Homologs in group_371

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17905 FBDBKF_17905 32.4 Morganella morganii S1 mdlB ABC-type multidrug transport system, ATPase and permease component
EHELCC_06430 EHELCC_06430 32.4 Morganella morganii S2 mdlB ABC-type multidrug transport system, ATPase and permease component
NLDBIP_06750 NLDBIP_06750 32.4 Morganella morganii S4 mdlB ABC-type multidrug transport system, ATPase and permease component
LHKJJB_18910 LHKJJB_18910 32.4 Morganella morganii S3 mdlB ABC-type multidrug transport system, ATPase and permease component
HKOGLL_04640 HKOGLL_04640 32.4 Morganella morganii S5 mdlB ABC-type multidrug transport system, ATPase and permease component
PMI_RS10010 PMI_RS10010 42.3 Proteus mirabilis HI4320 - type I secretion system permease/ATPase
PMI_RS12860 PMI_RS12860 32.4 Proteus mirabilis HI4320 - ABC transporter ATP-binding protein

Distribution of the homologs in the orthogroup group_371

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_371

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q933I3 1.99e-165 489 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia glucosida
P26760 2.61e-165 489 44 2 558 1 apxIB Toxin RTX-I translocation ATP-binding protein Actinobacillus pleuropneumoniae
P55122 6.68e-165 488 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Pasteurella haemolytica-like sp. (strain 5943B)
Q93FH2 2.94e-164 487 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P16532 3.61e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH6 3.69e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q9RCG7 3.96e-164 486 45 2 558 3 paxB Exotoxin translocation ATP-binding protein PaxB Pasteurella aerogenes
Q933E0 4.21e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Bibersteinia trehalosi
P0C086 5.11e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P0C087 5.11e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH0 5.22e-164 486 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FH3 1.85e-163 484 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
Q93FG6 3.58e-163 484 44 2 558 3 lktB Leukotoxin translocation ATP-binding protein LktB Mannheimia haemolytica
P23702 8.17e-163 483 44 2 558 1 ltxB Leukotoxin export ATP-binding protein LtxB Aggregatibacter actinomycetemcomitans
P0DKX5 4.32e-162 481 42 1 559 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX6 1.52e-161 480 42 1 559 3 cyaB Cyclolysin secretion/processing ATP-binding protein CyaB Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
Q47258 4.33e-161 478 44 2 558 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P10089 7.2e-161 478 44 2 558 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
Q8FDZ8 8.28e-161 478 44 2 558 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P08716 2.66e-160 476 44 3 560 1 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli
P11599 4.88e-160 476 46 2 546 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Proteus vulgaris
Q04473 6.69e-160 476 44 3 560 3 apxIIIB Toxin RTX-III translocation ATP-binding protein Actinobacillus pleuropneumoniae
Q46717 4.31e-152 455 43 2 558 3 hlyB Alpha-hemolysin translocation ATP-binding protein HlyB Escherichia coli O157:H7
Q2G2M9 1.19e-95 306 34 8 576 3 SAOUHSC_02003 Putative multidrug export ATP-binding/permease protein SAOUHSC_02003 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GFJ1 1.19e-95 306 34 8 576 3 SAR1956 Putative multidrug export ATP-binding/permease protein SAR1956 Staphylococcus aureus (strain MRSA252)
Q5HEQ8 1.19e-95 306 34 8 576 3 SACOL1924 Putative multidrug export ATP-binding/permease protein SACOL1924 Staphylococcus aureus (strain COL)
Q99T13 1.19e-95 306 34 8 576 1 SAV1866 Putative multidrug export ATP-binding/permease protein SAV1866 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FFM9 1.19e-95 306 34 8 576 3 SAUSA300_1847 Putative multidrug export ATP-binding/permease protein SAUSA300_1847 Staphylococcus aureus (strain USA300)
Q7A0J1 1.19e-95 306 34 8 576 3 MW1806 Putative multidrug export ATP-binding/permease protein MW1806 Staphylococcus aureus (strain MW2)
Q6G868 1.19e-95 306 34 8 576 3 SAS1788 Putative multidrug export ATP-binding/permease protein SAS1788 Staphylococcus aureus (strain MSSA476)
Q7A4T3 1.19e-95 306 34 8 576 1 SA1683 Putative multidrug export ATP-binding/permease protein SA1683 Staphylococcus aureus (strain N315)
Q2YU20 6.73e-95 304 34 9 580 3 SAB1799c Putative multidrug export ATP-binding/permease protein SAB1799c Staphylococcus aureus (strain bovine RF122 / ET3-1)
P71082 8.36e-92 296 31 4 548 3 ygaD Putative multidrug export ATP-binding/permease protein YgaD Bacillus subtilis (strain 168)
O31707 9.82e-92 296 32 4 562 3 yknU Uncharacterized ABC transporter ATP-binding protein YknU Bacillus subtilis (strain 168)
P59852 4.62e-90 295 33 6 546 1 lagD Lactococcin-G-processing and transport ATP-binding protein LagD Lactococcus lactis subsp. lactis
