain 8401)
B7LEG3 3.44e-139 402 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain 55989 / EAEC)
B5Z3A7 3.6e-139 401 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7Y6 3.6e-139 401 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O157:H7
B7NT89 3.88e-139 401 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1IUT4 6.7e-139 401 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3M4 6.7e-139 401 57 0 338 3 truD tRNA pseudouridine synthase D Escherichia coli O9:H4 (strain HS)
B2TZI6 1.06e-138 400 57 0 338 3 truD tRNA pseudouridine synthase D Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7MJ59 1.32e-138 400 56 1 350 3 truD tRNA pseudouridine synthase D Cronobacter sakazakii (strain ATCC BAA-894)
A8ANV9 2.02e-137 397 56 0 338 3 truD tRNA pseudouridine synthase D Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WDV0 4.44e-137 396 56 1 350 3 truD tRNA pseudouridine synthase D Enterobacter sp. (strain 638)
B5XV36 2.61e-134 389 56 1 350 3 truD tRNA pseudouridine synthase D Klebsiella pneumoniae (strain 342)
Q65Q80 1.12e-114 339 50 4 340 3 truD tRNA pseudouridine synthase D Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0URU7 9.36e-111 329 49 4 336 3 truD tRNA pseudouridine synthase D Histophilus somni (strain 2336)
Q0I5H8 1e-110 328 49 4 336 3 truD tRNA pseudouridine synthase D Histophilus somni (strain 129Pt)
Q9CKK4 3e-110 327 49 3 334 3 truD tRNA pseudouridine synthase D Pasteurella multocida (strain Pm70)
P44039 2.81e-107 320 49 4 339 1 truD tRNA pseudouridine synthase D Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6VR02 6.55e-107 319 49 4 334 3 truD tRNA pseudouridine synthase D Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q4QML9 2.53e-106 318 49 4 339 3 truD tRNA pseudouridine synthase D Haemophilus influenzae (strain 86-028NP)
A5UE25 1.62e-104 313 49 4 339 3 truD tRNA pseudouridine synthase D Haemophilus influenzae (strain PittEE)
A7MTT9 1.79e-102 308 45 4 349 3 truD tRNA pseudouridine synthase D Vibrio campbellii (strain ATCC BAA-1116)
Q8DC58 6.69e-102 306 48 5 341 3 truD tRNA pseudouridine synthase D Vibrio vulnificus (strain CMCP6)
Q87LQ4 1.53e-101 306 46 4 341 3 truD tRNA pseudouridine synthase D Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0KGH7 3.23e-101 305 49 3 335 3 truD tRNA pseudouridine synthase D Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q7MHQ6 3.27e-101 305 47 5 341 3 truD tRNA pseudouridine synthase D Vibrio vulnificus (strain YJ016)
A4SRB7 2.24e-100 303 49 3 335 3 truD tRNA pseudouridine synthase D Aeromonas salmonicida (strain A449)
Q6LMT5 5.71e-96 291 45 3 333 3 truD tRNA pseudouridine synthase D Photobacterium profundum (strain SS9)
C3LS20 2.56e-95 290 46 5 341 3 truD tRNA pseudouridine synthase D Vibrio cholerae serotype O1 (strain M66-2)
Q9KUJ0 2.56e-95 290 46 5 341 3 truD tRNA pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F9D8 2.56e-95 290 46 5 341 3 truD tRNA pseudouridine synthase D Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q5E330 5.77e-95 289 44 4 341 3 truD tRNA pseudouridine synthase D Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5FAF5 1.38e-94 288 44 4 341 3 truD tRNA pseudouridine synthase D Aliivibrio fischeri (strain MJ11)
B6EKL4 9.16e-91 278 43 4 341 3 truD tRNA pseudouridine synthase D Aliivibrio salmonicida (strain LFI1238)
Q8EBR4 5.91e-90 277 44 4 335 3 truD tRNA pseudouridine synthase D Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q31J61 4.82e-87 269 41 2 329 3 truD tRNA pseudouridine synthase D Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q15P29 2.04e-84 262 40 5 344 3 truD tRNA pseudouridine synthase D Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q487E7 2.48e-84 263 42 5 344 3 truD tRNA pseudouridine synthase D Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q604M0 1.28e-80 253 41 3 339 3 truD tRNA pseudouridine synthase D Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q3IDQ4 2.92e-77 244 38 4 335 3 truD tRNA pseudouridine synthase D Pseudoalteromonas translucida (strain TAC 125)
