Homologs in group_55

Help

13 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14715 FBDBKF_14715 35.7 Morganella morganii S1 fabG 3-oxoacyl-ACP reductase FabG
EHELCC_15520 EHELCC_15520 35.7 Morganella morganii S2 fabG 3-oxoacyl-ACP reductase FabG
NLDBIP_16050 NLDBIP_16050 35.7 Morganella morganii S4 fabG 3-oxoacyl-ACP reductase FabG
LHKJJB_15790 LHKJJB_15790 35.7 Morganella morganii S3 fabG 3-oxoacyl-ACP reductase FabG
HKOGLL_14910 HKOGLL_14910 35.7 Morganella morganii S5 fabG 3-oxoacyl-ACP reductase FabG
F4V73_RS04350 F4V73_RS04350 33.6 Morganella psychrotolerans - SDR family oxidoreductase
F4V73_RS07510 F4V73_RS07510 35.7 Morganella psychrotolerans fabG 3-oxoacyl-ACP reductase FabG
F4V73_RS12010 F4V73_RS12010 31.4 Morganella psychrotolerans - 3-ketoacyl-ACP reductase FabG2
PMI_RS04225 PMI_RS04225 36.1 Proteus mirabilis HI4320 fabG 3-oxoacyl-ACP reductase FabG
PMI_RS07455 PMI_RS07455 32.4 Proteus mirabilis HI4320 - glucose 1-dehydrogenase
PMI_RS11200 PMI_RS11200 30.0 Proteus mirabilis HI4320 - SDR family oxidoreductase
PMI_RS14395 PMI_RS14395 28.7 Proteus mirabilis HI4320 - SDR family NAD(P)-dependent oxidoreductase
PMI_RS14870 PMI_RS14870 31.3 Proteus mirabilis HI4320 - D-threitol dehydrogenase

Distribution of the homologs in the orthogroup group_55

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_55

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q05528 1.23e-130 372 70 0 251 1 kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Dickeya dadantii (strain 3937)
P37769 8.92e-129 367 69 0 251 1 kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Escherichia coli (strain K12)
P50842 8.09e-86 258 54 4 251 2 kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Bacillus subtilis (strain 168)
Q15SS0 3.73e-79 241 49 2 251 1 Patl_2552 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P76633 2.99e-71 222 44 2 252 3 ygcW Uncharacterized oxidoreductase YgcW Escherichia coli (strain K12)
P0A9P9 9.68e-64 202 43 2 250 1 idnO 5-keto-D-gluconate 5-reductase Escherichia coli (strain K12)
P0A9Q0 9.68e-64 202 43 2 250 3 idnO 5-keto-D-gluconate 5-reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
T2KLZ8 1.25e-62 200 44 5 259 2 kduD 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
P50199 1.14e-57 187 41 2 248 1 gno Gluconate 5-dehydrogenase Gluconobacter oxydans (strain 621H)
P51831 2.28e-53 176 38 3 247 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Bacillus subtilis (strain 168)
Q9X248 3.55e-51 170 39 4 246 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O67610 2.14e-49 165 36 4 248 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Aquifex aeolicus (strain VF5)
Q9KQH7 1.84e-46 157 36 4 245 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P55336 7.16e-46 156 35 3 245 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Vibrio harveyi
Q8CPI3 1.18e-45 155 38 5 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPW0 1.18e-45 155 38 5 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9Z8P2 4.34e-45 154 37 3 244 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia pneumoniae
P28643 6.59e-45 156 38 4 242 2 CLKR27 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic Cuphea lanceolata
Q949M3 8.29e-45 155 36 4 242 2 bkr3 3-oxoacyl-[acyl-carrier-protein] reductase 3, chloroplastic Brassica napus
P0A0I0 9.93e-45 153 37 4 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MW2)
Q6G9Y2 9.93e-45 153 37 4 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MSSA476)
Q6GHK4 9.93e-45 153 37 4 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain MRSA252)
P99093 9.93e-45 153 37 4 243 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain N315)
P0A0H9 9.93e-45 153 37 4 243 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGK2 9.93e-45 153 37 4 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Staphylococcus aureus (strain COL)
Q93X67 1.04e-44 155 37 4 242 2 bkr2 3-oxoacyl-[acyl-carrier-protein] reductase 2, chloroplastic Brassica napus
Q93X62 1.1e-44 155 36 4 242 1 gbkr1 3-oxoacyl-[acyl-carrier-protein] reductase 1, chloroplastic Brassica napus
Q93X68 3.42e-44 154 36 4 243 2 bkr1 3-oxoacyl-[acyl-carrier-protein] reductase 5, chloroplastic (Fragment) Brassica napus
P43713 2.75e-43 149 35 5 243 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K9J5 5.98e-43 149 34 5 246 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9PKF7 8.91e-43 148 36 4 245 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia muridarum (strain MoPn / Nigg)
Q949M2 2.02e-42 147 36 5 242 2 bkr4 3-oxoacyl-[acyl-carrier-protein] reductase 4 (Fragment) Brassica napus
P38004 2.22e-42 147 37 5 247 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P0AEK3 2.9e-42 147 34 3 245 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Shigella flexneri
P0AEK2 2.9e-42 147 34 3 245 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Escherichia coli (strain K12)
P0A2C9 4.81e-42 146 33 3 245 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D0 4.81e-42 146 33 3 245 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Salmonella typhi
P50941 8.54e-42 145 34 6 251 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia prowazekii (strain Madrid E)
C8WGQ3 1.45e-41 145 34 4 252 1 Elen_1325 3beta-hydroxysteroid dehydrogenase 2 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q68VY7 1.46e-41 145 34 5 249 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P73574 1.81e-41 145 38 4 248 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9KJF1 2.01e-41 145 36 5 242 1 bbsD (2S)-[(R)-hydroxy(phenyl)methyl]succinyl-CoA dehydrogenase subunit BbsD Thauera aromatica
Q92EU6 4.73e-41 144 35 4 246 1 golD NAD-dependent glycerol dehydrogenase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
O54438 1.08e-40 143 36 3 246 1 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P17611 1.17e-40 143 35 3 245 3 nodG Nodulation protein G Azospirillum brasilense
P72332 3.62e-40 141 35 3 245 3 nodG Nodulation protein G Rhizobium sp. (strain N33)
Q9HK58 4.08e-40 142 31 3 252 1 rhaD L-rhamnose 1-dehydrogenase (NADP(+)) Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
P33207 2.67e-39 141 34 4 242 1 At1g24360 3-oxoacyl-[acyl-carrier-protein] reductase, chloroplastic Arabidopsis thaliana
Q89AG9 3.87e-39 139 34 5 246 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P33368 4.87e-39 139 34 3 247 1 yohF Uncharacterized oxidoreductase YohF Escherichia coli (strain K12)
P57432 2.26e-38 137 34 3 244 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P06234 6.33e-38 135 34 3 246 3 nodG Nodulation protein G Rhizobium meliloti (strain 1021)
Q92RN6 7.71e-38 136 33 3 246 3 galD Probable galactose dehydrogenase GalD Rhizobium meliloti (strain 1021)
A9CES4 4.84e-37 134 35 4 257 1 Atu3164 Galactitol 2-dehydrogenase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9WYG0 7.36e-37 133 33 5 254 3 TM_0325 Uncharacterized oxidoreductase TM_0325 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q4UK62 8.02e-37 133 35 6 251 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92GE0 1.04e-36 132 35 6 251 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia conorii (strain ATCC VR-613 / Malish 7)
