Homologs in group_916

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04955 FBDBKF_04955 83.5 Morganella morganii S1 ppiB peptidylprolyl isomerase B
EHELCC_06245 EHELCC_06245 83.5 Morganella morganii S2 ppiB peptidylprolyl isomerase B
NLDBIP_06565 NLDBIP_06565 83.5 Morganella morganii S4 ppiB peptidylprolyl isomerase B
LHKJJB_03445 LHKJJB_03445 83.5 Morganella morganii S3 ppiB peptidylprolyl isomerase B
HKOGLL_06920 HKOGLL_06920 83.5 Morganella morganii S5 ppiB peptidylprolyl isomerase B
F4V73_RS16095 F4V73_RS16095 78.7 Morganella psychrotolerans ppiB peptidylprolyl isomerase B

Distribution of the homologs in the orthogroup group_916

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_916

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23869 1.52e-102 294 83 0 164 1 ppiB Peptidyl-prolyl cis-trans isomerase B Escherichia coli (strain K12)
P44499 1.13e-86 254 71 1 168 3 ppiB Peptidyl-prolyl cis-trans isomerase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P83221 1.74e-66 202 60 0 161 1 cyp18 Peptidyl-prolyl cis-trans isomerase cyp18 Streptomyces antibioticus
P42693 3.2e-62 192 58 1 162 3 rotA Peptidyl-prolyl cis-trans isomerase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q59641 3.33e-55 175 54 1 158 3 ppiA Peptidyl-prolyl cis-trans isomerase A Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0AFL3 1.7e-54 173 54 1 161 1 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli (strain K12)
P0AFL4 1.7e-54 173 54 1 161 3 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFL5 1.7e-54 173 54 1 161 3 ppiA Peptidyl-prolyl cis-trans isomerase A Escherichia coli O157:H7
P20753 3.07e-54 172 54 1 161 3 ppiA Peptidyl-prolyl cis-trans isomerase A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O53021 5.02e-54 172 53 1 161 3 rotA Peptidyl-prolyl cis-trans isomerase A Dickeya dadantii (strain 3937)
Q9LPC7 2.2e-26 100 38 6 166 2 CYP18-1 Peptidyl-prolyl cis-trans isomerase CYP18-1 Arabidopsis thaliana
Q54E95 7.11e-25 97 37 5 164 3 ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Dictyostelium discoideum
P0CP86 8.95e-25 97 37 6 166 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP87 8.95e-25 97 37 6 166 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q8W4D0 5.5e-22 94 38 6 167 1 CYP71 Peptidyl-prolyl cis-trans isomerase CYP71 Arabidopsis thaliana
Q49W93 2.51e-21 89 33 8 189 3 SSP1821 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5XAQ1 6.6e-21 91 36 9 187 1 M6_Spy1377 Putative bifunctional phosphatase/peptidyl-prolyl cis-trans isomerase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9D6L8 1.63e-20 85 32 6 165 1 Ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Mus musculus
Q9H2H8 2.25e-20 85 32 6 165 1 PPIL3 Peptidyl-prolyl cis-trans isomerase-like 3 Homo sapiens
Q812D3 2.9e-20 85 32 6 165 2 Ppil3 Peptidyl-prolyl cis-trans isomerase-like 3 Rattus norvegicus
Q8CT84 1.6e-19 84 33 7 187 3 SE_0648 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQK8 1.6e-19 84 33 7 187 3 SERP0540 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5ZLV2 1.75e-19 83 31 7 166 2 PPIL3 Peptidyl-prolyl cis-trans isomerase-like 3 Gallus gallus
P52017 1.81e-19 83 35 4 141 2 cyn-10 Peptidyl-prolyl cis-trans isomerase 10 Caenorhabditis elegans
Q7A1C0 2.59e-19 83 33 7 187 3 MW0836 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MW2)
Q6GAX2 2.59e-19 83 33 7 187 3 SAS0824 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MSSA476)
Q6GID4 2.59e-19 83 33 7 187 3 SAR0916 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain MRSA252)
Q7A6I1 2.59e-19 83 33 7 187 1 SA0815 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain N315)
Q99VD4 2.59e-19 83 33 7 187 3 SAV0954 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YWT2 2.59e-19 83 33 7 187 3 SAB0821 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2FZU9 2.59e-19 83 33 7 187 3 SAOUHSC_00891 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC1 2.59e-19 83 33 7 187 3 SAUSA300_0857 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain USA300)