Q5QUC5 4.7e-75 238 40 8 345 3 truD tRNA pseudouridine synthase D Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3JCS7 2.61e-70 226 40 7 330 3 truD tRNA pseudouridine synthase D Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5WWQ2 2.75e-69 223 37 2 334 3 truD tRNA pseudouridine synthase D Legionella pneumophila (strain Lens)
B0RU01 5.23e-68 221 39 5 352 3 truD tRNA pseudouridine synthase D Xanthomonas campestris pv. campestris (strain B100)
A5ICB9 5.48e-68 219 36 1 328 3 truD tRNA pseudouridine synthase D Legionella pneumophila (strain Corby)
Q4KHE9 8.01e-68 219 39 5 333 3 truD tRNA pseudouridine synthase D Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8P9Y9 6.18e-67 218 39 5 352 3 truD tRNA pseudouridine synthase D Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UTP6 6.18e-67 218 39 5 352 3 truD tRNA pseudouridine synthase D Xanthomonas campestris pv. campestris (strain 8004)
Q5ZV19 6.95e-67 217 36 1 328 3 truD tRNA pseudouridine synthase D Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X4T2 7.1e-67 217 36 1 328 3 truD tRNA pseudouridine synthase D Legionella pneumophila (strain Paris)
A4VJV1 1.85e-66 216 38 3 336 3 truD tRNA pseudouridine synthase D Stutzerimonas stutzeri (strain A1501)
Q3BUS6 2.18e-66 216 37 4 353 3 truD tRNA pseudouridine synthase D Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
C3K704 4.76e-66 215 38 2 331 3 truD tRNA pseudouridine synthase D Pseudomonas fluorescens (strain SBW25)
Q8PLR6 5.36e-66 215 37 4 353 3 truD tRNA pseudouridine synthase D Xanthomonas axonopodis pv. citri (strain 306)
A6V1G2 5.77e-66 215 39 3 343 3 truD tRNA pseudouridine synthase D Pseudomonas aeruginosa (strain PA7)
Q9HY04 6.15e-66 215 38 3 343 3 truD tRNA pseudouridine synthase D Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5GYK8 6.57e-66 215 38 4 353 3 truD tRNA pseudouridine synthase D Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P1L2 6.57e-66 215 38 4 353 3 truD tRNA pseudouridine synthase D Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q02R98 8.22e-66 214 38 3 343 3 truD tRNA pseudouridine synthase D Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V8C2 8.86e-66 214 38 3 343 3 truD tRNA pseudouridine synthase D Pseudomonas aeruginosa (strain LESB58)
Q1I653 1.2e-65 214 40 2 330 3 truD tRNA pseudouridine synthase D Pseudomonas entomophila (strain L48)
Q3KH85 2.68e-65 213 39 5 333 3 truD tRNA pseudouridine synthase D Pseudomonas fluorescens (strain Pf0-1)
A4XWR3 1.34e-64 211 40 4 335 3 truD tRNA pseudouridine synthase D Pseudomonas mendocina (strain ymp)
Q88MF2 4.41e-62 205 39 2 321 3 truD tRNA pseudouridine synthase D Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W822 3.88e-61 202 39 2 321 3 truD tRNA pseudouridine synthase D Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KSC6 4.09e-61 202 39 2 321 3 truD tRNA pseudouridine synthase D Pseudomonas putida (strain GB-1)
Q48F86 1.08e-59 199 38 2 331 3 truD tRNA pseudouridine synthase D Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B3PJA9 3.14e-59 197 36 5 337 3 truD tRNA pseudouridine synthase D Cellvibrio japonicus (strain Ueda107)
Q4FR14 5.21e-59 198 36 8 368 3 truD tRNA pseudouridine synthase D Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4ZWQ1 1.09e-58 196 37 2 331 3 truD tRNA pseudouridine synthase D Pseudomonas syringae pv. syringae (strain B728a)