O34717 3.11e-36 132 35 6 249 2 fadH Probable 2,4-dienoyl-CoA reductase [(2E)-enoyl-CoA-producing] Bacillus subtilis (strain 168)
Q92506 3.87e-36 132 34 5 255 1 HSD17B8 (3R)-3-hydroxyacyl-CoA dehydrogenase Homo sapiens
Q9X6U2 1.14e-35 130 31 3 258 3 hbdH1 D-beta-hydroxybutyrate dehydrogenase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O07575 1.96e-35 130 34 4 246 3 yhdF Uncharacterized oxidoreductase YhdF Bacillus subtilis (strain 168)
A0A5B8YU81 2.02e-35 130 33 6 264 2 GME11373 Short-chain dehydrogenase/reductase GME11373 Pestalotiopsis microspora
Q5TJF5 3.34e-35 129 33 5 254 3 HSD17B8 (3R)-3-hydroxyacyl-CoA dehydrogenase Canis lupus familiaris
A0A2H3D8Y2 3.36e-35 129 32 2 251 1 ARMGADRAFT_1018421 Short-chain dehydrogenase/reductase ARMGADRAFT_1018421 Armillaria gallica
Q1RKB7 4.09e-35 128 35 6 251 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Rickettsia bellii (strain RML369-C)
A7B3K3 4.71e-35 128 35 4 250 1 baiA 3alpha-hydroxysteroid dehydrogenase Mediterraneibacter gnavus (strain ATCC 29149 / DSM 114966 / JCM 6515 / VPI C7-9)
Q9ZNN8 5.98e-35 128 36 3 254 1 budC L-2,3-butanediol dehydrogenase Corynebacterium glutamicum
Q9GKX2 1.24e-34 127 34 4 250 1 DHRS4 Dehydrogenase/reductase SDR family member 4 (Fragment) Oryctolagus cuniculus
Q59787 1.36e-34 127 34 3 255 1 polS Sorbitol dehydrogenase Cereibacter sphaeroides
P0A2D1 1.85e-34 127 36 8 257 3 ucpA Oxidoreductase UcpA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D2 1.85e-34 127 36 8 257 3 ucpA Oxidoreductase UcpA Salmonella typhi
Q5HKG6 1.99e-34 127 34 3 255 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P12310 2.26e-34 127 33 1 246 2 gdh Glucose 1-dehydrogenase Bacillus subtilis (strain 168)
P0DXE1 2.61e-34 126 35 4 244 1 chcB2 Cis-4-hydroxycyclohexanecarboxylate dehydrogenase Corynebacterium cyclohexanicum
Q8CQD2 3.64e-34 126 34 3 255 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q08632 3.73e-34 127 34 5 256 2 None Short-chain type dehydrogenase/reductase Picea abies
P39484 3.76e-34 126 32 1 246 3 gdhIII Glucose 1-dehydrogenase 3 Priestia megaterium
P39485 8e-34 125 32 1 246 1 gdhIV Glucose 1-dehydrogenase 4 Priestia megaterium
Q5RCF8 8.04e-34 126 34 4 250 2 DHRS4 Dehydrogenase/reductase SDR family member 4 Pongo abelii
P10528 8.62e-34 125 32 1 246 3 gdhA Glucose 1-dehydrogenase A Priestia megaterium
Q6MGB5 8.76e-34 125 33 6 256 1 Hsd17b8 (3R)-3-hydroxyacyl-CoA dehydrogenase Rattus norvegicus
Q8SPU8 1.01e-33 125 34 4 250 2 DHRS4 Dehydrogenase/reductase SDR family member 4 Bos taurus
Q5P5I4 1.2e-33 125 35 4 247 1 ped (S)-1-Phenylethanol dehydrogenase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
P80869 1.31e-33 125 32 7 253 1 ycdF Glucose 1-dehydrogenase 2 Bacillus subtilis (strain 168)
Q8WNV7 1.55e-33 125 32 3 249 1 DHRS4 Dehydrogenase/reductase SDR family member 4 Sus scrofa
C0KTJ6 1.74e-33 124 34 4 252 1 None Galactitol 2-dehydrogenase (L-tagatose-forming) Cereibacter sphaeroides
Q9BTZ2 1.92e-33 125 34 4 250 1 DHRS4 Dehydrogenase/reductase SDR family member 4 Homo sapiens
P39483 1.93e-33 124 32 1 246 3 gdhII Glucose 1-dehydrogenase 2 Priestia megaterium
G5EGA6 2.14e-33 124 34 5 258 1 dhrs-4 Dehydrogenase/reductase SDR family member 4 Caenorhabditis elegans
P57793 2.3e-33 125 32 6 267 1 SAMN02910417_01454 Phloroglucinol reductase Eubacterium oxidoreducens
P71079 2.47e-33 124 36 7 248 1 fabL Enoyl-[acyl-carrier-protein] reductase [NADPH] FabL Bacillus subtilis (strain 168)
P14697 4.15e-33 123 31 3 245 1 phaB Acetoacetyl-CoA reductase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1JP75 4.31e-33 123 31 2 245 2 DCXR L-xylulose reductase Bos taurus
P50203 4.75e-33 123 34 4 243 3 phaB Acetoacetyl-CoA reductase Acinetobacter sp. (strain RA3849)
Q8KWT4 6.63e-33 123 29 3 256 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus subtilis
Q94KL7 9.88e-33 123 33 7 252 1 None Secoisolariciresinol dehydrogenase (Fragment) Forsythia intermedia
P80873 1.05e-32 123 34 5 246 1 ydaD General stress protein 39 Bacillus subtilis (strain 168)
Q920P0 1.95e-32 121 31 2 245 1 Dcxr L-xylulose reductase Rattus norvegicus
I6YCF0 2.34e-32 122 33 7 253 1 ipdF (5R,7aS)-5-hydroxy-7a-methyl-1-oxo-2,3,5,6,7,7a-hexahydro-1H-indene-carboxyl-CoA reductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
C8WJW0 2.52e-32 122 36 1 246 1 Elen_0198 3beta-hydroxysteroid dehydrogenase 1 Eggerthella lenta (strain ATCC 25559 / DSM 2243 / CCUG 17323 / JCM 9979 / KCTC 3265 / NCTC 11813 / VPI 0255 / 1899 B)
Q988B7 2.6e-32 121 33 2 242 1 pldh-t Pyridoxal 4-dehydrogenase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P40288 2.95e-32 121 32 2 247 1 None Glucose 1-dehydrogenase Priestia megaterium
E9ET40 2.99e-32 122 32 5 258 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
P39482 3.18e-32 121 31 1 246 2 gdhI Glucose 1-dehydrogenase 1 Priestia megaterium
Q2UEK6 3.25e-32 121 35 5 255 2 astEA Short chain dehydrogenase/reductase astE Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q48436 3.46e-32 121 33 3 252 1 budC Diacetyl reductase [(S)-acetoin forming] Klebsiella pneumoniae
P40397 3.66e-32 122 34 5 249 3 yhxC Uncharacterized oxidoreductase YhxC Bacillus subtilis (strain 168)
Q9L9F8 3.86e-32 121 36 5 246 1 novJ Short-chain reductase protein NovJ Streptomyces niveus
Q9RPT1 5.76e-32 120 34 5 252 1 rhlG Rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q91X52 5.77e-32 120 31 2 245 1 Dcxr L-xylulose reductase Mus musculus
Q8JIS3 5.92e-32 120 30 2 246 1 DER D-erythrulose reductase Gallus gallus
A0A0B4GU97 6.07e-32 121 32 7 259 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium guizhouense (strain ARSEF 977)
Q9URX0 7e-32 120 31 5 251 3 SPAC922.06 Uncharacterized oxidoreductase C922.06 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P94681 7.13e-32 120 32 5 256 1 tsaC1 4-formylbenzenesulfonate dehydrogenase TsaC1/TsaC2 Comamonas testosteroni
P9WGQ5 9.31e-32 120 33 3 251 1 Rv0927c Uncharacterized oxidoreductase Rv0927c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ4 9.31e-32 120 33 3 251 3 MT0954 Uncharacterized oxidoreductase MT0954 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0B4FP77 9.38e-32 120 32 5 257 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium brunneum (strain ARSEF 3297)
A0R518 9.42e-32 120 31 5 276 1 MSMEG_6031 Putative short-chain type dehydrogenase/reductase MSMEG_6031/MSMEI_5872 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q56318 1.05e-31 120 32 4 247 3 TM_0019 Uncharacterized oxidoreductase TM_0019 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q49117 1.35e-31 119 31 6 253 3 MexAM1_META1p0182 Uncharacterized oxidoreductase MexAM1_META1p0182 Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
P39640 1.74e-31 119 28 3 256 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus subtilis (strain 168)
O74470 1.79e-31 119 30 6 254 3 SPCC1739.08c Uncharacterized oxidoreductase C1739.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0A0B4HVU2 2.23e-31 119 32 5 258 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium majus (strain ARSEF 297)