Q9CJB8 1.78e-84 280 32 4 549 3 lcnC Lactococcin transport/processing ATP-binding protein LcnC-like Lactococcus lactis subsp. lactis (strain IL1403)
Q00564 2.87e-84 280 32 5 550 3 lcnC Lactococcin-A transport/processing ATP-binding protein LcnC Lactococcus lactis subsp. lactis
P36497 2.36e-82 275 31 5 548 3 pedD Pediocin PA-1 transport/processing ATP-binding protein PedD Pediococcus acidilactici
Q1QX69 8.95e-80 264 32 4 515 3 msbA ATP-dependent lipid A-core flippase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
O31708 2.03e-79 264 31 8 559 3 yknV Uncharacterized ABC transporter ATP-binding protein YknV Bacillus subtilis (strain 168)
P59653 3.93e-79 266 30 5 556 1 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q03727 3.97e-79 266 30 5 556 3 comA Transport/processing ATP-binding protein ComA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4QPI4 8.17e-79 262 33 7 515 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain 86-028NP)
Q5QU36 5.03e-78 259 31 8 522 3 msbA ATP-dependent lipid A-core flippase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q12M46 9.04e-78 259 32 4 499 3 msbA ATP-dependent lipid A-core flippase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q6LPK6 3.43e-77 258 30 5 525 3 msbA ATP-dependent lipid A-core flippase Photobacterium profundum (strain SS9)
Q87R16 1.18e-76 256 32 5 523 3 msbA ATP-dependent lipid A-core flippase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CMG7 1.45e-76 256 31 8 521 3 msbA ATP-dependent lipid A-core flippase Pasteurella multocida (strain Pm70)
Q2SIN5 2.71e-76 255 32 6 518 3 msbA ATP-dependent lipid A-core flippase Hahella chejuensis (strain KCTC 2396)
Q8DAV2 3.62e-76 254 30 4 521 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain CMCP6)
Q7MJ07 5.23e-76 254 30 4 521 3 msbA ATP-dependent lipid A-core flippase Vibrio vulnificus (strain YJ016)
Q6AJW3 6.85e-76 254 30 3 558 3 msbA ATP-dependent lipid A-core flippase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q2LVL0 1.08e-75 254 32 3 478 3 msbA ATP-dependent lipid A-core flippase Syntrophus aciditrophicus (strain SB)
Q10418 3.01e-75 256 30 7 561 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q7VL52 4.58e-75 252 32 5 505 3 msbA ATP-dependent lipid A-core flippase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q5E0F2 7.5e-75 251 30 4 521 3 msbA ATP-dependent lipid A-core flippase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q65U21 1.1e-74 251 32 7 521 3 msbA ATP-dependent lipid A-core flippase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
P44407 1.66e-74 250 32 9 517 3 msbA ATP-dependent lipid A-core flippase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I4C5 1.32e-73 248 31 9 549 3 msbA ATP-dependent lipid A-core flippase Histophilus somni (strain 129Pt)
P45861 1.53e-73 248 30 4 560 1 ywjA Uncharacterized ABC transporter ATP-binding protein YwjA Bacillus subtilis (strain 168)
Q2NUA5 3.89e-73 247 29 5 522 3 msbA ATP-dependent lipid A-core flippase Sodalis glossinidius (strain morsitans)
Q0HTS8 5.87e-73 247 31 4 499 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-7)
Q0HHH4 5.87e-73 247 31 4 499 3 msbA ATP-dependent lipid A-core flippase Shewanella sp. (strain MR-4)
Q3J7R8 7.51e-73 246 30 3 557 3 msbA ATP-dependent lipid A-core flippase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q0VQP5 1.04e-72 246 32 7 495 3 msbA ATP-dependent lipid A-core flippase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q1RDU4 2.09e-72 245 30 6 524 3 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain UTI89 / UPEC)
Q8FJB1 2.09e-72 245 30 6 524 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJD9 2.09e-72 245 30 6 524 3 msbA ATP-dependent lipid A-core flippase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q32E34 3.39e-72 244 30 6 524 3 msbA ATP-dependent lipid A-core flippase Shigella dysenteriae serotype 1 (strain Sd197)
Q31YT6 3.39e-72 244 30 6 524 3 msbA ATP-dependent lipid A-core flippase Shigella boydii serotype 4 (strain Sb227)
P60752 3.39e-72 244 30 6 524 1 msbA ATP-dependent lipid A-core flippase Escherichia coli (strain K12)
P60753 3.39e-72 244 30 6 524 1 msbA ATP-dependent lipid A-core flippase Escherichia coli O157:H7
Q7NZU6 3.65e-72 244 29 7 562 3 msbA ATP-dependent lipid A-core flippase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q83LP0 8.23e-72 243 30 6 524 3 msbA ATP-dependent lipid A-core flippase Shigella flexneri
Q8EDF0 9.52e-72 243 30 4 499 3 msbA ATP-dependent lipid A-core flippase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3Z3K7 1.46e-71 243 30 6 524 3 msbA ATP-dependent lipid A-core flippase Shigella sonnei (strain Ss046)
P35598 2.09e-71 242 32 13 558 3 exp8 Putative ABC transporter ATP-binding protein exp8 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q080T2 2.31e-71 243 30 4 497 3 msbA ATP-dependent lipid A-core flippase Shewanella frigidimarina (strain NCIMB 400)