P0CP90 5.68e-19 86 35 5 165 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP91 5.68e-19 86 35 5 165 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0C1I5 6.78e-19 81 32 7 181 3 cyp4 Peptidyl-prolyl cis-trans isomerase-like 3 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q5HHD1 1.18e-18 81 32 7 187 3 SACOL0957 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus aureus (strain COL)
Q4L4W9 8.24e-18 79 33 9 187 3 SH1997 Putative peptidyl-prolyl cis-trans isomerase Staphylococcus haemolyticus (strain JCSC1435)
Q13356 8.68e-18 82 35 5 164 1 PPIL2 RING-type E3 ubiquitin-protein ligase PPIL2 Homo sapiens
Q8G0J9 1.17e-17 79 34 4 164 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella suis biovar 1 (strain 1330)
Q8YHB5 1.17e-17 79 34 4 164 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57D43 1.32e-17 79 34 4 164 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella abortus biovar 1 (strain 9-941)
Q2YPY5 1.32e-17 79 34 4 164 3 ppi Probable peptidyl-prolyl cis-trans isomerase Brucella abortus (strain 2308)
Q9FJX0 1.64e-17 82 33 5 164 2 CYP65 Peptidyl-prolyl cis-trans isomerase CYP65 Arabidopsis thaliana
Q9D787 2.38e-17 81 33 5 164 1 Ppil2 RING-type E3 ubiquitin-protein ligase PPIL2 Mus musculus
O74942 3.85e-17 80 33 5 161 1 cyp9 Peptidyl-prolyl cis-trans isomerase 9 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ASS6 4.41e-17 79 37 7 155 1 PNSL5 Photosynthetic NDH subunit of lumenal location 5, chloroplastic Arabidopsis thaliana
Q4I1Y1 5.7e-17 76 29 6 168 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9NI62 1.31e-16 75 32 5 167 1 cypE Peptidyl-prolyl cis-trans isomerase cypE Dictyostelium discoideum
Q4IPB8 1.54e-16 75 31 8 183 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P87051 1.98e-16 75 32 8 167 1 ppi1 Peptidyl-prolyl cis-trans isomerase ppi1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WCM6 2.86e-16 75 36 6 163 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0C1J0 4.52e-16 77 37 5 142 3 cyp15 Peptidyl-prolyl cis-trans isomerase cyp15 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q8CEC6 4.72e-16 77 35 7 163 1 Ppwd1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Mus musculus
Q29RZ2 5e-16 77 35 7 164 2 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Bos taurus
P0C1I4 5.26e-16 73 35 6 145 3 cyp3 Peptidyl-prolyl cis-trans isomerase-like 1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P0C1J1 6.71e-16 77 35 7 159 3 cyp14 Peptidyl-prolyl cis-trans isomerase-like 2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9SIH1 1.12e-15 73 29 4 143 2 CYP18-2 Peptidyl-prolyl cis-trans isomerase CYP18-2 Arabidopsis thaliana
P9WHW3 1.49e-15 73 33 6 178 1 ppiA Peptidyl-prolyl cis-trans isomerase A Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHW2 1.49e-15 73 33 6 178 3 ppiA Peptidyl-prolyl cis-trans isomerase A Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65763 1.49e-15 73 33 6 178 3 ppiA Probable peptidyl-prolyl cis-trans isomerase A Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5AQL0 1.81e-15 73 33 6 163 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5XIB2 2.02e-15 75 40 3 111 1 Cwc27 Spliceosome-associated protein CWC27 homolog Rattus norvegicus
P21568 2.1e-15 72 36 5 150 1 CYP Peptidyl-prolyl cis-trans isomerase Solanum lycopersicum
Q4WE62 2.31e-15 75 30 5 160 3 cwc27 Peptidyl-prolyl isomerase cwc27 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q3TKY6 2.34e-15 75 40 3 111 1 Cwc27 Spliceosome-associated protein CWC27 homolog Mus musculus
Q96BP3 2.67e-15 75 34 7 164 1 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Homo sapiens
Q5NVL7 2.7e-15 75 34 7 164 2 PPWD1 Peptidylprolyl isomerase domain and WD repeat-containing protein 1 Pongo abelii
Q5AUG9 3.36e-15 75 31 5 160 3 cwc27 Peptidyl-prolyl isomerase cwc27 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q09928 3.95e-15 75 35 7 159 2 cyp8 Peptidyl-prolyl cis-trans isomerase cyp8 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4PCH8 4.42e-15 71 30 7 169 3 CYP10 Peptidyl-prolyl cis-trans isomerase-like 3 Ustilago maydis (strain 521 / FGSC 9021)
Q9CDE9 4.84e-15 72 32 6 178 3 ppiA Probable peptidyl-prolyl cis-trans isomerase A Mycobacterium leprae (strain TN)