Q886L6 4.58e-58 194 37 2 331 3 truD tRNA pseudouridine synthase D Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1QU75 4.83e-58 194 38 4 331 3 truD tRNA pseudouridine synthase D Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B1JB31 8.05e-55 186 39 2 328 3 truD tRNA pseudouridine synthase D Pseudomonas putida (strain W619)
C1DSR9 8.96e-55 186 38 4 330 3 truD tRNA pseudouridine synthase D Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1TZ52 2.33e-50 174 33 7 363 3 truD tRNA pseudouridine synthase D Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q9RSX8 3.23e-50 174 37 7 329 3 truD tRNA pseudouridine synthase D Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P59893 2.4e-41 151 30 11 366 3 truD tRNA pseudouridine synthase D Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q2IFQ4 2.3e-39 145 32 11 358 3 truD tRNA pseudouridine synthase D Anaeromyxobacter dehalogenans (strain 2CP-C)
B8J7C8 7.04e-39 144 32 10 347 3 truD tRNA pseudouridine synthase D Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q5SI49 1.35e-38 144 32 10 350 3 truD tRNA pseudouridine synthase D Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72IG5 1.86e-38 143 32 10 350 3 truD tRNA pseudouridine synthase D Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q30RS1 1.07e-37 141 28 8 353 3 truD tRNA pseudouridine synthase D Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A7HGV2 2.28e-36 137 31 9 336 3 truD tRNA pseudouridine synthase D Anaeromyxobacter sp. (strain Fw109-5)
P55985 6.02e-34 132 26 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain ATCC 700392 / 26695)
B2UU74 7.62e-34 131 26 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain Shi470)
Q17WX3 7.62e-34 131 26 10 375 3 truD tRNA pseudouridine synthase D Helicobacter acinonychis (strain Sheeba)
Q9ZKS5 3.08e-33 130 26 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain J99 / ATCC 700824)
Q1CSU8 5.3e-33 129 26 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain HPAG1)
A8FNC4 5.67e-33 129 28 9 351 3 truD tRNA pseudouridine synthase D Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q9PMK3 5.73e-33 129 28 9 351 3 truD tRNA pseudouridine synthase D Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B6JME7 7.51e-33 129 26 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain P12)
Q5HSX3 1.05e-32 128 28 9 351 3 truD tRNA pseudouridine synthase D Campylobacter jejuni (strain RM1221)
B5Z7T0 1.3e-32 128 25 10 379 3 truD tRNA pseudouridine synthase D Helicobacter pylori (strain G27)
A7H5G6 1.31e-32 128 28 9 351 3 truD tRNA pseudouridine synthase D Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A1W165 1.34e-32 128 28 9 351 3 truD tRNA pseudouridine synthase D Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q3A6I8 5.78e-31 124 30 12 393 3 truD tRNA pseudouridine synthase D Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
C6E4K4 2e-29 120 27 10 393 3 truD tRNA pseudouridine synthase D Geobacter sp. (strain M21)
A6Q2U7 7.3e-29 117 28 12 357 3 truD tRNA pseudouridine synthase D Nitratiruptor sp. (strain SB155-2)
Q39R76 7.58e-29 118 28 10 401 3 truD tRNA pseudouridine synthase D Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
P59892 1.39e-28 117 25 8 366 3 truD tRNA pseudouridine synthase D Helicobacter hepaticus (strain ATCC 51449 / 3B1)
B9M644 2.75e-28 116 26 11 394 3 truD tRNA pseudouridine synthase D Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q5JDB6 4.68e-23 102 25 15 408 3 truD Probable tRNA pseudouridine synthase D Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
P60347 6.28e-23 102 26 10 391 3 truD tRNA pseudouridine synthase D Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B6YTE4 8.48e-23 101 24 17 422 3 truD Probable tRNA pseudouridine synthase D Thermococcus onnurineus (strain NA1)