Q5PGH0 2.52e-71 242 30 6 524 3 msbA ATP-dependent lipid A-core flippase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q7N6C6 4.28e-71 241 30 4 500 3 msbA ATP-dependent lipid A-core flippase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9KQW9 5.74e-71 241 29 5 522 1 msbA ATP-dependent lipid A-core flippase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q5RKI8 7.41e-71 244 30 5 495 2 Abcb8 Mitochondrial potassium channel ATP-binding subunit Rattus norvegicus
Q8XXB6 8.81e-71 241 30 6 512 3 msbA ATP-dependent lipid A-core flippase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9FNU2 9.92e-71 242 30 5 527 2 ABCB25 ABC transporter B family member 25 Oryza sativa subsp. japonica
Q6D437 1.16e-70 240 29 6 521 3 msbA ATP-dependent lipid A-core flippase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P63359 1.31e-70 240 30 6 524 1 msbA ATP-dependent lipid A-core flippase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63360 1.31e-70 240 30 6 524 3 msbA ATP-dependent lipid A-core flippase Salmonella typhi
Q57R14 1.31e-70 240 30 6 524 3 msbA ATP-dependent lipid A-core flippase Salmonella choleraesuis (strain SC-B67)
Q5RFQ9 1.81e-70 243 30 5 495 2 ABCB8 Mitochondrial potassium channel ATP-binding subunit Pongo abelii
Q9CXJ4 3.04e-70 242 30 5 495 1 Abcb8 Mitochondrial potassium channel ATP-binding subunit Mus musculus
G5EFD4 9.15e-70 242 30 11 582 2 hmt-1 Heavy metal tolerance factor 1 Caenorhabditis elegans
Q8D2U8 2.19e-69 237 30 3 496 3 msbA ATP-dependent lipid A-core flippase Wigglesworthia glossinidia brevipalpis
Q9WYC4 3.08e-69 237 28 7 557 1 TM_0288 Uncharacterized ABC transporter ATP-binding protein TM_0288 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P55469 3.23e-69 236 30 6 511 3 NGR_a03510 Uncharacterized ABC transporter ATP-binding protein y4gM Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q6F9X0 6.9e-69 235 33 3 470 3 msbA ATP-dependent lipid A-core flippase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
O07550 7.65e-69 235 30 9 519 1 yheI Probable multidrug resistance ABC transporter ATP-binding/permease protein YheI Bacillus subtilis (strain 168)
B2GUP8 9.66e-69 238 33 8 484 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Xenopus tropicalis
Q66CI3 1.43e-68 234 29 5 523 3 msbA ATP-dependent lipid A-core flippase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CGH0 1.43e-68 234 29 5 523 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZGA9 1.43e-68 234 29 5 523 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis
Q1CA68 1.43e-68 234 29 5 523 3 msbA ATP-dependent lipid A-core flippase Yersinia pestis bv. Antiqua (strain Antiqua)
Q56A55 1.96e-68 237 32 10 495 2 abcb8 Mitochondrial potassium channel ATP-binding subunit Danio rerio
Q15UY7 5.03e-68 233 29 5 521 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q483B6 5.72e-68 233 28 6 564 3 msbA1 ATP-dependent lipid A-core flippase 1 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9NUT2 6.18e-68 236 30 5 495 1 ABCB8 Mitochondrial potassium channel ATP-binding subunit Homo sapiens
Q3IGX5 7.93e-68 233 30 6 515 3 msbA ATP-dependent lipid A-core flippase Pseudoalteromonas translucida (strain TAC 125)
P9WQJ3 1.81e-67 233 28 4 486 1 Rv1272c Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ2 1.81e-67 233 28 4 486 3 MT1310 Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63398 1.81e-67 233 28 4 486 3 BQ2027_MB1303C Fatty acid ABC transporter ATP-binding/permease protein Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9QYJ4 2.53e-67 235 29 8 541 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Rattus norvegicus
Q9JJ59 2.97e-67 235 29 8 541 1 Abcb9 ABC-type oligopeptide transporter ABCB9 Mus musculus
Q492S9 3.13e-67 231 30 4 506 3 msbA ATP-dependent lipid A-core flippase Blochmanniella pennsylvanica (strain BPEN)
Q9NP78 5.82e-67 234 29 8 544 1 ABCB9 ABC-type oligopeptide transporter ABCB9 Homo sapiens
Q1BUV6 6.35e-67 230 30 6 515 3 msbA ATP-dependent lipid A-core flippase Burkholderia orbicola (strain AU 1054)
P54719 7.72e-67 230 28 3 551 3 yfiC Uncharacterized ABC transporter ATP-binding protein YfiC Bacillus subtilis (strain 168)
Q54BU4 1.27e-66 235 30 10 550 3 abcB1 ABC transporter B family member 1 Dictyostelium discoideum
Q0A4U4 2.42e-66 229 32 7 473 3 msbA ATP-dependent lipid A-core flippase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q3SFZ6 7.04e-66 227 30 4 498 3 msbA ATP-dependent lipid A-core flippase Thiobacillus denitrificans (strain ATCC 25259)
Q5ZUH9 7.34e-66 228 28 10 579 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q39E73 7.41e-66 228 31 9 520 3 msbA ATP-dependent lipid A-core flippase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