P9WGT3 2.49e-31 119 35 5 240 1 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGT2 2.49e-31 119 35 5 240 3 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Y5 2.49e-31 119 35 5 240 3 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8JZV9 3.74e-31 118 30 8 251 1 Bdh2 Dehydrogenase/reductase SDR family member 6 Mus musculus
A0A0B4GT47 4.63e-31 119 32 5 258 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium anisopliae (strain ARSEF 549)
P0AET8 4.64e-31 118 35 4 244 1 hdhA 7alpha-hydroxysteroid dehydrogenase Escherichia coli (strain K12)
P0AET9 4.64e-31 118 35 4 244 3 hdhA 7alpha-hydroxysteroid dehydrogenase Escherichia coli O157:H7
P08074 5.03e-31 118 29 2 247 1 Cbr2 Carbonyl reductase [NADPH] 2 Mus musculus
P50200 5.09e-31 118 34 6 250 1 None 7alpha-hydroxysteroid dehydrogenase Paraclostridium sordellii
P27582 5.3e-31 116 36 4 207 1 None 3-oxoacyl-[acyl-carrier-protein] reductase (Fragments) Brassica napus
D4A1J4 5.43e-31 118 29 7 252 1 Bdh2 Dehydrogenase/reductase SDR family member 6 Rattus norvegicus
P37440 5.57e-31 118 33 7 255 1 ucpA Oxidoreductase UcpA Escherichia coli (strain K12)
P41177 6.51e-31 118 36 6 254 3 None Monensin polyketide synthase putative ketoacyl reductase Streptomyces virginiae
Q3T046 7e-31 117 29 6 250 2 BDH2 Dehydrogenase/reductase SDR family member 6 Bos taurus
P07999 7.09e-31 118 32 5 251 1 gdhB Glucose 1-dehydrogenase B Priestia megaterium
Q99LB2 7.22e-31 118 33 5 252 1 Dhrs4 Dehydrogenase/reductase SDR family member 4 Mus musculus
Q8XBJ4 7.57e-31 118 33 7 255 3 ucpA Oxidoreductase UcpA Escherichia coli O157:H7
A3LZU7 7.59e-31 117 36 2 251 1 DHG2 L-rhamnose-1-dehydrogenase Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
P9WGQ9 8.53e-31 117 34 7 255 1 Rv0769 Uncharacterized oxidoreductase Rv0769 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ8 8.53e-31 117 34 7 255 3 MT0793 Uncharacterized oxidoreductase MT0793 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A411PQN6 9.02e-31 118 33 7 260 3 AgnL6 Short chain dehydrogenase AgnL6 Paecilomyces divaricatus
Q3KPT7 1.45e-30 117 30 6 251 2 bdh2 Dehydrogenase/reductase SDR family member 6 Xenopus laevis
Q91XV4 1.5e-30 116 29 2 244 1 DCXR L-xylulose reductase Mesocricetus auratus
P23238 1.57e-30 116 32 5 244 3 phaB Acetoacetyl-CoA reductase Shinella zoogloeoides
Q6CEE9 1.61e-30 117 31 8 265 1 YALI0B16192g Probable NADP-dependent mannitol dehydrogenase Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6NUE2 1.83e-30 116 33 5 240 2 cbr4 Carbonyl reductase family member 4 Xenopus laevis
D4Z260 2.18e-30 116 33 4 248 1 linX 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX Sphingobium indicum (strain DSM 16413 / CCM 7287 / MTCC 6362 / UT26 / NBRC 101211 / UT26S)
A0A1L5BU05 2.18e-30 116 33 4 248 3 linX 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase LinX Sphingobium indicum (strain DSM 16412 / CCM 7286 / MTCC 6364 / B90A)
P50205 2.45e-30 116 33 4 242 3 phaB Acetoacetyl-CoA reductase Rhizobium meliloti (strain 1021)
Q920N9 3.65e-30 115 30 2 245 2 DCXR L-xylulose reductase Cavia porcellus
P87219 5.52e-30 116 31 9 260 1 SOU1 Sorbose reductase SOU1 Candida albicans (strain SC5314 / ATCC MYA-2876)
O07399 6.74e-30 115 36 5 238 3 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycobacterium avium
Q00791 8.07e-30 115 33 6 259 2 stcU Versicolorin reductase stcU Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
E9EHG1 9.19e-30 115 32 6 257 3 Arp2 Hydroxynaphthalene reductase-like protein Arp2 Metarhizium acridum (strain CQMa 102)
Q8VID1 1.04e-29 115 32 3 249 2 Dhrs4 Dehydrogenase/reductase SDR family member 4 Rattus norvegicus
Q937L4 1.51e-29 114 29 3 248 1 cpnA Cyclopentanol dehydrogenase Comamonas testosteroni
Q8GAV9 1.51e-29 114 29 3 248 1 cpnA Cyclopentanol dehydrogenase Comamonas sp. (strain NCIMB 9872)
W3XC32 1.61e-29 115 32 6 257 2 Pfmaj Trihydroxynaphthalene reductase PfmaI Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
A0A1L9WLH9 1.86e-29 114 31 5 259 1 AacuN Short chain dehydrogenase/reductase AacuN Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q7Z4W1 1.86e-29 114 30 3 250 1 DCXR L-xylulose reductase Homo sapiens
P50171 2.01e-29 114 35 6 257 1 Hsd17b8 (3R)-3-hydroxyacyl-CoA dehydrogenase Mus musculus
H9BFQ2 2.14e-29 114 33 4 247 2 None Tropinone reductase-like 3 Erythroxylum coca
P50204 2.47e-29 113 31 3 233 3 phaB Acetoacetyl-CoA reductase Paracoccus denitrificans
C1C4R8 4.58e-29 112 30 8 251 2 bdh2 Dehydrogenase/reductase SDR family member 6 Aquarana catesbeiana
O86034 5.24e-29 113 31 4 258 1 bdhA D-beta-hydroxybutyrate dehydrogenase Rhizobium meliloti (strain 1021)
Q68ER2 7.47e-29 112 36 3 168 2 cbr4 Carbonyl reductase family member 4 Xenopus tropicalis
P66782 7.64e-29 112 31 5 247 3 fabG2 Uncharacterized oxidoreductase Mb1385 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGR9 7.64e-29 112 31 5 247 1 fabG2 Uncharacterized oxidoreductase Rv1350 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGR8 7.64e-29 112 31 5 247 3 fabG2 Uncharacterized oxidoreductase MT1393 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6TMA3 7.73e-29 113 33 7 265 1 chnA Cyclohexanol dehydrogenase Rhodococcus sp. (strain TK6)
H9BFQ0 8.95e-29 112 33 5 253 2 None Tropinone reductase-like 1 Erythroxylum coca
Q10216 1.17e-28 112 31 5 247 3 SPAC4H3.08 Uncharacterized oxidoreductase C4H3.08 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9BUT1 1.24e-28 112 30 7 250 1 BDH2 Dehydrogenase/reductase SDR family member 6 Homo sapiens
P71534 1.53e-28 112 34 6 243 1 mabA 3-oxoacyl-[acyl-carrier-protein] reductase MabA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9SCU0 1.6e-28 112 32 6 269 3 SDR2a Short-chain dehydrogenase reductase 2a Arabidopsis thaliana
P70720 1.69e-28 111 31 4 240 3 fabG 3-oxoacyl-[acyl-carrier-protein] reductase FabG Aggregatibacter actinomycetemcomitans
F9XMW6 2.23e-28 111 30 5 255 3 MYCGRDRAFT_87994 Probable tetrahydroxynaphthalene reductase MYCGRDRAFT_87994 Zymoseptoria tritici (strain CBS 115943 / IPO323)
Q561X9 2.48e-28 110 30 9 257 2 bdh2 Dehydrogenase/reductase SDR family member 6 Danio rerio
Q9F7E0 2.81e-28 110 30 4 246 1 chnA Cyclohexanol dehydrogenase Acinetobacter sp. (strain SE19)
P45375 2.98e-28 110 34 3 205 3 phaB Acetoacetyl-CoA reductase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
P0CU75 4.33e-28 110 31 5 257 1 claC Short chain dehydrogenase claC Passalora fulva
Q9C826 4.35e-28 111 32 5 259 1 ABA2 Xanthoxin dehydrogenase Arabidopsis thaliana
Q29529 4.62e-28 110 29 2 247 1 CBR2 Carbonyl reductase [NADPH] 2 Sus scrofa
Q9SQR2 4.81e-28 110 32 8 265 1 ChlADR2 NADPH-dependent aldehyde reductase 2, chloroplastic Arabidopsis thaliana
Q5BH34 6.8e-28 110 30 5 258 1 mdpC Short chain dehydrogenase mdpC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A2I1C3T5 7.96e-28 110 31 5 257 1 nsrJ Short chain dehydrogenase/reductase nsrJ Aspergillus novofumigatus (strain IBT 16806)
Q7TS56 8.23e-28 109 29 5 242 2 Cbr4 3-oxoacyl-[acyl-carrier-protein] reductase Rattus norvegicus
Q9Y6Z9 8.27e-28 110 33 9 261 3 sou1 Sorbose reductase sou1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P73826 8.47e-28 109 31 5 242 1 phaB Acetoacetyl-CoA reductase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P50162 8.47e-28 110 30 6 255 1 TR1 Tropinone reductase 1 Datura stramonium