Q8U0N1 1.28e-19 92 25 17 420 3 truD Probable tRNA pseudouridine synthase D Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
C5A1W0 3.69e-19 91 26 18 418 3 truD Probable tRNA pseudouridine synthase D Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
O28596 1.01e-18 90 32 1 158 3 truD Probable tRNA pseudouridine synthase D Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O59207 1.1e-17 87 24 11 412 3 truD Probable tRNA pseudouridine synthase D Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q6L1R2 1.02e-16 84 34 8 172 3 truD Probable tRNA pseudouridine synthase D Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
O27572 1.28e-16 84 32 1 152 3 truD Probable tRNA pseudouridine synthase D Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8ZTR2 1.71e-16 83 33 3 162 3 truD Probable tRNA pseudouridine synthase D Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q9HLL3 2.13e-16 83 32 3 160 3 truD Probable tRNA pseudouridine synthase D Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q3IMF3 2.28e-16 83 34 3 162 3 truD Probable tRNA pseudouridine synthase D Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q3IMF3 0.000405 45 26 6 157 3 truD Probable tRNA pseudouridine synthase D Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9V107 2.26e-15 80 34 4 165 3 truD Probable tRNA pseudouridine synthase D Pyrococcus abyssi (strain GE5 / Orsay)
A4WLG8 3.57e-14 76 32 3 159 3 truD Probable tRNA pseudouridine synthase D Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
C6A1K9 7.38e-14 75 30 3 167 3 truD Probable tRNA pseudouridine synthase D Thermococcus sibiricus (strain DSM 12597 / MM 739)
Q978K9 1.03e-13 75 29 1 147 3 truD Probable tRNA pseudouridine synthase D Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A1RRV7 1.09e-13 75 31 3 170 3 truD Probable tRNA pseudouridine synthase D Pyrobaculum islandicum (strain DSM 4184 / JCM 9189 / GEO3)
Q12WH6 2.72e-13 73 32 4 159 3 truD Probable tRNA pseudouridine synthase D Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
Q466V2 7.77e-13 72 23 14 414 3 truD Probable tRNA pseudouridine synthase D Methanosarcina barkeri (strain Fusaro / DSM 804)
O67616 1.84e-12 71 29 3 151 3 truD tRNA pseudouridine synthase D Aquifex aeolicus (strain VF5)
Q5V1E6 3.05e-12 70 29 4 181 3 truD Probable tRNA pseudouridine synthase D Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V1E6 0.000215 46 27 7 165 3 truD Probable tRNA pseudouridine synthase D Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8TKX2 4.05e-12 70 24 15 417 3 truD Probable tRNA pseudouridine synthase D Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9H0K6 8.29e-12 70 36 4 122 1 PUS7L Pseudouridylate synthase PUS7L Homo sapiens
Q1L8I0 1.39e-11 69 33 3 130 2 pus7l Pseudouridylate synthase PUS7L Danio rerio
Q6LZL0 2.33e-11 67 30 5 165 3 truD2 Probable tRNA pseudouridine synthase D 2 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q8F8N2 3.53e-11 67 32 5 161 3 truD tRNA pseudouridine synthase D Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72N01 3.53e-11 67 32 5 161 3 truD tRNA pseudouridine synthase D Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9HSG5 9.21e-11 66 32 4 161 3 truD Probable tRNA pseudouridine synthase D Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R2Y4 9.21e-11 66 32 4 161 3 truD Probable tRNA pseudouridine synthase D Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A4FYL2 1.55e-10 65 29 5 165 3 truD Probable tRNA pseudouridine synthase D Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
B1Y9W7 2.78e-10 64 32 3 159 3 truD Probable tRNA pseudouridine synthase D Pyrobaculum neutrophilum (strain DSM 2338 / JCM 9278 / NBRC 100436 / V24Sta)