Q6Q152 6.73e-15 74 34 2 118 1 CYP57 Peptidyl-prolyl cis-trans isomerase CYP57 Arabidopsis thaliana
Q9UA41 7.61e-15 71 32 5 164 1 cypD Peptidyl-prolyl cis-trans isomerase D, mitochondrial Dictyostelium discoideum
Q5R7W3 8.11e-15 73 39 3 111 2 CWC27 Spliceosome-associated protein CWC27 homolog Pongo abelii
Q6UX04 9.01e-15 73 39 3 111 1 CWC27 Spliceosome-associated protein CWC27 homolog Homo sapiens
Q4R713 9.11e-15 73 39 3 111 2 CWC27 Spliceosome-associated protein CWC27 homolog Macaca fascicularis
Q17QX9 9.2e-15 73 39 3 111 2 CWC27 Spliceosome-associated protein CWC27 homolog Bos taurus
P77949 9.79e-15 70 33 7 183 1 cypB Peptidyl-prolyl cis-trans isomerase B Streptomyces anulatus
Q39613 1e-14 70 36 5 151 1 PCKR1 Peptidyl-prolyl cis-trans isomerase Catharanthus roseus
P52012 1.01e-14 73 31 6 165 1 cyn-4 Peptidyl-prolyl cis-trans isomerase 4 Caenorhabditis elegans
P72704 1.14e-14 72 30 4 168 3 sll0227 Probable peptidyl-prolyl cis-trans isomerase sll0227 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0CP84 1.17e-14 70 30 6 168 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP85 1.17e-14 70 30 6 168 3 CYP1 Peptidyl-prolyl cis-trans isomerase-like 1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q2TZ33 1.46e-14 70 34 5 157 3 cyp3 Peptidyl-prolyl cis-trans isomerase H Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q4IPH4 1.49e-14 70 32 5 165 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6GLX7 1.89e-14 73 40 3 111 2 cwc27 Spliceosome-associated protein CWC27 homolog Xenopus laevis
Q7SF72 2.48e-14 69 28 7 169 3 ppi-1 Peptidyl-prolyl cis-trans isomerase-like 1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
O74729 2.79e-14 69 35 6 150 3 cyp3 Peptidyl-prolyl cis-trans isomerase cyp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9Y3C6 3.12e-14 69 31 6 160 1 PPIL1 Peptidyl-prolyl cis-trans isomerase-like 1 Homo sapiens
Q5E992 3.12e-14 69 31 6 160 2 PPIL1 Peptidyl-prolyl cis-trans isomerase-like 1 Bos taurus
Q9D0W5 3.29e-14 69 31 6 160 1 Ppil1 Peptidyl-prolyl cis-trans isomerase-like 1 Mus musculus
Q5B4R3 5.22e-14 69 35 7 157 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O93826 7.22e-14 69 36 7 155 2 CPR2 Peptidyl-prolyl cis-trans isomerase B Arthroderma benhamiae
D4AY02 7.22e-14 69 36 7 155 1 ARB_01071 Probable peptidyl-prolyl cis-trans isomerase ARB_01071 Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q4WMB6 7.67e-14 69 31 7 205 3 cyp10 Peptidyl-prolyl cis-trans isomerase-like 3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0C1J2 7.94e-14 71 38 4 115 3 cwc27 Peptidyl-prolyl isomerase cwc27 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9ZJH5 8.26e-14 68 34 5 140 3 ppiA Peptidyl-prolyl cis-trans isomerase Helicobacter pylori (strain J99 / ATCC 700824)
P52018 8.95e-14 68 38 6 147 2 cyn-11 Peptidyl-prolyl cis-trans isomerase 11 Caenorhabditis elegans
Q4WCR3 9.09e-14 68 28 6 168 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
O94273 9.73e-14 68 35 8 163 3 cyp4 Peptidyl-prolyl cis-trans isomerase B Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7SG06 1.08e-13 68 32 6 162 3 cyp-3 Peptidyl-prolyl cis-trans isomerase H Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7SBX8 1.1e-13 70 33 4 132 3 cwc-27 Peptidyl-prolyl isomerase cwc-27 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q5ASQ0 1.17e-13 67 27 6 173 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P18253 1.46e-13 67 34 7 156 3 ppi1 Peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O25982 1.69e-13 67 33 3 137 3 ppiA Peptidyl-prolyl cis-trans isomerase Helicobacter pylori (strain ATCC 700392 / 26695)
Q5BAH7 2.85e-13 67 32 1 123 3 cyp10 Peptidyl-prolyl cis-trans isomerase-like 3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P52014 3.29e-13 67 34 7 156 2 cyn-6 Peptidyl-prolyl cis-trans isomerase 6 Caenorhabditis elegans
O43447 3.82e-13 67 33 4 145 1 PPIH Peptidyl-prolyl cis-trans isomerase H Homo sapiens
Q0P5D0 3.82e-13 67 33 4 145 2 PPIH Peptidyl-prolyl cis-trans isomerase H Bos taurus
Q8SRE1 4.03e-13 66 36 6 135 1 CPR1 Peptidyl-prolyl cis-trans isomerase Encephalitozoon cuniculi (strain GB-M1)