O07549 7.58e-66 229 29 7 503 1 yheH Probable multidrug resistance ABC transporter ATP-binding/permease protein YheH Bacillus subtilis (strain 168)
Q1LQD3 1.45e-65 227 29 7 513 3 msbA ATP-dependent lipid A-core flippase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q63VX7 6.78e-65 225 29 4 510 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain K96243)
Q3JUI6 6.78e-65 225 29 4 510 3 msbA ATP-dependent lipid A-core flippase Burkholderia pseudomallei (strain 1710b)
Q62IG3 6.78e-65 225 29 4 510 3 msbA ATP-dependent lipid A-core flippase Burkholderia mallei (strain ATCC 23344)
P43245 7.98e-65 233 33 10 472 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
P43245 9.09e-48 182 29 14 508 2 Abcb1 ATP-dependent translocase ABCB1 Rattus norvegicus
Q4WPP6 1.29e-64 228 34 9 496 2 mdr2 ABC multidrug transporter mdr2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8RY46 1.44e-64 226 31 15 531 1 ABCB26 ABC transporter B family member 26, chloroplastic Arabidopsis thaliana
Q1GZI0 1.9e-64 224 31 7 533 3 msbA ATP-dependent lipid A-core flippase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
P21449 2.43e-64 231 32 10 480 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
P21449 2.49e-49 187 28 10 497 2 PGY2 Multidrug resistance protein 2 Cricetulus griseus
Q5X498 3.42e-64 223 28 12 589 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Paris)
Q83D84 6.83e-64 222 30 9 535 3 msbA ATP-dependent lipid A-core flippase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q142P6 7.3e-64 222 31 6 493 3 msbA ATP-dependent lipid A-core flippase Paraburkholderia xenovorans (strain LB400)
Q2SZW0 8.98e-64 222 28 4 510 3 msbA ATP-dependent lipid A-core flippase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9SYI3 9.81e-64 229 33 8 468 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
Q9SYI3 8.56e-49 186 33 8 390 3 ABCB5 ABC transporter B family member 5 Arabidopsis thaliana
P16875 1.16e-63 229 33 15 540 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16875 1.8e-60 220 32 11 488 3 MDR1 Multidrug resistance protein 1 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P06795 1.2e-63 229 33 9 469 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P06795 1.2e-50 191 29 9 482 1 Abcb1b ATP-dependent translocase ABCB1 Mus musculus
P21448 1.42e-63 229 33 7 468 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21448 8.07e-51 191 28 9 510 1 ABCB1 ATP-dependent translocase ABCB1 Cricetulus griseus
P21447 1.75e-63 229 33 10 470 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
P21447 6.76e-51 192 28 9 510 1 Abcb1a ATP-dependent translocase ABCB1 Mus musculus
Q5WVN2 1.96e-63 221 28 12 589 3 msbA ATP-dependent lipid A-core flippase Legionella pneumophila (strain Lens)
P70864 2.66e-63 221 30 8 479 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis
P77265 2.73e-63 221 29 8 551 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Escherichia coli (strain K12)
A1USS5 3.1e-63 221 30 8 479 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q480N3 3.89e-63 220 29 6 532 3 msbA2 ATP-dependent lipid A-core flippase 2 Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P21439 4.13e-63 228 32 6 482 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
P21439 1.33e-50 191 29 10 520 1 ABCB4 Phosphatidylcholine translocator ABCB4 Homo sapiens
Q57180 5.28e-63 220 31 10 487 3 HI_1051 Uncharacterized ABC transporter ATP-binding protein HI_1051 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P34712 7.79e-63 227 30 10 498 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
P34712 3.65e-51 192 30 10 500 1 pgp-1 Multidrug resistance protein pgp-1 Caenorhabditis elegans
Q9HUG8 8.89e-63 219 30 7 483 3 msbA ATP-dependent lipid A-core flippase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P08183 1.29e-62 226 32 8 475 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
P08183 3.03e-49 187 28 10 486 1 ABCB1 ATP-dependent translocase ABCB1 Homo sapiens
Q21NS8 1.33e-62 219 29 6 515 3 msbA ATP-dependent lipid A-core flippase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21WN9 1.43e-62 218 30 5 540 3 msbA ATP-dependent lipid A-core flippase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q31FG2 1.48e-62 218 30 4 503 3 msbA ATP-dependent lipid A-core flippase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5NIG3 1.52e-62 219 27 8 560 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14JW6 1.52e-62 219 27 8 560 1 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. tularensis (strain FSC 198)
G5EG61 1.53e-62 226 30 9 508 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
G5EG61 5.65e-47 180 33 8 384 2 pgp-14 P-glycoprotein 14 Caenorhabditis elegans
Q0BKJ3 1.65e-62 219 27 8 560 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A1U9 1.65e-62 219 27 8 560 3 msbA ATP-dependent lipid A-core flippase Francisella tularensis subsp. holarctica (strain LVS)