Q9LHT0 9.93e-28 110 30 6 256 2 At5g06060 Tropinone reductase homolog At5g06060 Arabidopsis thaliana
M1W270 1.19e-27 109 30 6 261 2 CPUR_05429 Short chain dehydrogenase CPUR_05429 Claviceps purpurea (strain 20.1)
Q75KH3 1.22e-27 110 32 6 261 2 Os05g0140800 Glucose and ribitol dehydrogenase homolog Oryza sativa subsp. japonica
Q1MLL4 1.26e-27 109 32 6 253 1 gdh Galactitol 2-dehydrogenase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
M2WJF1 1.36e-27 109 30 4 258 2 ver1 Versicolorin reductase 1 Dothistroma septosporum (strain NZE10 / CBS 128990)
Q8TFD5 1.36e-27 109 30 4 258 2 ver1 Versicolorin reductase 1 Dothistroma septosporum
Q9SQR4 1.4e-27 109 31 7 266 3 At3g03980 NADPH-dependent aldehyde reductase-like protein, chloroplastic Arabidopsis thaliana
A0QYC2 1.71e-27 109 36 2 168 1 dthD D-threitol dehydrogenase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q6WVP7 1.8e-27 108 30 3 249 1 adh NADP-dependent (R)-specific alcohol dehydrogenase Lentilactobacillus kefiri
Q8KWS9 2.15e-27 108 28 5 258 1 bacC Dihydroanticapsin 7-dehydrogenase Bacillus amyloliquefaciens
H9BFQ1 2.39e-27 109 33 6 256 2 None Tropinone reductase-like 2 Erythroxylum coca
A0A1A9TAK5 2.52e-27 108 31 6 251 1 NR Noroxomaritidine/norcraugsodine reductase Narcissus pseudonarcissus
A0A1C9II22 2.52e-27 108 31 6 251 1 NR Noroxomaritidine/norcraugsodine reductase Narcissus aff. pseudonarcissus MK-2014
Q9XT00 3.15e-27 108 40 1 165 3 HSD17B8 (3R)-3-hydroxyacyl-CoA dehydrogenase Sus scrofa
P0CG22 3.58e-27 108 33 4 253 5 DHRS4L1 Putative dehydrogenase/reductase SDR family member 4-like 1 Homo sapiens
F1SWA0 4.14e-27 108 32 8 262 1 ZSD1 Zerumbone synthase Zingiber zerumbet
P9WGT1 4.18e-27 108 32 3 245 1 fabG3 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P69166 4.18e-27 108 32 3 245 3 fabG3 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5FPE5 4.36e-27 108 31 2 245 1 GOX2015 Glucose 1-dehydrogenase Gluconobacter oxydans (strain 621H)
P55575 5.66e-27 107 32 6 252 3 NGR_a02430 Uncharacterized short-chain type dehydrogenase/reductase y4mP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8NK50 7.36e-27 107 30 6 259 1 lxr1 NADP-dependent mannitol dehydrogenase Hypocrea jecorina (strain ATCC 56765 / BCRC 32924 / NRRL 11460 / Rut C-30)
P9WGT0 7.61e-27 107 32 3 245 3 fabG3 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q21929 1.01e-26 107 29 2 248 1 dhs-21 L-xylulose reductase Caenorhabditis elegans
P87218 1.06e-26 107 31 9 258 3 SOU2 Sorbose reductase homolog SOU2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9FZ42 1.28e-26 107 31 7 254 1 ChlADR1 NADPH-dependent aldehyde reductase 1, chloroplastic Arabidopsis thaliana
Q6NV34 1.33e-26 107 32 5 250 2 decr2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Danio rerio
P37079 1.6e-26 106 30 6 269 3 sorD Sorbitol-6-phosphate 2-dehydrogenase Klebsiella pneumoniae
Q45219 1.63e-26 107 30 5 251 3 blr2146 Probable short-chain type dehydrogenase/reductase blr2146 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q6P0H7 1.66e-26 105 32 6 241 2 cbr4 Carbonyl reductase family member 4 Danio rerio
Q13268 1.97e-26 107 31 4 245 1 DHRS2 Dehydrogenase/reductase SDR family member 2, mitochondrial Homo sapiens
A7AZH2 2.1e-26 106 30 7 270 1 RUMGNA_00694 3beta-hydroxysteroid dehydrogenase Mediterraneibacter gnavus (strain ATCC 29149 / DSM 114966 / JCM 6515 / VPI C7-9)
P50161 2.51e-26 106 31 6 257 1 aflM Versicolorin reductase 1 Aspergillus parasiticus (strain ATCC 56775 / NRRL 5862 / SRRC 143 / SU-1)
A0A3Q8GYY4 2.61e-26 106 30 6 262 1 NEPS2 (+)-cis,trans-nepetalactol synthase NEPS2 Nepeta racemosa
P0DXE0 3.2e-26 105 32 5 248 1 chcB1 Trans-4-hydroxycyclohexanecarboxylate dehydrogenase Corynebacterium cyclohexanicum
P0DKI3 4.1e-26 105 30 5 252 1 At1g07440 Tropinone reductase homolog At1g07440 Arabidopsis thaliana
A4IFA7 4.48e-26 105 31 5 241 2 CBR4 3-oxoacyl-[acyl-carrier-protein] reductase Bos taurus
P39071 4.76e-26 105 29 4 259 1 dhbA 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase Bacillus subtilis (strain 168)
E9QUT3 5.08e-26 105 32 7 253 3 arp2 Hydroxynaphthalene reductase arp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q01373 7.11e-26 109 32 3 182 1 fox-2 Peroxisomal hydratase-dehydrogenase-epimerase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q01373 3.68e-15 78 37 1 116 1 fox-2 Peroxisomal hydratase-dehydrogenase-epimerase Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
G9FRD7 7.7e-26 104 31 3 247 1 hdha 7alpha-hydroxysteroid dehydrogenase Clostridium sardiniense
Q5C9I9 8.1e-26 105 31 4 251 1 None (-)-isopiperitenol/(-)-carveol dehydrogenase, mitochondrial Mentha piperita
Q9LBG2 8.52e-26 104 31 9 265 1 lvr Levodione reductase Leifsonia aquatica
A0A8F5XX49 8.61e-26 105 31 7 258 1 BDH2 (+)-borneol dehydrogenase 2 Salvia officinalis
A0A1V0QSC6 1.07e-25 104 31 3 249 1 eriH Short-chain dehydrogenase/reductase eriH Hericium erinaceus
B8H1Z0 1.15e-25 103 31 4 245 1 xylB D-xylose 1-dehydrogenase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A9Z0 1.15e-25 103 31 4 245 1 xylB D-xylose 1-dehydrogenase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P87025 1.24e-25 104 30 5 256 3 THR1 Trihydroxynaphthalene reductase Colletotrichum orbiculare (strain 104-T / ATCC 96160 / CBS 514.97 / LARS 414 / MAFF 240422)
Q8N4T8 1.36e-25 103 31 5 241 1 CBR4 3-oxoacyl-[acyl-carrier-protein] reductase Homo sapiens
Q5KTS5 2.32e-25 104 30 5 252 2 CAISE5 Glucose and ribitol dehydrogenase Daucus carota
P66776 2.54e-25 103 32 3 254 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain MW2)
Q6GCZ8 2.54e-25 103 32 3 254 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain MSSA476)
Q6GKH9 2.54e-25 103 32 3 254 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain MRSA252)
P99120 2.54e-25 103 32 3 254 1 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain N315)
P66775 2.54e-25 103 32 3 254 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJP2 2.54e-25 103 32 3 254 3 butA Diacetyl reductase [(S)-acetoin forming] Staphylococcus aureus (strain COL)
P07914 2.74e-25 103 30 4 249 1 baiA1 3alpha-hydroxy bile acid-CoA-ester 3-dehydrogenase 1/3 Clostridium scindens (strain JCM 10418 / VPI 12708)
Q5RCH8 3.18e-25 104 29 7 260 2 PECR Peroxisomal trans-2-enoyl-CoA reductase Pongo abelii
Q9RA05 3.59e-25 103 30 6 270 1 limC (-)-trans-carveol dehydrogenase Rhodococcus erythropolis
Q12634 4.64e-25 103 29 6 259 1 MGG_02252 Tetrahydroxynaphthalene reductase Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A0A3Q8GL18 4.7e-25 103 28 3 255 1 NEPS1 (+)-cis,trans-nepetalactol synthase NEPS1 Nepeta racemosa
A0A4P8DJW8 5.6e-25 102 29 6 264 3 dmxR18 Short chain dehydrogenase/reductase dmxR18 Cryptosporiopsis sp. (strain 8999)
Q9ZW03 6.19e-25 102 31 7 250 1 At2g29150 Tropinone reductase homolog At2g29150 Arabidopsis thaliana
Q9CQ62 6.83e-25 103 30 5 245 1 Decr1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Mus musculus
A0A8F5SIS3 6.85e-25 102 31 5 248 1 BDH1 (+)-borneol dehydrogenase 1 Salvia officinalis