O66105 4.3e-13 67 35 6 156 1 ppiB Probable peptidyl-prolyl cis-trans isomerase Treponema pallidum (strain Nichols)
P0CP88 5.39e-13 68 31 7 181 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP89 5.39e-13 68 31 7 181 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P54985 5.72e-13 66 36 6 139 2 CYPA Peptidyl-prolyl cis-trans isomerase Blattella germanica
Q5ARI5 6.92e-13 68 30 5 155 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8LDR3 8.92e-13 66 30 4 165 2 CYP23 Peptidyl-prolyl cis-trans isomerase CYP23 Arabidopsis thaliana
P22011 9.01e-13 65 32 6 152 1 CYP1 Peptidyl-prolyl cis-trans isomerase Candida albicans (strain SC5314 / ATCC MYA-2876)
Q2U6U0 1.1e-12 65 28 7 174 3 cyp1 Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q7ZW86 1.13e-12 67 36 3 111 2 cwc27 Spliceosome-associated protein CWC27 homolog Danio rerio
Q6MWS8 1.48e-12 65 29 9 171 3 cyp-10 Peptidyl-prolyl cis-trans isomerase-like 3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q41651 1.6e-12 66 34 5 141 1 None Peptidyl-prolyl cis-trans isomerase, chloroplastic Vicia faba
Q4G338 1.78e-12 67 35 6 139 1 None Peptidyl-prolyl cis-trans isomerase E Haemonchus contortus
Q8X166 2.17e-12 65 34 7 155 1 cypB Peptidyl-prolyl cis-trans isomerase B Aspergillus niger
Q8X191 2.32e-12 64 29 5 145 3 cypC Peptidyl-prolyl cis-trans isomerase-like 1 Aspergillus niger
Q7S7Z6 2.38e-12 66 35 7 155 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8LDP4 2.41e-12 65 32 6 162 1 CYP19-4 Peptidyl-prolyl cis-trans isomerase CYP19-4 Arabidopsis thaliana
Q4WAQ9 2.42e-12 67 31 7 155 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P35627 2.64e-12 64 32 6 162 2 None Peptidyl-prolyl cis-trans isomerase Unspecified eudicot DB-1992
Q4IPB3 2.93e-12 67 30 3 136 3 CWC27 Peptidyl-prolyl isomerase CWC27 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P0C1H7 3.03e-12 64 34 7 158 3 cyp2 Peptidyl-prolyl cis-trans isomerase A1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q4P555 3.81e-12 66 32 6 170 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Ustilago maydis (strain 521 / FGSC 9021)
Q4WP12 4.32e-12 64 34 7 155 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q2U256 4.74e-12 66 30 6 155 3 cyp6 Peptidyl-prolyl cis-trans isomerase-like 4 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B3A0R0 5.87e-12 64 33 7 156 1 None Putative peptidyl-prolyl cis-trans isomerase Lottia gigantea
Q9TW32 6.37e-12 63 31 5 146 1 cypB Peptidyl-prolyl cis-trans isomerase B Dictyostelium discoideum
P24369 8.12e-12 63 33 7 157 1 Ppib Peptidyl-prolyl cis-trans isomerase B Mus musculus
Q4P7H2 8.41e-12 65 31 5 170 3 CWC27 Peptidyl-prolyl isomerase CWC27 Ustilago maydis (strain 521 / FGSC 9021)
Q8L8W5 1.08e-11 63 31 5 162 2 CYP21-2 Peptidyl-prolyl cis-trans isomerase CYP21-2 Arabidopsis thaliana
P62936 1.09e-11 62 34 6 135 1 PPIA Peptidyl-prolyl cis-trans isomerase A Sus scrofa
P62935 1.09e-11 62 34 6 135 1 PPIA Peptidyl-prolyl cis-trans isomerase A Bos taurus
Q9V3G3 1.2e-11 64 34 7 158 1 cyp33 Peptidyl-prolyl cis-trans isomerase E Drosophila melanogaster
P0C1I0 1.25e-11 63 33 7 157 3 cyp9 Peptidyl-prolyl cis-trans isomerase B2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P52013 1.3e-11 63 33 7 156 1 cyn-5 Peptidyl-prolyl cis-trans isomerase 5 Caenorhabditis elegans
P0CP82 1.42e-11 62 33 5 149 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP83 1.42e-11 62 33 5 149 3 CYP3 Peptidyl-prolyl cis-trans isomerase H Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P14832 1.43e-11 62 33 6 139 1 CPR1 Peptidyl-prolyl cis-trans isomerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9D868 1.44e-11 62 32 4 140 1 Ppih Peptidyl-prolyl cis-trans isomerase H Mus musculus
Q01490 1.51e-11 63 34 7 157 1 CYPB Peptidyl-prolyl cis-trans isomerase B Orpinomyces sp. (strain PC-2)
Q9TTC6 1.93e-11 62 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Oryctolagus cuniculus
P10111 1.95e-11 62 34 6 135 1 Ppia Peptidyl-prolyl cis-trans isomerase A Rattus norvegicus
Q0ZQK6 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Symphalangus syndactylus
Q5R8S7 1.97e-11 62 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Pongo pygmaeus