Q60AA3 2.4e-62 218 29 7 528 3 msbA ATP-dependent lipid A-core flippase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7VR44 2.65e-62 218 29 3 493 3 msbA ATP-dependent lipid A-core flippase Blochmanniella floridana
Q9C7F2 4.09e-62 225 35 9 438 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9C7F2 3.24e-51 192 28 10 517 3 ABCB14 ABC transporter B family member 14 Arabidopsis thaliana
Q9M0G9 4.68e-62 219 30 11 534 1 ABCB24 ABC transporter B family member 24, mitochondrial Arabidopsis thaliana
Q0WML0 5.08e-62 218 30 8 512 1 ABCB27 ABC transporter B family member 27 Arabidopsis thaliana
Q9FUT3 7.85e-62 219 29 8 534 1 ABCB23 ABC transporter B family member 23, mitochondrial Arabidopsis thaliana
Q1QBW0 7.86e-62 217 30 3 476 3 msbA ATP-dependent lipid A-core flippase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
P54718 9.21e-62 216 31 5 422 3 yfiB Uncharacterized ABC transporter ATP-binding protein YfiB Bacillus subtilis (strain 168)
P21440 1.1e-61 223 31 6 482 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
P21440 6.93e-54 201 28 15 569 1 Abcb4 Phosphatidylcholine translocator ABCB4 Mus musculus
Q46Y89 1.15e-61 216 29 8 515 3 msbA ATP-dependent lipid A-core flippase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q9GTN7 1.44e-61 223 29 7 559 1 tagA Serine protease/ABC transporter B family protein tagA Dictyostelium discoideum
P23174 1.51e-61 223 32 6 477 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
P23174 1.29e-52 197 27 11 547 2 ABCB4 Phosphatidylcholine translocator ABCB4 Cricetulus griseus
Q9JI39 1.9e-61 218 30 10 560 1 Abcb10 ATP-binding cassette sub-family B member 10, mitochondrial Mus musculus
Q9LVM1 2.08e-61 218 29 9 528 1 ABCB25 ABC transporter B family member 25, mitochondrial Arabidopsis thaliana
Q9ZNB0 2.67e-61 215 27 6 561 3 SCO0742 Uncharacterized ABC transporter ATP-binding protein SCO0742 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8T9W4 2.9e-61 223 31 9 489 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q8T9W4 1.08e-45 176 27 13 572 3 abcB3 ABC transporter B family member 3 Dictyostelium discoideum
Q47908 2.92e-61 215 28 8 557 3 msbA ATP-dependent lipid A-core flippase Francisella novicida
Q54W24 7.6e-61 218 29 8 515 3 abcB4 ABC transporter B family member 4 Dictyostelium discoideum
Q08201 9.69e-61 221 31 6 482 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
Q08201 1.63e-53 199 28 15 569 1 Abcb4 Phosphatidylcholine translocator ABCB4 Rattus norvegicus
O14286 1.34e-60 216 28 11 528 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q02592 1.4e-60 218 28 16 573 2 hmt1 Heavy metal tolerance protein Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8T9W2 1.98e-60 215 30 6 510 3 abcB5 ABC transporter B family member 5 Dictyostelium discoideum
Q4FS42 2.01e-60 213 29 3 476 3 msbA ATP-dependent lipid A-core flippase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q9LSJ6 2.84e-60 219 28 12 540 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q9LSJ6 1.2e-52 197 29 14 506 3 ABCB17 ABC transporter B family member 17 Arabidopsis thaliana
Q4KJB2 2.94e-60 213 29 8 508 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9C7F8 3.42e-60 219 34 8 438 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q9C7F8 5.26e-53 198 27 9 505 3 ABCB13 ABC transporter B family member 13 Arabidopsis thaliana
Q8K985 3.77e-60 212 30 6 484 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9M1Q9 5.15e-60 219 31 12 486 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
Q9M1Q9 1.25e-50 191 42 4 244 1 ABCB21 ABC transporter B family member 21 Arabidopsis thaliana
J9VF33 6.76e-60 218 32 11 484 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VF33 2.89e-45 175 31 10 435 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q7W9N7 6.96e-60 212 27 12 570 3 msbA ATP-dependent lipid A-core flippase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WH20 6.96e-60 212 27 12 570 3 msbA ATP-dependent lipid A-core flippase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VWD8 7.25e-60 212 27 12 570 3 msbA ATP-dependent lipid A-core flippase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q6G2Z5 9.11e-60 211 30 7 449 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
O80725 9.44e-60 218 31 12 485 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
O80725 4.1e-51 192 43 4 245 1 ABCB4 ABC transporter B family member 4 Arabidopsis thaliana
Q6FZF2 1.03e-59 211 29 10 481 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bartonella quintana (strain Toulouse)
Q9DC29 1.12e-59 215 27 13 563 1 Abcb6 ATP-binding cassette sub-family B member 6 Mus musculus
A1KF14 1.16e-59 218 29 2 469 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A1KF14 1.07e-42 167 29 4 381 1 BCG_0231 Multidrug efflux ATP-binding/permease protein BCG_0231 Mycobacterium bovis (strain BCG / Pasteur 1173P2)