P55541 6.97e-25 102 30 6 252 3 NGR_a02730 Uncharacterized short-chain type dehydrogenase/reductase y4lA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q91VT4 7.23e-25 101 29 5 242 1 Cbr4 3-oxoacyl-[acyl-carrier-protein] reductase Mus musculus
B0ZT44 8.47e-25 102 30 7 267 2 RDT1 Elsinochrome reductase 1 Elsinoe fawcettii
Q64591 1.36e-24 103 30 6 251 1 Decr1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Rattus norvegicus
H9XP47 1.37e-24 101 31 6 242 1 budC Meso-2,3-butanediol dehydrogenase Serratia marcescens
P9WEQ5 1.5e-24 101 31 6 256 3 olcF Short-chain dehydrogenase/reductase olcF Penicillium canescens
P46331 1.72e-24 101 30 8 261 3 yxbG Uncharacterized oxidoreductase YxbG Bacillus subtilis (strain 168)
W6QDA7 1.75e-24 101 29 8 261 1 anuF Short-chain dehydrogenase anuF Penicillium roqueforti (strain FM164)
Q9BY49 2.03e-24 102 28 7 260 1 PECR Peroxisomal trans-2-enoyl-CoA reductase Homo sapiens
Q9ZW12 2.2e-24 102 27 4 248 2 At2g29260 Tropinone reductase homolog At2g29260, chloroplastic Arabidopsis thaliana
K4N0V2 2.58e-24 100 31 6 244 1 BDH Borneol dehydrogenase, mitochondrial Lavandula x intermedia
Q9ZW14 3.41e-24 100 29 5 251 2 At2g29310 Tropinone reductase homolog At2g29310 Arabidopsis thaliana
P50163 3.71e-24 100 29 6 256 1 TR2 Tropinone reductase 2 Datura stramonium
Q53217 4.2e-24 103 31 4 245 3 NGR_a01150 Uncharacterized short-chain type dehydrogenase/reductase y4vI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q53217 1.92e-15 78 29 5 250 3 NGR_a01150 Uncharacterized short-chain type dehydrogenase/reductase y4vI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9MA93 4.81e-24 100 32 6 254 2 At3g05260 Glucose and ribitol dehydrogenase homolog 2 Arabidopsis thaliana
P0AG84 6.2e-24 100 28 3 247 1 yghA Uncharacterized oxidoreductase YghA Escherichia coli (strain K12)
P0AG85 6.2e-24 100 28 3 247 3 yghA Uncharacterized oxidoreductase YghA Escherichia coli O157:H7
A0A1L5BUG8 6.79e-24 99 30 3 250 3 linB 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase Sphingobium indicum (strain DSM 16412 / CCM 7286 / MTCC 6364 / B90A)
P19337 7.08e-24 99 31 5 257 1 baiA2 3alpha-hydroxy bile acid-CoA-ester 3-dehydrogenase 2 Clostridium scindens (strain JCM 10418 / VPI 12708)
P50164 7.78e-24 99 28 6 256 2 TR2 Tropinone reductase 2 Hyoscyamus niger
P06235 7.96e-24 99 29 5 247 3 nodG Nodulation protein G Rhizobium meliloti
D4YYG1 9.89e-24 99 30 3 250 1 linC 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase Sphingobium indicum (strain DSM 16413 / CCM 7287 / MTCC 6362 / UT26 / NBRC 101211 / UT26S)
Q4L8Y1 1.11e-23 98 29 3 197 3 SH0585 Uncharacterized oxidoreductase SH0585 Staphylococcus haemolyticus (strain JCSC1435)
O49332 1.18e-23 99 28 5 250 3 At2g30670 Tropinone reductase homolog At2g30670 Arabidopsis thaliana
P9WGS7 1.26e-23 99 29 3 266 1 Rv0687 Uncharacterized NAD-dependent oxidoreductase Rv0687 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGS6 1.26e-23 99 29 3 266 3 MT0715 Uncharacterized NAD-dependent oxidoreductase MT0715 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8P3K4 1.38e-23 99 31 8 252 1 XCC4067 2-keto-3-deoxy-L-fuconate dehydrogenase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P9WES5 1.42e-23 99 29 7 269 3 fogB Short-chain dehydrogenase fogB Aspergillus ruber (strain CBS 135680)
O31680 1.58e-23 98 32 4 244 3 ykvO Uncharacterized oxidoreductase YkvO Bacillus subtilis (strain 168)
P15047 1.58e-23 98 30 6 253 1 entA 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase Escherichia coli (strain K12)
P16544 1.59e-23 98 29 4 252 1 actIII Putative ketoacyl reductase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O53547 1.62e-23 99 31 6 264 1 chsB1 Hydroxyacyl-CoA dehydrogenase ChsB1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O80714 2.78e-23 98 31 7 256 3 SDR3c Short-chain dehydrogenase reductase 3c Arabidopsis thaliana
P22441 3.04e-23 98 34 8 254 1 None N-acylmannosamine 1-dehydrogenase Flavobacterium sp. (strain 141-8)
P0DX40 3.09e-23 98 31 3 193 1 cla-dh CLA biosynthesis dehydrogenase/reductase Lactiplantibacillus plantarum
O34896 3.52e-23 98 26 6 269 2 uxuB Uncharacterized oxidoreductase UxuB Bacillus subtilis (strain 168)
A7DY56 3.72e-23 98 28 5 249 1 TR Tropinone reductase Cochlearia officinalis
Q9S9W2 3.85e-23 97 33 6 251 1 SDRA Short-chain dehydrogenase/reductase SDRA Arabidopsis thaliana
Q04520 3.98e-23 97 34 1 185 3 budC Diacetyl reductase [(S)-acetoin forming] Raoultella terrigena
Q9M1K9 4.78e-23 97 31 5 253 1 TA1 Short-chain dehydrogenase reductase ATA1 Arabidopsis thaliana
Q73SC8 5.04e-23 97 28 3 266 1 MAP_4146 Uncharacterized NAD-dependent oxidoreductase MAP_4146 Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P22414 5.2e-23 100 29 5 244 1 None Peroxisomal hydratase-dehydrogenase-epimerase Candida tropicalis
P22414 1.4e-19 90 28 7 263 1 None Peroxisomal hydratase-dehydrogenase-epimerase Candida tropicalis
I6Y778 5.68e-23 100 32 5 243 1 fabG4 3-oxoacyl-[acyl-carrier-protein] reductase [NADH] Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
F4IKM1 6.81e-23 97 30 4 250 2 At2g29340 Tropinone reductase homolog At2g29340 Arabidopsis thaliana
Q9ZW19 7.95e-23 97 29 5 250 1 SDR Tropinone reductase homolog At2g29360 Arabidopsis thaliana
A0A3Q8GLE8 9.03e-23 97 27 5 255 1 NEPS3 (+)-cis,cis-nepetalactol synthase NEPS3 Nepeta racemosa
Q9ZW16 9.62e-23 96 30 3 249 1 TRI Tropinone reductase homolog At2g29330 Arabidopsis thaliana
P50167 1.04e-22 97 29 8 264 2 ARDH D-arabinitol 2-dehydrogenase [ribulose-forming] Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5LA59 1.08e-22 96 31 8 259 1 hdhA 7alpha-hydroxysteroid dehydrogenase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
O80713 1.19e-22 96 28 3 255 2 SDR3a Short-chain dehydrogenase reductase 3a Arabidopsis thaliana
A0A2I1BSW8 1.64e-22 95 30 7 254 1 nvfC Asnovolin H dehydrogenase nvfC Aspergillus novofumigatus (strain IBT 16806)
P50160 1.83e-22 97 29 6 280 2 TS2 Sex determination protein tasselseed-2 Zea mays
P9WGS5 1.83e-22 96 30 7 276 1 Rv2750 Uncharacterized oxidoreductase Rv2750 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGS4 1.83e-22 96 30 7 276 3 MT2820 Uncharacterized oxidoreductase MT2820 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q56840 1.84e-22 95 30 6 249 1 xecD1 2-(R)-hydroxypropyl-CoM dehydrogenase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
P42317 1.98e-22 95 29 4 257 3 yxjF Uncharacterized oxidoreductase YxjF Bacillus subtilis (strain 168)
Q9ZW15 2.01e-22 95 28 4 249 2 At2g29320 Tropinone reductase homolog At2g29320 Arabidopsis thaliana
P19992 2.37e-22 95 34 5 247 1 None 3-alpha-(or 20-beta)-hydroxysteroid dehydrogenase Streptomyces exfoliatus
H1VN83 3.38e-22 95 32 7 259 1 dpchG Short chain dehydrogenase/reductase dpchG Colletotrichum higginsianum (strain IMI 349063)
F4J300 3.63e-22 95 30 3 250 3 SDR5 Short-chain dehydrogenase reductase 5 Arabidopsis thaliana
A7IQF2 4.63e-22 94 35 2 174 3 xecE2 Inactive 2-(S)-hydroxypropyl-CoM dehydrogenase 2 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
O00058 5.95e-22 94 28 4 252 2 PIG8 Probable NADP-dependent mannitol dehydrogenase Uromyces fabae
P0DOV5 6.34e-22 94 29 3 247 1 PpSQ1_00405 Sulfoquinovose 1-dehydrogenase Pseudomonas putida