Q6M1A3 3.03e-10 64 28 4 151 3 truD1 Probable tRNA pseudouridine synthase D 1 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q58759 3.39e-10 64 29 5 154 3 truD2 Probable tRNA pseudouridine synthase D 2 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TXJ7 3.83e-10 64 32 1 128 3 truD Probable tRNA pseudouridine synthase D Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q08DI8 5.67e-10 64 33 3 107 2 PUS7 Pseudouridylate synthase 7 homolog Bos taurus
Q9VSK9 8.06e-10 63 30 4 143 1 Pus7 Pseudouridylate synthase 7 homolog Drosophila melanogaster
Q91VU7 9.72e-10 63 29 3 128 2 Pus7 Pseudouridylate synthase 7 homolog Mus musculus
Q8Q0M2 1e-09 63 29 3 155 1 truD Probable tRNA pseudouridine synthase D Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q96PZ0 2.08e-09 62 32 3 107 1 PUS7 Pseudouridylate synthase 7 homolog Homo sapiens
Q8CE46 2.79e-09 62 33 4 119 1 Pus7l Pseudouridylate synthase PUS7L Mus musculus
Q17426 1.25e-08 60 29 4 144 3 B0024.11 Putative pseudouridine synthase B0024.11 Caenorhabditis elegans
A6USB0 2.37e-08 58 29 5 166 3 truD Probable tRNA pseudouridine synthase D Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q08647 2.51e-08 59 36 2 113 1 PUS7 Multisubstrate pseudouridine synthase 7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6UV17 6.08e-07 54 27 5 172 3 truD Probable tRNA pseudouridine synthase D Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
O74343 1.11e-06 53 29 3 132 3 pus7 Multisubstrate pseudouridine synthase 7 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q58008 4.9e-06 51 27 6 166 3 truD1 Probable tRNA pseudouridine synthase D 1 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11035
Feature type CDS
Gene truD
Product tRNA pseudouridine(13) synthase TruD
Location 2429709 - 2430761 (strand: -1)
Length 1053 (nucleotides) / 350 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2386
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01142 tRNA pseudouridine synthase D (TruD)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0585 Translation, ribosomal structure and biogenesis (J) J tRNA(Glu) U13 pseudouridine synthase TruD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06176 tRNA pseudouridine13 synthase [EC:5.4.99.27] - -

Protein Sequence

MSDLPELHWLHGKPTATGRLKSTPEDFKVSEDLGFTLDGEGEHVMVRVRKTGCNTAFVAEKLAKFAGIHPRDASYAGLKDRNAVTEQWFCLRMPGKEMPDFSQFTLEGCEILTTTRQQRKLRIGTLKGNHFTLVLRDISDVTSVETRLVEIQKQGVPNYFGVQRFGRNGDNLRQAWRWATNEIRVKERSKRSFYLSAARSAMFNHLVSQRLERHIYTQVLCGDAMQLHGKRSWFVAEGAELAQIQTRYEEHDIHITAPLPGKGDLGTQAQALIFETDNLADYEALWSLAQQERVDTTRRAINLLPENMSWHWLDDTTVSLSFFLPAGSFATSVVRELILLGNIDAENISE

Flanking regions ( +/- flanking 50bp)

GGTATCGCTTGTGAAGCGGTGGTGTTATTAATCAAAGAGTCTTTATCTTAATGAGTGATTTACCAGAACTTCATTGGCTACATGGCAAACCGACAGCGACAGGGCGATTAAAATCGACACCAGAAGATTTTAAGGTCAGCGAAGATCTCGGCTTTACCTTAGATGGTGAAGGCGAACACGTGATGGTTAGAGTCAGAAAAACAGGTTGTAATACGGCTTTTGTGGCTGAAAAGTTAGCTAAATTTGCCGGTATTCATCCTCGAGATGCTAGTTATGCTGGGCTTAAAGACAGAAATGCGGTTACGGAACAATGGTTTTGTTTGCGTATGCCGGGTAAAGAGATGCCCGACTTTAGTCAATTTACGTTAGAAGGTTGCGAAATATTAACAACCACCCGCCAGCAACGTAAGCTACGTATTGGGACATTAAAAGGGAACCATTTCACCTTAGTATTACGTGATATCTCCGATGTGACATCGGTGGAAACTCGTCTAGTAGAGATACAAAAACAAGGGGTTCCTAACTATTTTGGTGTGCAACGCTTTGGTCGTAATGGCGACAATTTACGCCAAGCATGGCGTTGGGCAACCAATGAAATTCGGGTAAAAGAGCGTAGCAAACGTAGCTTTTATCTCTCAGCTGCACGTAGTGCGATGTTTAATCATCTGGTGAGCCAACGACTTGAGCGTCATATTTATACTCAAGTGCTTTGTGGTGATGCGATGCAATTGCACGGTAAAAGAAGTTGGTTTGTGGCAGAAGGAGCGGAACTTGCCCAAATACAAACACGCTATGAAGAGCATGATATACATATTACCGCTCCATTGCCGGGTAAAGGTGACTTAGGTACACAAGCACAAGCACTGATATTTGAAACCGACAACTTAGCTGACTACGAAGCATTATGGTCATTAGCACAACAAGAGCGAGTTGATACCACTCGCCGTGCGATTAATTTGCTACCAGAAAATATGTCATGGCATTGGTTAGATGATACTACGGTTTCTTTATCGTTCTTTTTGCCAGCAGGAAGTTTTGCCACTAGCGTTGTCCGTGAATTGATATTATTAGGGAATATTGATGCTGAAAATATTAGTGAGTAATGACGATGGTGTTATGGCAAAAGGGATACAGACACTCGCAAAAGCCTTAC