O53645 1.22e-59 218 29 2 469 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O53645 1.16e-42 167 29 4 381 1 Rv0194 Multidrug efflux ATP-binding/permease protein Rv0194 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O70595 1.86e-59 214 27 13 563 1 Abcb6 ATP-binding cassette sub-family B member 6 Rattus norvegicus
Q9NRK6 2e-59 213 28 11 571 1 ABCB10 ATP-binding cassette sub-family B member 10, mitochondrial Homo sapiens
Q3KJ31 2.13e-59 210 29 7 499 3 msbA ATP-dependent lipid A-core flippase Pseudomonas fluorescens (strain Pf0-1)
P22638 3.4e-59 210 31 8 474 2 hepA Heterocyst differentiation ATP-binding protein HepA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q00449 3.68e-59 216 30 13 514 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q00449 1.69e-50 191 41 3 245 2 Mdr49 Multidrug resistance protein homolog 49 Drosophila melanogaster
Q7RX59 4.07e-59 212 29 13 535 3 fes-4 Iron-sulfur clusters transporter atm1, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q6C6N0 7.43e-59 211 29 13 572 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Yarrowia lipolytica (strain CLIB 122 / E 150)
A0A095C325 9.9e-59 215 32 12 492 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
A0A095C325 1.54e-43 170 31 11 435 1 MDR1 ABC multidrug transporter MDR1 Cryptococcus deuterogattii (strain R265)
Q9NP58 1.02e-58 213 28 15 530 1 ABCB6 ATP-binding cassette sub-family B member 6 Homo sapiens
Q2M3G0 1.48e-58 214 31 7 475 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
Q2M3G0 2.44e-51 193 35 8 380 1 ABCB5 ATP-binding cassette sub-family B member 5 Homo sapiens
B5X0E4 1.5e-58 214 28 11 528 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
B5X0E4 6.61e-56 206 29 10 532 2 Abcb5 ATP-binding cassette sub-family B member 5 Mus musculus
Q08D64 1.82e-58 212 29 7 515 2 abcb6 ATP-binding cassette sub-family B member 6 Xenopus tropicalis
Q9LJX0 5.4e-58 213 43 4 279 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q9LJX0 2.59e-53 199 43 2 244 1 ABCB19 ABC transporter B family member 19 Arabidopsis thaliana
Q2HIE9 5.43e-58 207 29 11 507 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q9JXR3 6.19e-58 207 29 1 416 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9LSJ5 6.79e-58 212 28 10 522 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q9LSJ5 1.56e-51 194 27 14 508 3 ABCB18 ABC transporter B family member 18 Arabidopsis thaliana
Q54RU1 9.24e-58 207 27 13 590 3 abcB6 ABC transporter B family member 6 Dictyostelium discoideum
Q4PH16 9.96e-58 209 28 12 538 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q5F4X8 1.14e-57 206 29 1 416 3 msbA ATP-dependent lipid A-core flippase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JW59 1.58e-57 206 29 1 416 3 msbA ATP-dependent lipid A-core flippase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q48P40 2.06e-57 205 32 11 499 3 msbA ATP-dependent lipid A-core flippase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZZ16 3.23e-57 204 32 11 499 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. syringae (strain B728a)
Q5P2S7 3.26e-57 204 30 7 479 3 msbA ATP-dependent lipid A-core flippase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A0A125QXJ1 4.21e-57 208 26 13 563 2 ABCB6 ATP-binding cassette sub-family B member 6 Mesocricetus auratus
Q88D92 5.35e-57 204 30 8 485 3 msbA ATP-dependent lipid A-core flippase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4HVU7 9.68e-57 205 28 12 558 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q2KYS6 1.03e-56 203 27 12 572 3 msbA ATP-dependent lipid A-core flippase Bordetella avium (strain 197N)
P16876 1.14e-56 209 30 11 520 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16876 9.44e-54 200 27 8 546 3 MDR3 Multidrug resistance protein 3 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
Q87VF3 1.19e-56 203 31 9 495 3 msbA ATP-dependent lipid A-core flippase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
O06967 1.94e-56 202 29 6 550 1 bmrA Multidrug resistance ABC transporter ATP-binding/permease protein BmrA Bacillus subtilis (strain 168)
P16877 2.28e-56 208 41 3 279 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
P16877 5.85e-54 201 28 13 540 3 MDR4 Multidrug resistance protein 4 Entamoeba histolytica (strain ATCC 30459 / HM-1:IMSS / ABRM)
E7F6F7 2.97e-56 204 31 10 487 3 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Danio rerio
Q9LSJ2 3.19e-56 207 30 9 505 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9LSJ2 1.22e-54 203 28 16 548 3 ABCB22 ABC transporter B family member 22 Arabidopsis thaliana
Q9CHL8 3.47e-56 201 28 9 510 1 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. lactis (strain IL1403)
Q2ULH4 4.43e-56 204 28 8 528 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P18767 5.85e-56 201 26 11 570 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium meliloti (strain 1021)