P14802 6.92e-22 94 29 3 220 3 yoxD Uncharacterized oxidoreductase YoxD Bacillus subtilis (strain 168)
P16542 8.11e-22 94 31 6 253 3 gra-orf5 Granaticin polyketide synthase putative ketoacyl reductase 1 Streptomyces violaceoruber
P43066 8.62e-22 94 29 6 264 3 ARD1 D-arabinitol 2-dehydrogenase [ribulose-forming] Candida albicans (strain WO-1)
F4J2Z7 8.96e-22 94 30 3 250 2 SDR4 Short-chain dehydrogenase reductase 4 Arabidopsis thaliana
Q9LBV3 9.56e-22 94 28 5 253 1 barS1 A-factor type gamma-butyrolactone 1'-reductase (1S-forming) Streptomyces virginiae
B6HV34 1.02e-21 94 30 5 250 1 adrF Short chain dehydrogenase adrF Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
O31642 1.53e-21 93 29 8 256 3 yjdA Uncharacterized oxidoreductase YjdA Bacillus subtilis (strain 168)
Q9WVK3 1.55e-21 94 29 9 264 2 Pecr Peroxisomal trans-2-enoyl-CoA reductase Rattus norvegicus
P07772 1.65e-21 93 31 9 260 3 benD 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A0A6S6QNE4 1.74e-21 93 29 5 256 1 ple7 Short chain dehydrogenase ple7 Rhodocybe pseudopiperita
Q9BPX1 2.09e-21 93 33 8 198 1 HSD17B14 17-beta-hydroxysteroid dehydrogenase 14 Homo sapiens
Q9ZW04 2.17e-21 93 29 7 252 3 At2g29170 Tropinone reductase homolog At2g29170 Arabidopsis thaliana
Q56841 2.63e-21 92 34 3 176 1 xecE1 2-(S)-hydroxypropyl-CoM dehydrogenase 1 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q2FVD5 3.11e-21 92 27 6 244 3 SAOUHSC_02778 Uncharacterized oxidoreductase SAOUHSC_02778 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HD73 3.11e-21 92 27 6 244 3 SACOL2488 Uncharacterized oxidoreductase SACOL2488 Staphylococcus aureus (strain COL)
Q2FE21 3.11e-21 92 27 6 244 3 SAUSA300_2422 Uncharacterized oxidoreductase SAUSA300_2422 Staphylococcus aureus (strain USA300)
N4WE73 3.63e-21 91 34 6 185 3 OXI1 Dehydrogenase OXI1 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
P44481 4.48e-21 92 26 6 271 1 HI_0048 Uncharacterized oxidoreductase HI_0048 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9MYP6 5.27e-21 92 31 8 248 2 HSD17B14 17-beta-hydroxysteroid dehydrogenase 14 Bos taurus
Q9Z2M4 6.13e-21 92 31 7 251 1 Decr2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Rattus norvegicus
Q5RBV3 6.26e-21 92 30 7 252 2 DECR2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Pongo abelii
P50166 6.43e-21 92 28 7 264 1 ARD D-arabinitol 2-dehydrogenase [ribulose-forming] Candida tropicalis
Q42182 6.49e-21 91 27 5 251 2 At2g29300 Tropinone reductase homolog At2g29300 Arabidopsis thaliana
O34308 6.85e-21 91 28 6 248 3 ytkK Putative oxidoreductase YtkK Bacillus subtilis (strain 168)
P0C0Y4 7.35e-21 91 27 7 259 1 None NADP-dependent mannitol dehydrogenase Alternaria alternata
Q9NUI1 7.37e-21 92 30 7 252 1 DECR2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Homo sapiens
Q9WV68 1.05e-20 91 31 7 251 1 Decr2 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Mus musculus
Q8NUV9 1.4e-20 90 26 6 245 3 MW2403 Uncharacterized oxidoreductase MW2403 Staphylococcus aureus (strain MW2)
Q6G6J1 1.4e-20 90 26 6 245 3 SAS2370 Uncharacterized oxidoreductase SAS2370 Staphylococcus aureus (strain MSSA476)
A7IQH5 1.88e-20 90 32 3 185 1 xecE3 2-(S)-hydroxypropyl-CoM dehydrogenase 3 Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
P95727 2.09e-20 90 28 7 249 1 chcA 1-cyclohexenylcarbonyl-CoA reductase Streptomyces collinus
Q5HLD8 2.12e-20 89 29 2 186 3 SERP2049 Uncharacterized oxidoreductase SERP2049 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CN40 2.12e-20 89 29 2 186 3 SE_2036 Uncharacterized oxidoreductase SE_2036 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0A8D5M6H6 2.7e-20 90 27 5 254 1 esdpF Short-chain dehydrogenase/reductase esdpF Penicillium shearii
Q9ZW18 3.5e-20 90 29 7 251 1 SAG13 Senescence-associated protein 13 Arabidopsis thaliana
Q9JIF5 3.98e-20 90 30 3 190 1 PECR Peroxisomal trans-2-enoyl-CoA reductase Cavia porcellus
Q94KL8 4.26e-20 89 29 4 196 1 None Secoisolariciresinol dehydrogenase (Fragment) Podophyllum peltatum
Q99RF5 4.56e-20 89 26 6 245 3 SAV2478 Uncharacterized oxidoreductase SAV2478 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A3L9 4.56e-20 89 26 6 245 1 SA2266 Uncharacterized oxidoreductase SA2266 Staphylococcus aureus (strain N315)
P51659 4.93e-20 92 28 7 257 1 HSD17B4 Peroxisomal multifunctional enzyme type 2 Homo sapiens
Q6GDV6 5.79e-20 88 25 6 244 3 SAR2567 Uncharacterized oxidoreductase SAR2567 Staphylococcus aureus (strain MRSA252)
Q16698 6.71e-20 90 30 3 196 1 DECR1 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing], mitochondrial Homo sapiens
P0C0Y5 6.8e-20 89 27 6 259 1 None NADP-dependent mannitol dehydrogenase Davidiella tassiana
P97852 7.14e-20 91 29 7 257 1 Hsd17b4 Peroxisomal multifunctional enzyme type 2 Rattus norvegicus
Q22230 8.99e-20 89 30 8 253 3 decr-1.3 Probable 2,4-dienoyl-CoA reductase 3 [(3E)-enoyl-CoA-producing] Caenorhabditis elegans
O18404 9.18e-20 88 30 8 253 1 scu 3-hydroxyacyl-CoA dehydrogenase type-2 Drosophila melanogaster
Q8RX32 1.17e-19 88 28 4 251 2 At1g07450 Tropinone reductase homolog At1g07450 Arabidopsis thaliana
O34782 1.2e-19 88 28 9 267 3 yvrD Uncharacterized oxidoreductase YvrD Bacillus subtilis (strain 168)
Q23116 1.45e-19 89 29 8 257 3 decr-1.2 Probable 2,4-dienoyl-CoA reductase decr-1.2 [(3E)-enoyl-CoA-producing] Caenorhabditis elegans
A3F5F0 1.93e-19 88 30 6 200 1 SDH Secoisolariciresinol dehydrogenase Sinopodophyllum hexandrum
O32229 2.06e-19 87 26 5 260 3 yvaG Uncharacterized oxidoreductase YvaG Bacillus subtilis (strain 168)
P05406 2.16e-19 87 32 10 253 3 fixR Protein FixR Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O13908 2.56e-19 87 27 6 256 3 SPAC22A12.17c Uncharacterized oxidoreductase C22A12.17c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4A054 3.47e-19 86 28 3 197 3 SSP0419 Uncharacterized oxidoreductase SSP0419 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
G0RH19 4.91e-19 87 26 7 269 1 lxr3 L-xylulose reductase Hypocrea jecorina (strain QM6a)
O93868 5.84e-19 86 29 6 261 1 mtdH NADP-dependent mannitol dehydrogenase Agaricus bisporus
Q94K41 6.08e-19 86 28 2 247 2 SDR3b Short-chain dehydrogenase reductase 3b Arabidopsis thaliana
P70684 7.07e-19 86 32 5 205 2 HPGD 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Cavia porcellus
Q70FD1 7.2e-19 86 27 10 270 1 ALX1 NADH-dependent L-xylulose reductase Ambrosiozyma monospora
Q9ZW13 8.43e-19 86 28 6 253 2 At2g29290 Tropinone reductase homolog At2g29290 Arabidopsis thaliana
Q9VXJ0 8.7e-19 88 31 8 256 1 Mfe2 Peroxisomal multifunctional enzyme type 2 Drosophila melanogaster
Q1NEI6 9.14e-19 85 28 8 249 1 LRA5 2-dehydro-3-deoxy-L-rhamnonate dehydrogenase (NAD(+)) Sphingomonas sp. (strain SKA58)
P51660 1.02e-18 88 28 7 257 1 Hsd17b4 Peroxisomal multifunctional enzyme type 2 Mus musculus
Q9ZW20 1.15e-18 85 27 3 248 3 At2g29370 Tropinone reductase homolog At2g29370 Arabidopsis thaliana
Q99MZ7 1.26e-18 86 30 5 193 1 Pecr Peroxisomal trans-2-enoyl-CoA reductase Mus musculus
A0A1Y0BRF8 1.4e-18 85 27 6 251 3 adrF Short chain dehydrogenase adrF Penicillium roqueforti
P19871 1.42e-18 85 30 5 250 1 None 3-beta-hydroxysteroid dehydrogenase Comamonas testosteroni