P62941 1.97e-11 62 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Papio anubis
Q0ZQL1 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Pan troglodytes
Q0ZQL2 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Pan paniscus
Q0ZQK7 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Nomascus leucogenys
P62940 1.97e-11 62 34 6 135 1 PPIA Peptidyl-prolyl cis-trans isomerase A Macaca mulatta
Q0ZQK8 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Hylobates lar
P62937 1.97e-11 62 34 6 135 1 PPIA Peptidyl-prolyl cis-trans isomerase A Homo sapiens
Q0ZQL0 1.97e-11 62 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Gorilla gorilla gorilla
P62938 1.97e-11 62 34 6 135 1 PPIA Peptidyl-prolyl cis-trans isomerase A Chlorocebus aethiops
P0CP92 2.08e-11 64 38 4 106 3 CWC27 Peptidyl-prolyl isomerase CWC27 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CP93 2.08e-11 64 38 4 106 3 CWC27 Peptidyl-prolyl isomerase CWC27 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q4P6X6 2.58e-11 61 31 5 148 3 CYP3 Peptidyl-prolyl cis-trans isomerase H (Fragment) Ustilago maydis (strain 521 / FGSC 9021)
P29117 2.64e-11 62 35 6 137 1 Ppif Peptidyl-prolyl cis-trans isomerase F, mitochondrial Rattus norvegicus
P91791 2.84e-11 61 33 6 141 2 None Peptidyl-prolyl cis-trans isomerase Hemicentrotus pulcherrimus
P30405 3.53e-11 62 36 6 136 1 PPIF Peptidyl-prolyl cis-trans isomerase F, mitochondrial Homo sapiens
P30404 3.61e-11 62 35 6 137 1 PPIF Peptidyl-prolyl cis-trans isomerase F, mitochondrial Bos taurus
P35176 4.17e-11 62 33 8 169 1 CPR5 Peptidyl-prolyl cis-trans isomerase D Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q26516 4.3e-11 61 34 6 141 2 None Peptidyl-prolyl cis-trans isomerase E (Fragment) Schistosoma japonicum
Q42406 4.71e-11 61 32 5 149 1 CYP18-4 Peptidyl-prolyl cis-trans isomerase CYP18-4 Arabidopsis thaliana
Q0ZQK3 4.84e-11 60 34 6 135 3 PPIA Peptidyl-prolyl cis-trans isomerase A Saguinus oedipus
Q6DTV9 4.84e-11 60 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Aotus trivirgatus
Q4IBK5 5.76e-11 63 29 6 164 3 CYP8 Peptidyl-prolyl cis-trans isomerase-like 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q8HXS3 5.77e-11 60 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Felis catus
P14851 5.77e-11 60 34 6 135 2 PPIA Peptidyl-prolyl cis-trans isomerase A Cricetulus griseus
Q54SM3 5.93e-11 61 33 5 146 1 ppiA Peptidyl-prolyl cis-trans isomerase A Dictyostelium discoideum
P17742 6.08e-11 60 34 6 135 1 Ppia Peptidyl-prolyl cis-trans isomerase A Mus musculus
P25007 6.22e-11 61 36 6 136 1 Cyp1 Peptidyl-prolyl cis-trans isomerase Drosophila melanogaster
Q99KR7 6.37e-11 61 35 6 137 1 Ppif Peptidyl-prolyl cis-trans isomerase F, mitochondrial Mus musculus
Q871A4 7.55e-11 62 29 7 165 3 cyp-6 Peptidyl-prolyl cis-trans isomerase-like 4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9SKQ0 7.61e-11 60 31 4 146 2 CYP19-2 Peptidyl-prolyl cis-trans isomerase CYP19-2 Arabidopsis thaliana
Q4I5R9 7.88e-11 61 31 8 174 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q27774 7.9e-11 61 34 5 147 2 None Peptidyl-prolyl cis-trans isomerase B Schistosoma japonicum
P21569 7.92e-11 60 32 4 146 2 CYP Peptidyl-prolyl cis-trans isomerase Zea mays
P23284 8.03e-11 61 32 7 157 1 PPIB Peptidyl-prolyl cis-trans isomerase B Homo sapiens
P80311 8.03e-11 61 34 8 158 1 PPIB Peptidyl-prolyl cis-trans isomerase B Bos taurus
Q9C566 8.7e-11 62 32 7 164 2 CYP40 Peptidyl-prolyl cis-trans isomerase CYP40 Arabidopsis thaliana
Q26548 9.01e-11 62 35 6 139 1 None Peptidyl-prolyl cis-trans isomerase E Schistosoma mansoni
P0C1I9 9.03e-11 62 32 7 163 3 cyp11 Peptidyl-prolyl cis-trans isomerase cyp11 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q9SP02 9.26e-11 60 31 6 162 1 CYP20-1 Peptidyl-prolyl cis-trans isomerase CYP20-1 Arabidopsis thaliana
Q8W171 9.45e-11 60 31 4 147 2 Cyp1 Peptidyl-prolyl cis-trans isomerase 1 Glycine max
P0C1I8 9.68e-11 60 30 5 150 3 cyp6 Peptidyl-prolyl cis-trans isomerase cyp6 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q6CGK4 9.95e-11 62 33 2 112 3 CWC27 Peptidyl-prolyl isomerase CWC27 Yarrowia lipolytica (strain CLIB 122 / E 150)