Q9LHD1 6.35e-56 206 29 11 527 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q9LHD1 5.01e-48 183 28 7 474 3 ABCB15 ABC transporter B family member 15 Arabidopsis thaliana
Q47JR8 1.07e-55 200 29 3 495 3 msbA ATP-dependent lipid A-core flippase Dechloromonas aromatica (strain RCB)
H2LNR5 2.98e-55 202 30 8 484 1 abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Oryzias latipes
P75094 3.2e-55 200 27 6 443 3 MPN_019 Putative ABC transporter ATP-binding protein MG015 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9SGY1 4.28e-55 204 29 9 497 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q9SGY1 8.32e-52 194 28 11 528 1 ABCB10 ABC transporter B family member 10 Arabidopsis thaliana
Q2UPC0 5.7e-55 201 28 12 520 3 aclQ ABC transporter aclQ Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q54BT3 5.76e-55 204 29 6 459 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
Q54BT3 4.61e-48 183 27 10 553 3 abcB2 ABC transporter B family member 2 Dictyostelium discoideum
P34713 5.79e-55 204 31 3 423 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P34713 5.32e-49 186 42 2 247 2 pgp-3 Multidrug resistance protein pgp-3 Caenorhabditis elegans
P47261 6.02e-55 198 36 2 257 3 MG015 Putative ABC transporter ATP-binding protein MG015 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q6YUU5 7.21e-55 203 29 10 559 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
Q6YUU5 7.06e-54 201 28 8 562 3 Os02g0190300 Putative multidrug resistance protein Oryza sativa subsp. japonica
O75027 7.75e-55 201 30 9 483 1 ABCB7 Iron-sulfur clusters transporter ABCB7, mitochondrial Homo sapiens
Q704E8 1.02e-54 200 30 9 483 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Rattus norvegicus
Q9SYI2 1.77e-54 202 31 9 482 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q9SYI2 4.13e-47 181 28 12 528 3 ABCB3 ABC transporter B family member 3 Arabidopsis thaliana
Q8G0T8 2.2e-54 197 25 8 558 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella suis biovar 1 (strain 1330)
Q8T9W1 2.35e-54 202 42 3 240 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q8T9W1 0.000352 47 20 5 288 3 tagD Serine protease/ABC transporter B family protein tagD Dictyostelium discoideum
Q5B1Q2 2.51e-54 199 37 6 313 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2G506 4.43e-54 196 28 5 507 1 atm1 ATM1-type heavy metal exporter Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q9LHK4 5.03e-54 201 28 11 539 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q9LHK4 1.3e-47 182 29 9 509 5 ABCB8 Putative ABC transporter B family member 8 Arabidopsis thaliana
Q8YH20 5.27e-54 196 25 8 558 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q61102 6.61e-54 198 30 9 483 1 Abcb7 Iron-sulfur clusters transporter ABCB7, mitochondrial Mus musculus
J9VWU3 8.24e-54 197 29 12 528 2 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q9LSJ8 8.42e-54 200 28 9 521 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
Q9LSJ8 5.76e-50 189 28 13 512 2 ABCB16 ABC transporter B family member 16 Arabidopsis thaliana
P0C529 8.84e-54 195 25 8 558 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus biovar 1 (strain 9-941)
Q2YQ73 8.84e-54 195 25 8 558 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Brucella abortus (strain 2308)
Q4WTT9 1.14e-53 200 30 11 483 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WTT9 5.36e-49 186 28 11 493 2 mdr1 ABC multidrug transporter mdr1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q07QX6 1.28e-53 195 29 11 490 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q20Z38 1.38e-53 194 40 1 262 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q87EF0 1.46e-53 194 27 9 556 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q00748 2.01e-53 199 31 9 477 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
Q00748 2.38e-49 187 31 8 435 1 Mdr65 Multidrug resistance protein homolog 65 Drosophila melanogaster
A0A0D1BUH6 2.22e-53 199 29 8 513 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
A0A0D1BUH6 1.94e-45 176 29 14 466 2 atr1 ABC-type transporter atr1 Ustilago maydis (strain 521 / FGSC 9021)
Q2J0F4 2.72e-53 194 30 3 419 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain HaA2)
Q9PEE7 3.39e-53 193 27 9 556 3 msbA ATP-dependent lipid A-core flippase Xylella fastidiosa (strain 9a5c)
Q9FWX7 4.48e-53 198 30 12 487 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
Q9FWX7 2.31e-52 196 28 11 530 2 ABCB11 ABC transporter B family member 11 Arabidopsis thaliana
P97998 4.51e-53 194 30 10 458 3 MDL1 ATP-dependent permease MDL1 Candida albicans
Q89A96 5.21e-53 192 29 12 579 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q6CX96 8.25e-53 194 28 11 512 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8LPK2 8.3e-53 197 32 13 458 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q8LPK2 2.27e-50 190 31 10 438 1 ABCB2 ABC transporter B family member 2 Arabidopsis thaliana