P40398 1.98e-18 85 27 6 254 3 yhxD Uncharacterized oxidoreductase YhxD Bacillus subtilis (strain 168)
G4N1P8 2.07e-18 85 28 8 266 2 ABA4 Short-chain dehydrogenase/reductase ABA4 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
L7I518 2.07e-18 85 28 8 266 2 ABA4 Short-chain dehydrogenase/reductase ABA4 Pyricularia oryzae (strain Y34)
Q9GME3 2.81e-18 81 40 1 134 2 HSD17B8 Estradiol 17-beta-dehydrogenase 8 (Fragment) Callithrix jacchus
Q8MJY8 3.49e-18 84 33 6 206 2 HPGD 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Macaca fascicularis
A0A165U5V5 4.75e-18 84 28 7 260 1 ADH1 Short chain aldehyde dehydrogenase 1 Euphorbia lathyris
A5JYX5 4.97e-18 84 29 3 193 1 dhs-3 Protein dhs-3 Caenorhabditis elegans
W3XAA0 6.1e-18 84 27 5 258 1 PfmaG Tetrahydroxynaphthalene reductase PfmaG Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
P9WGQ3 9.82e-18 83 29 3 186 3 Rv1714 Uncharacterized oxidoreductase Rv1714 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ2 9.82e-18 83 29 3 186 3 MT1753.1 Uncharacterized oxidoreductase MT1753.1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3U0B3 1.06e-17 83 31 9 238 1 Dhrs11 Dehydrogenase/reductase SDR family member 11 Mus musculus
A0A2U8U2K8 1.15e-17 82 29 3 242 1 asL5 Oxidoreductase asL5 Sarocladium schorii
P05707 1.21e-17 82 27 5 254 1 srlD Sorbitol-6-phosphate 2-dehydrogenase Escherichia coli (strain K12)
O31767 1.31e-17 82 26 5 244 3 ymfI Uncharacterized oxidoreductase YmfI Bacillus subtilis (strain 168)
P15428 1.36e-17 82 33 6 206 1 HPGD 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Homo sapiens
D2WKD9 1.54e-17 82 31 6 202 1 SDR-1 Farnesol dehydrogenase Aedes aegypti
A0A3G9HAL8 1.72e-17 82 27 6 251 1 cdmF Short-chain dehydrogenase/reductase cdmF Talaromyces verruculosus
Q93761 1.73e-17 83 30 7 255 3 F53C11.3 Uncharacterized oxidoreductase F53C11.3 Caenorhabditis elegans
A0A8J9S3B0 1.88e-17 82 28 7 282 3 phomF Short-chain dehydrogenase/reductase PhomF Diaporthe leptostromiformis
A0A384JQF5 2.43e-17 82 28 7 263 2 aba4 Short-chain dehydrogenase/reductase aba4 Botryotinia fuckeliana (strain B05.10)
L7WRR9 2.64e-17 82 28 8 264 1 notP' Short chain dehydrogenases/reductase notP' Aspergillus versicolor
O70351 3.05e-17 81 30 9 258 1 Hsd17b10 3-hydroxyacyl-CoA dehydrogenase type-2 Rattus norvegicus
P0C622 3.34e-17 81 30 7 259 3 cmtB 2,3-dihydroxy-2,3-dihydro-p-cumate dehydrogenase Pseudomonas putida
A5W4G5 3.34e-17 81 30 7 259 3 cmtB 2,3-dihydroxy-2,3-dihydro-p-cumate dehydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q14RS1 3.83e-17 81 27 7 263 2 aba4 Short-chain dehydrogenase/reductase aba4 Botryotinia fuckeliana
O02691 4.14e-17 81 28 8 256 1 HSD17B10 3-hydroxyacyl-CoA dehydrogenase type-2 Bos taurus
P00335 4.43e-17 81 29 4 230 1 rbtD Ribitol 2-dehydrogenase Klebsiella aerogenes
Q7FAE1 5.36e-17 81 31 5 250 2 Os04g0179200 Momilactone A synthase Oryza sativa subsp. japonica
Q02207 5.45e-17 83 29 4 188 2 FOX2 Peroxisomal hydratase-dehydrogenase-epimerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q02207 3.33e-11 66 31 4 190 2 FOX2 Peroxisomal hydratase-dehydrogenase-epimerase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A443HJZ3 5.63e-17 81 29 6 292 1 VdtF Short-chain dehydrogenase/reductase VdtF Byssochlamys spectabilis
P37694 5.76e-17 81 29 4 228 3 hetN Ketoacyl reductase HetN Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q51576 6.15e-17 80 31 6 247 3 PA3106 Uncharacterized oxidoreductase PA3106 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P50165 6.34e-17 81 27 6 254 2 None Tropinone reductase homolog Datura stramonium
P39333 7.89e-17 80 29 8 250 1 bdcA Cyclic-di-GMP-binding biofilm dispersal mediator protein Escherichia coli (strain K12)
P39644 1.69e-16 79 25 6 259 1 bacG NADPH-dependent reductase BacG Bacillus subtilis (strain 168)
P16543 1.89e-16 79 30 9 248 3 gra-orf6 Granaticin polyketide synthase putative ketoacyl reductase 2 Streptomyces violaceoruber
A0A142I726 2.52e-16 79 27 7 282 3 PhomF' Short-chain dehydrogenase/reductase PhomF' Diaporthe leptostromiformis
Q8VCC1 2.58e-16 79 30 5 207 1 Hpgd 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Mus musculus
Q05069 3.7e-16 79 32 10 264 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6PKH6 3.78e-16 78 32 4 183 1 DHRS4L2 Dehydrogenase/reductase SDR family member 4-like 2 Homo sapiens
Q0CS96 4.35e-16 80 26 6 247 2 tazN Short chain dehydrogenase tazN Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P52037 6e-16 78 29 8 257 1 ygfF Uncharacterized oxidoreductase YgfF Escherichia coli (strain K12)
Q3ZBV9 6.3e-16 78 28 8 237 2 DHRS11 Dehydrogenase/reductase SDR family member 11 Bos taurus
Q0VFE7 8.53e-16 78 28 6 231 2 dhrs7b Dehydrogenase/reductase SDR family member 7B Xenopus tropicalis
Q9KJF2 1.11e-15 77 29 6 243 1 bbsC (2S)-[(R)-hydroxy(phenyl)methyl]succinyl-CoA dehydrogenase subunit BbsC Thauera aromatica
P55435 1.15e-15 77 27 5 204 3 NGR_a03830 Uncharacterized short-chain type dehydrogenase/reductase y4eL Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3T0C2 1.68e-15 77 30 5 205 2 HPGD 15-hydroxyprostaglandin dehydrogenase [NAD(+)] Bos taurus
Q71R50 1.74e-15 77 31 10 241 2 DHRS11 Dehydrogenase/reductase SDR family member 11 Gallus gallus
O42866 1.89e-15 76 27 8 244 3 oar2 3-oxoacyl-[acyl-carrier-protein] reductase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P9WEW9 3.35e-15 76 28 7 259 1 dpfgG Short chain dehydrogenase/reductase dpfgG Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6UWP2 3.66e-15 76 30 9 238 1 DHRS11 Dehydrogenase/reductase SDR family member 11 Homo sapiens
O08756 3.68e-15 76 29 8 255 1 Hsd17b10 3-hydroxyacyl-CoA dehydrogenase type-2 Mus musculus
P42556 4.41e-15 76 27 7 284 1 PTR1 Pteridine reductase 1 Leishmania tarentolae
Q0IH28 5.24e-15 76 27 6 231 2 dhrs7b Dehydrogenase/reductase SDR family member 7B Xenopus laevis
A0A0U5GHD4 5.87e-15 75 25 6 262 3 ausX Short chain dehydrogenase ausX Aspergillus calidoustus
A0A097ZPC9 7.71e-15 75 27 6 252 3 andC Short chain dehydrogenase andC Emericella variicolor
Q7SHI4 8.03e-15 75 23 7 267 2 srdC Short-chain dehydrogenase srdC Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9Y140 1.18e-14 75 29 6 196 2 CG7601 Dehydrogenase/reductase SDR family protein 7-like Drosophila melanogaster
Q9NKW1 1.5e-14 75 27 8 260 2 mfeA Peroxisomal multifunctional enzyme A Dictyostelium discoideum
Q9SY73 1.52e-14 73 28 6 194 1 At1g10310 NADPH-dependent pterin aldehyde reductase Arabidopsis thaliana
P23102 1.72e-14 74 27 10 261 3 xylL 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase Pseudomonas putida
Q5R6U1 2.06e-14 74 28 10 239 2 DHRS7B Dehydrogenase/reductase SDR family member 7B Pongo abelii
Q9LTV6 2.22e-14 74 28 7 257 2 At3g12800 Peroxisomal 2,4-dienoyl-CoA reductase [(3E)-enoyl-CoA-producing] Arabidopsis thaliana
Q0C898 2.51e-14 73 26 6 230 1 trt9 Short chain dehydrogenase trt9 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
G4N290 3.64e-14 73 27 4 190 2 RED2 Short-chain dehydrogenase RED2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q6IAN0 4.27e-14 73 28 7 232 1 DHRS7B Dehydrogenase/reductase SDR family member 7B Homo sapiens