P34887 1.02e-10 59 33 4 141 2 CYP Peptidyl-prolyl cis-trans isomerase Allium cepa
P0C1I3 1.06e-10 60 31 6 161 3 cyp7 Peptidyl-prolyl cis-trans isomerase H Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P84343 1.39e-10 60 36 3 105 1 None Peptidyl-prolyl cis-trans isomerase Neospora caninum
P24368 1.67e-10 60 33 7 155 1 Ppib Peptidyl-prolyl cis-trans isomerase B Rattus norvegicus
P34791 1.74e-10 60 32 6 155 1 CYP20-3 Peptidyl-prolyl cis-trans isomerase CYP20-3, chloroplastic Arabidopsis thaliana
P0DN37 1.97e-10 59 32 5 134 1 PPIAL4G Peptidyl-prolyl cis-trans isomerase A-like 4G Homo sapiens
A0A0B4J2A2 2.19e-10 59 32 5 134 2 PPIAL4C Peptidyl-prolyl cis-trans isomerase A-like 4C Homo sapiens
P0DN26 2.35e-10 59 32 5 134 3 PPIAL4F Peptidyl-prolyl cis-trans isomerase A-like 4F Homo sapiens
A0A075B759 2.35e-10 59 32 5 134 3 PPIAL4E Peptidyl-prolyl cis-trans isomerase A-like 4E Homo sapiens
F5H284 2.5e-10 59 32 5 131 3 PPIAL4D Peptidyl-prolyl cis-trans isomerase A-like 4D Homo sapiens
P24525 2.65e-10 59 31 4 145 2 CYP Peptidyl-prolyl cis-trans isomerase Brassica napus
P34790 2.98e-10 58 31 4 146 1 CYP18-3 Peptidyl-prolyl cis-trans isomerase CYP18-3 Arabidopsis thaliana
P0C1H9 3.23e-10 59 33 7 157 3 cyp8 Peptidyl-prolyl cis-trans isomerase B1 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P52016 3.41e-10 60 31 3 145 2 cyn-8 Peptidyl-prolyl cis-trans isomerase 8 Caenorhabditis elegans
P24367 3.95e-10 59 33 7 157 2 PPIB Peptidyl-prolyl cis-trans isomerase B Gallus gallus
Q2UGK2 3.96e-10 58 32 6 144 3 cpr2 Peptidyl-prolyl cis-trans isomerase B Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q6C4W6 4.01e-10 59 34 8 159 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Yarrowia lipolytica (strain CLIB 122 / E 150)
O49886 4.85e-10 58 31 4 147 2 None Peptidyl-prolyl cis-trans isomerase Lupinus luteus
O00060 6.39e-10 58 34 6 144 2 PIG28 Peptidyl-prolyl cis-trans isomerase Uromyces fabae
P0C1I6 7.62e-10 59 30 8 179 3 cyp13 Peptidyl-prolyl cis-trans isomerase-like 4 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P29820 7.86e-10 57 39 3 98 3 rot Peptidyl-prolyl cis-trans isomerase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q26565 8.52e-10 57 31 7 154 1 None Peptidyl-prolyl cis-trans isomerase Schistosoma mansoni
O42941 8.56e-10 59 46 0 52 1 cyp7 Peptidylprolyl isomerase cyp7 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A075B767 8.6e-10 57 31 5 134 1 PPIAL4H Peptidyl-prolyl cis-trans isomerase A-like 4H Homo sapiens
O49605 9.85e-10 58 30 5 162 2 CYP21-1 Peptidyl-prolyl cis-trans isomerase CYP21-1 Arabidopsis thaliana
P23285 1.12e-09 58 36 8 141 1 CPR2 Peptidyl-prolyl cis-trans isomerase B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9UNP9 1.13e-09 58 31 7 155 1 PPIE Peptidyl-prolyl cis-trans isomerase E Homo sapiens
P30412 1.14e-09 58 34 6 141 1 Ppic Peptidyl-prolyl cis-trans isomerase C Mus musculus
Q8IXY8 1.23e-09 58 28 6 146 1 PPIL6 Probable inactive peptidyl-prolyl cis-trans isomerase-like 6 Homo sapiens
P0C1H8 1.26e-09 57 30 6 152 3 cyp1 Peptidyl-prolyl cis-trans isomerase A2 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q5R723 1.35e-09 58 31 7 155 2 PPIE Peptidyl-prolyl cis-trans isomerase E Pongo abelii
P14088 1.41e-09 57 33 6 152 2 CYP-1 Peptidyl-prolyl cis-trans isomerase Echinococcus granulosus
Q9LY75 1.76e-09 58 34 5 145 1 CYP63 Peptidyl-prolyl cis-trans isomerase CYP63 Arabidopsis thaliana
Q4IE79 1.79e-09 58 30 6 156 3 CYP6 Peptidyl-prolyl cis-trans isomerase-like 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9QZH3 2.68e-09 57 30 7 155 1 Ppie Peptidyl-prolyl cis-trans isomerase E Mus musculus
Q9ERU9 2.82e-09 58 30 6 139 1 Ranbp2 E3 SUMO-protein ligase RanBP2 Mus musculus
Q26551 2.86e-09 57 31 6 162 2 CYP Peptidyl-prolyl cis-trans isomerase B Schistosoma mansoni
P52015 3e-09 56 29 7 166 1 cyn-7 Peptidyl-prolyl cis-trans isomerase 7 Caenorhabditis elegans
Q5U8Z7 3.02e-09 58 28 4 161 2 Cyp40 Peptidyl-prolyl cis-trans isomerase D Amanita muscaria
Q38900 3.03e-09 56 31 5 146 1 CYP19-1 Peptidyl-prolyl cis-trans isomerase CYP19-1 Arabidopsis thaliana
Q1RMP7 3.4e-09 57 28 6 146 2 PPIL6 Probable inactive peptidyl-prolyl cis-trans isomerase-like 6 Bos taurus
Q5B4E7 3.7e-09 57 31 5 161 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q94A16 4.27e-09 56 28 4 160 2 CYP21-3 Peptidyl-prolyl cis-trans isomerase CYP21-3, mitochondrial Arabidopsis thaliana
P52009 4.34e-09 56 32 7 150 2 cyn-1 Peptidyl-prolyl cis-trans isomerase 1 Caenorhabditis elegans
A4FV72 4.41e-09 57 30 7 156 2 PPIE Peptidyl-prolyl cis-trans isomerase E Bos taurus
Q7RXA6 6.04e-09 57 28 7 172 3 ppi-2 Peptidyl-prolyl cis-trans isomerase-like 2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P25719 7.3e-09 55 30 7 158 1 CPR3 Peptidyl-prolyl cis-trans isomerase C, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P73789 7.72e-09 55 30 5 143 1 slr1251 Peptidyl-prolyl cis-trans isomerase slr1251 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P28517 9.84e-09 55 32 5 156 2 NINAA Peptidyl-prolyl cis-trans isomerase, rhodopsin-specific isozyme Calliphora vicina
Q6BXZ7 9.93e-09 56 27 4 163 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P30415 1.06e-08 56 28 4 146 1 Nktr NK-tumor recognition protein Mus musculus
H2QII6 1.14e-08 56 30 6 139 1 RANBP2 E3 SUMO-protein ligase RanBP2 Pan troglodytes
Q9CXG3 1.15e-08 56 27 7 180 1 Ppil4 Peptidyl-prolyl cis-trans isomerase-like 4 Mus musculus
Q4HXF6 1.28e-08 56 29 7 169 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q38867 1.29e-08 54 29 5 162 2 CYP19-3 Peptidyl-prolyl cis-trans isomerase CYP19-3 Arabidopsis thaliana
Q8WUA2 1.58e-08 55 26 7 180 1 PPIL4 Peptidyl-prolyl cis-trans isomerase-like 4 Homo sapiens
Q9Y536 1.59e-08 54 33 6 135 1 PPIAL4A Peptidyl-prolyl cis-trans isomerase A-like 4A Homo sapiens
Q6Q151 1.64e-08 55 30 4 141 1 CYP59 Peptidyl-prolyl cis-trans isomerase CYP59 Arabidopsis thaliana
Q5AXT6 1.72e-08 55 33 4 116 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P30414 1.77e-08 56 28 4 146 1 NKTR NK-tumor recognition protein Homo sapiens
O00845 1.8e-08 53 30 5 152 3 None Peptidyl-prolyl cis-trans isomerase Paramecium primaurelia
Q09637 1.89e-08 55 32 4 141 2 cyn-9 Peptidyl-prolyl cis-trans isomerase 9 Caenorhabditis elegans
P0CP78 2.16e-08 54 32 7 161 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q4WVU5 2.29e-08 55 34 4 105 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P0CP79 2.35e-08 54 32 7 161 3 CPR2 Peptidyl-prolyl cis-trans isomerase B Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0C1I7 2.41e-08 53 30 5 146 3 cyp5 Peptidyl-prolyl cis-trans isomerase cyp5 Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
Q2U5W8 2.64e-08 55 33 3 105 3 cyp8 Peptidyl-prolyl cis-trans isomerase-like 2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5ACI8 2.96e-08 55 28 4 165 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9ZVJ4 3.18e-08 53 31 6 149 2 CYP22 Peptidyl-prolyl cis-trans isomerase CYP22 Arabidopsis thaliana
Q6CBP4 3.19e-08 55 29 6 162 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Yarrowia lipolytica (strain CLIB 122 / E 150)
Q08E11 3.37e-08 54 33 6 141 2 PPIC Peptidyl-prolyl cis-trans isomerase C Bos taurus
Q9P3X9 3.57e-08 54 29 4 161 1 cyp41 41 kDa peptidyl-prolyl cis-trans isomerase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4P0V4 3.87e-08 54 29 6 168 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Ustilago maydis (strain 521 / FGSC 9021)
P52011 3.97e-08 53 31 8 166 1 cyn-3 Peptidyl-prolyl cis-trans isomerase 3 Caenorhabditis elegans
Q4WIF3 4.3e-08 54 30 4 160 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q27450 4.44e-08 54 28 4 162 1 CYP-1 Peptidyl-prolyl cis-trans isomerase 1 Brugia malayi
P15425 4.57e-08 53 28 5 159 1 ninaA Peptidyl-prolyl cis-trans isomerase, rhodopsin-specific isozyme Drosophila melanogaster
P0C1I2 8.64e-08 53 31 7 155 3 cyp10 Peptidyl-prolyl cis-trans isomerase E Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P45877 9.46e-08 52 32 6 141 1 PPIC Peptidyl-prolyl cis-trans isomerase C Homo sapiens
Q06118 1.45e-07 51 34 8 146 1 ppiA Peptidyl-prolyl cis-trans isomerase A Streptomyces anulatus