P73016 4.85e-14 72 30 11 263 3 fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0A084B9Z1 5.63e-14 72 25 5 229 3 SAT3 Short-chain dehydrogenase/reductase SAT3 Stachybotrys chartarum (strain CBS 109288 / IBT 7711)
A0A0F7U1Z1 5.65e-14 72 24 7 264 3 ausX Short chain dehydrogenase ausX Penicillium brasilianum
P96825 5.95e-14 73 27 6 247 1 Rv0148 Putative short-chain type dehydrogenase/reductase Rv0148 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
G9N4B1 6.25e-14 72 26 7 265 1 virB Short-chain dehydrogenase virB Hypocrea virens (strain Gv29-8 / FGSC 10586)
A0A1U8QWA2 6.49e-14 74 28 5 232 1 ATRR Glycine betaine reductase ATRR Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q82IY9 6.72e-14 72 30 6 211 1 ptlF 1-deoxy-11-beta-hydroxypentalenate dehydrogenase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P0A169 8.42e-14 72 30 7 191 3 nahB 1,2-dihydroxy-1,2-dihydronaphthalene dehydrogenase Pseudomonas putida
P9WGS3 8.72e-14 73 27 1 185 1 ephD Probable oxidoreductase EphD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGS2 8.72e-14 73 27 1 185 3 ephD Probable oxidoreductase EphD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P66778 8.72e-14 73 27 1 185 3 ephD Probable oxidoreductase EphD Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A0H3KNE7 9.94e-14 72 29 6 253 1 BMULJ_04919 L-fucose dehydrogenase Burkholderia multivorans (strain ATCC 17616 / 249)
Q99J47 1.16e-13 72 27 8 232 1 Dhrs7b Dehydrogenase/reductase SDR family member 7B Mus musculus
Q99714 1.19e-13 72 27 6 255 1 HSD17B10 3-hydroxyacyl-CoA dehydrogenase type-2 Homo sapiens
Q96LJ7 1.36e-13 72 29 6 197 1 DHRS1 Dehydrogenase/reductase SDR family member 1 Homo sapiens
P0A170 1.44e-13 71 29 6 191 3 doxE 1,2-dihydroxy-1,2-dihydronaphthalene dehydrogenase Pseudomonas sp. (strain C18)
W6QP06 1.59e-13 72 28 5 196 3 prx4 Short-chain dehydrogenase/reductase prx4 Penicillium roqueforti (strain FM164)
B6H065 1.8e-13 72 28 5 196 2 prx4 Short-chain dehydrogenase/reductase prx4 Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q99L04 2e-13 72 28 6 206 1 Dhrs1 Dehydrogenase/reductase SDR family member 1 Mus musculus
A0A023I4C8 2.48e-13 71 28 5 196 3 prx4 Short-chain dehydrogenase/reductase prx4 Penicillium roqueforti
A0A0S2CGD3 2.89e-13 71 25 7 249 1 pigC Short chain dehydrogenase pigC Monascus ruber
P50206 3.16e-13 70 29 9 260 3 bphB Cis-2,3-dihydrobiphenyl-2,3-diol dehydrogenase Pseudomonas sp. (strain KKS102)
A0A1E1FFP5 3.68e-13 70 25 6 262 1 prhI Short chain dehydrogenase prhI Penicillium brasilianum
Q93UV4 3.73e-13 71 29 11 256 1 flnB Fluoren-9-ol dehydrogenase Terrabacter sp. (strain DBF63)
Q6F7B8 4.44e-13 70 27 4 184 1 acr1 Fatty acyl-CoA reductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q49WS9 5.88e-13 69 27 6 196 3 SSP1627 Uncharacterized oxidoreductase SSP1627 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q566S6 7.79e-13 70 26 5 227 2 dhrs7b Dehydrogenase/reductase SDR family member 7B Danio rerio
P9WGQ7 8.09e-13 69 28 9 249 1 Rv1144 Uncharacterized oxidoreductase Rv1144 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGQ6 8.09e-13 69 28 9 249 3 MT1177 Uncharacterized oxidoreductase MT1177 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P32573 8.32e-13 70 27 9 265 1 SPS19 Peroxisomal 2,4-dienoyl-CoA reductase SPS19 [(3E)-enoyl-CoA-producing] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q3T0R4 1.03e-12 70 26 6 226 2 DHRS7B Dehydrogenase/reductase SDR family member 7B Bos taurus
Q46381 1.09e-12 69 27 8 260 1 bphB Cis-2,3-dihydrobiphenyl-2,3-diol dehydrogenase Comamonas testosteroni
Q92EK7 1.24e-12 68 28 4 197 3 lin0452 Uncharacterized oxidoreductase Lin0452 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q7N4V7 2.36e-12 68 29 8 230 3 hcaB 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P40747 2.74e-12 69 25 3 206 3 yuxG Uncharacterized oxidoreductase YuxG Bacillus subtilis (strain 168)
Q7Q732 3.13e-12 68 28 4 200 3 AGAP005532 Dehydrogenase/reductase SDR family protein 7-like Anopheles gambiae
P25145 5.17e-12 67 27 4 197 3 lmo0432 Uncharacterized oxidoreductase Lmo0432 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A0A1B2CTA9 5.58e-12 67 29 8 258 1 penD Short chain dehydrogenase penD Penicillium thymicola
O52384 6.26e-12 67 30 7 194 3 nagB 1,2-dihydroxy-1,2-dihydronaphthalene dehydrogenase Ralstonia sp.
Q53882 7.62e-12 66 29 7 250 1 dauE Aklaviketone reductase DauE Streptomyces sp. (strain C5)
P54554 8.57e-12 66 30 9 227 3 yqjQ Uncharacterized oxidoreductase YqjQ Bacillus subtilis (strain 168)
M2ZIX7 1.02e-11 67 26 5 206 3 MYCFIDRAFT_6125 Short chain dehydrogenase MYCFIDRAFT_6125 Pseudocercospora fijiensis (strain CIRAD86)
P13859 1.4e-11 66 29 10 268 1 todD Cis-toluene dihydrodiol dehydrogenase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P08088 1.4e-11 66 29 10 268 3 bnzE Cis-1,2-dihydrobenzene-1,2-diol dehydrogenase Pseudomonas putida
P40579 1.58e-11 65 28 9 253 1 YIR035C Uncharacterized oxidoreductase YIR035C Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5M875 1.92e-11 66 24 6 243 1 Hsd17b13 17-beta-hydroxysteroid dehydrogenase 13 Rattus norvegicus
Q01782 1.97e-11 65 28 4 196 1 PTR1 Pteridine reductase 1 Leishmania major

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10505
Feature type CDS
Gene kduD
Product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD
Location 2312015 - 2312770 (strand: -1)
Length 756 (nucleotides) / 251 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_55
Orthogroup size 14
N. genomes 7

Actions

Genomic region

Domains

PF13561 Enoyl-(Acyl carrier protein) reductase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1028 Lipid transport and metabolism (I) I NAD(P)-dependent dehydrogenase, short-chain alcohol dehydrogenase family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K00065 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase [EC:1.1.1.127] Pentose and glucuronate interconversions
Metabolic pathways		 -

Protein Sequence

MNLFDLTGKVAIVTGCNTGLGQGMAIGLAQAGADIVGVGIQDAPETRQKVEALGRRFHYITQNLIQQDGLDALVDEAVKVMGRIDILVNNAGIIRREDLLQFSEKDWDDVININQKTLFFLSQKVARQFVKQGEGGKIINIASMLSYQGGIRVPSYTASKSAVMGLTRALATELSQYNINVNAIAPGYMATDNTAALRADEARNAAILERIPAGRWGTPEDVAGPAIFLASKASDYINGYTIAVDGGWLAR

Flanking regions ( +/- flanking 50bp)

CTACAAAAAAAAGTGTGGCAATTATTGCCACACTTCTAGAGGTTTTAATCATGAATTTATTTGATTTAACAGGCAAAGTTGCCATTGTTACTGGGTGTAATACAGGCTTAGGGCAAGGAATGGCAATAGGTTTAGCACAAGCCGGTGCGGATATTGTTGGCGTGGGTATTCAAGATGCTCCTGAAACGCGTCAAAAAGTCGAAGCGTTAGGCCGTCGTTTTCATTACATCACGCAAAATTTAATCCAACAAGATGGATTAGATGCTTTAGTGGATGAGGCTGTTAAGGTGATGGGACGTATTGATATTTTAGTGAATAATGCCGGTATTATTCGCCGTGAAGATCTTTTGCAATTTAGTGAAAAAGATTGGGATGATGTGATTAATATTAACCAAAAGACACTGTTTTTCTTATCGCAAAAAGTGGCTCGCCAGTTTGTCAAACAAGGCGAAGGTGGCAAGATAATCAACATCGCGTCAATGCTTTCTTATCAAGGAGGTATCCGAGTTCCTTCTTATACGGCAAGTAAATCCGCGGTAATGGGATTAACACGAGCATTAGCGACGGAATTATCACAATATAATATTAATGTAAATGCAATTGCTCCTGGCTATATGGCAACCGATAACACCGCTGCACTTCGTGCTGATGAAGCGCGTAATGCTGCTATTTTAGAGCGTATTCCTGCGGGGCGTTGGGGAACACCTGAAGATGTCGCAGGTCCTGCCATATTTTTAGCCTCTAAAGCTAGTGATTATATCAATGGATATACCATTGCGGTTGATGGTGGTTGGTTAGCTCGATAATCTTATGGAGAACTAGGATGGAACACGCTAATACAGAGGCTTTACAAAGA