P0C1I1 1.59e-07 53 29 5 161 3 cyp12 Peptidyl-prolyl cis-trans isomerase D Rhizopus delemar (strain RA 99-880 / ATCC MYA-4621 / FGSC 9543 / NRRL 43880)
P49792 1.83e-07 53 30 6 139 1 RANBP2 E3 SUMO-protein ligase RanBP2 Homo sapiens
Q9D6D8 1.91e-07 52 26 6 146 1 Ppil6 Probable inactive peptidyl-prolyl cis-trans isomerase-like 6 Mus musculus
P52010 2.08e-07 51 29 5 157 2 cyn-2 Peptidyl-prolyl cis-trans isomerase 2 Caenorhabditis elegans
P35137 3.09e-07 50 30 2 121 1 ppiB Peptidyl-prolyl cis-trans isomerase B Bacillus subtilis (strain 168)
P47103 3.25e-07 52 28 7 192 1 CPR7 Peptidyl-prolyl cis-trans isomerase CYP7 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9CR16 3.43e-07 52 29 5 145 1 Ppid Peptidyl-prolyl cis-trans isomerase D Mus musculus
Q6DGG0 4.07e-07 52 29 5 145 1 Ppid Peptidyl-prolyl cis-trans isomerase D Rattus norvegicus
A8X8D0 4.29e-07 51 31 4 139 2 cyn-9 Peptidyl-prolyl cis-trans isomerase 9 Caenorhabditis briggsae
Q75A33 4.69e-07 51 27 5 168 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P48820 6.48e-07 51 31 7 140 2 RANBP2 E3 SUMO-protein ligase RanBP2 (Fragment) Bos taurus
P10255 7.41e-07 50 30 6 141 1 csr-1 Peptidyl-prolyl cis-trans isomerase, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q2U0E0 1.1e-06 50 29 5 149 3 cpr6 Peptidyl-prolyl cis-trans isomerase D Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9UUE4 2.62e-06 49 27 7 179 1 cyp6 Peptidyl-prolyl cis-trans isomerase cyp6 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9C835 3.03e-06 48 25 3 140 2 CYP21-4 Peptidyl-prolyl cis-trans isomerase CYP21-4 Arabidopsis thaliana
Q6FNU6 4.18e-06 48 29 4 150 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P26882 6.91e-06 48 29 5 139 1 PPID Peptidyl-prolyl cis-trans isomerase D Bos taurus
A2AR02 8.02e-06 48 26 3 146 1 Ppig Peptidyl-prolyl cis-trans isomerase G Mus musculus
O55035 8.82e-06 48 26 3 146 1 Ppig Peptidyl-prolyl cis-trans isomerase G Rattus norvegicus
Q13427 9.7e-06 48 26 3 146 1 PPIG Peptidyl-prolyl cis-trans isomerase G Homo sapiens
P9WHW1 1.32e-05 47 27 9 178 1 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHW0 1.32e-05 47 27 9 178 3 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q08752 1.44e-05 47 29 5 138 1 PPID Peptidyl-prolyl cis-trans isomerase D Homo sapiens
Q6CL78 6.77e-05 45 42 2 59 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q11004 7.34e-05 45 27 4 140 2 wis2 40 kDa peptidyl-prolyl cis-trans isomerase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P0CP81 0.000128 44 25 5 165 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P46697 0.000227 43 26 7 176 3 ppiB Probable peptidyl-prolyl cis-trans isomerase B Mycobacterium leprae (strain TN)
G5EEW6 0.000258 43 23 5 146 1 sig-7 Peptidyl-prolyl cis-trans isomerase sig-7 Caenorhabditis elegans
P0CP80 0.00037 43 25 5 165 3 CPR6 Peptidyl-prolyl cis-trans isomerase D Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10640
Feature type CDS
Gene ppiB
Product peptidylprolyl isomerase B
Location 2340288 - 2340782 (strand: 1)
Length 495 (nucleotides) / 164 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_916
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00160 Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0652 Posttranslational modification, protein turnover, chaperones (O) O Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family

Protein Sequence

MVTFHTNYGDIVIKTFADKAPATVENFLDYCKEGFYDNTIFHRVINGFMIQGGGFEPGMKQKETKAPVRNEANNGLANNRGTLAMARTNDPHSATAQFFINVADNDFLNFRAENANGWGYCVFAEVVEGMDVVDKIKAVSTGRSGFHQDVPREDIIINSVTVSE

Flanking regions ( +/- flanking 50bp)

TTGTTTCAGCCCACATCTGGGTAAAACTAAAATTATACTAGGATCTGAATATGGTTACTTTTCATACCAATTACGGCGATATCGTGATTAAAACATTTGCAGATAAAGCACCTGCAACCGTAGAAAATTTTTTAGATTACTGTAAAGAAGGGTTCTACGATAACACTATCTTCCACCGTGTTATTAATGGTTTTATGATCCAAGGTGGTGGTTTTGAACCTGGTATGAAGCAAAAAGAAACTAAAGCCCCGGTAAGAAACGAAGCAAACAACGGTCTTGCCAATAATCGTGGTACATTAGCGATGGCTCGTACCAACGATCCACATTCTGCAACAGCACAATTCTTTATCAACGTAGCAGATAACGACTTCTTAAACTTCCGTGCAGAAAATGCCAATGGTTGGGGATATTGTGTATTTGCTGAAGTTGTTGAAGGAATGGATGTTGTAGACAAAATCAAAGCCGTTTCTACTGGTCGCAGTGGTTTCCACCAAGATGTTCCTCGTGAAGATATTATCATTAACAGTGTTACTGTTAGCGAATAAGTAGCGCTTTTTATGTGCACCCTGTTTATTGCAGATCTGCATTTAAGTGA