Q6N1Y7 8.8e-53 192 30 3 419 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A0A059JJ46 9.45e-53 197 29 11 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JJ46 5.89e-49 186 28 16 531 2 MDR2 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
F2RP52 1e-52 197 29 11 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RP52 2.55e-49 187 28 16 531 2 MDR2 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2PRR1 1e-52 197 29 11 516 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2PRR1 2.55e-49 187 28 16 531 2 MDR2 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
Q1QH37 1.01e-52 192 37 3 302 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
P40416 1.09e-52 194 30 17 529 1 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
F2T1C4 1.23e-52 197 29 11 516 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2T1C4 8.55e-48 182 29 13 480 1 MDR2 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9FHF1 1.48e-52 197 31 9 442 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
Q9FHF1 1.39e-48 185 28 15 527 3 ABCB7 ABC transporter B family member 7 Arabidopsis thaliana
P57551 1.48e-52 191 29 9 544 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q23868 1.55e-52 197 40 2 243 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q23868 0.000215 48 20 4 248 2 tagC Serine protease/ABC transporter B family protein tagC Dictyostelium discoideum
Q3SP57 1.68e-52 192 31 7 425 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q12C33 1.69e-52 191 28 11 510 3 msbA ATP-dependent lipid A-core flippase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q28433 2.1e-52 194 28 7 539 2 TAP1 Antigen peptide transporter 1 Gorilla gorilla gorilla
P97046 2.43e-52 191 26 5 503 3 lmrA Multidrug resistance ABC transporter ATP-binding and permease protein Lactococcus lactis subsp. cremoris (strain MG1363)
P0CL92 2.61e-52 193 28 10 529 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CL93 2.74e-52 193 28 10 529 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q8PKS5 2.95e-52 191 27 6 540 3 msbA ATP-dependent lipid A-core flippase Xanthomonas axonopodis pv. citri (strain 306)
Q3BTC8 3.84e-52 190 27 6 540 3 msbA ATP-dependent lipid A-core flippase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6FIK3 3.99e-52 192 28 12 514 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9Y8G1 4.22e-52 195 29 14 534 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q9Y8G1 1.51e-44 173 38 2 248 1 atrD ABC multidrug transporter atrD Emericella nidulans
Q03518 4.45e-52 193 28 7 539 1 TAP1 Antigen peptide transporter 1 Homo sapiens
Q9FWX8 4.87e-52 195 29 11 494 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
Q9FWX8 3.74e-51 192 29 10 484 2 ABCB12 ABC transporter B family member 12 Arabidopsis thaliana
A0A1U8QG99 4.9e-52 195 32 14 458 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A1U8QG99 4.04e-39 157 31 12 441 2 atrC ABC multidrug transporter atrC Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 5.89e-52 195 29 14 534 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BAY0 1.94e-44 172 39 3 251 1 atrD ABC multidrug transporter atrD Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
F2SQT8 7.56e-52 194 28 15 508 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
F2SQT8 3.67e-51 192 32 10 429 1 MDR5 ABC multidrug transporter MDR5 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q9QY30 8.73e-52 194 31 8 484 1 Abcb11 Bile salt export pump Mus musculus
Q9QY30 6.5e-48 183 26 7 501 1 Abcb11 Bile salt export pump Mus musculus
P22520 9.18e-52 191 28 3 516 3 cvaB Colicin V secretion/processing ATP-binding protein CvaB Escherichia coli
P9WQJ7 9.6e-52 189 30 1 340 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ6 9.6e-52 189 30 1 340 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63394 9.6e-52 189 30 1 340 3 irtB Mycobactin import ATP-binding/permease protein IrtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q89A97 1.09e-51 189 28 7 491 3 mdlA Multidrug resistance-like ATP-binding protein MdlA Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9Y8G2 1.3e-51 194 44 4 245 2 atrC ABC multidrug transporter atrC Emericella nidulans
Q9Y8G2 4.35e-39 156 29 16 504 2 atrC ABC multidrug transporter atrC Emericella nidulans
O70127 1.41e-51 194 29 12 513 1 Abcb11 Bile salt export pump Rattus norvegicus
O70127 2.03e-51 193 31 9 486 1 Abcb11 Bile salt export pump Rattus norvegicus
Q9ZR72 1.82e-51 193 43 2 246 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q9ZR72 1.14e-47 182 37 3 279 1 ABCB1 ABC transporter B family member 1 Arabidopsis thaliana
Q5H0H0 1.86e-51 189 27 6 504 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E7 1.86e-51 189 27 6 504 3 msbA ATP-dependent lipid A-core flippase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q4WLN7 2.06e-51 191 28 10 531 3 atm1 Iron-sulfur clusters transporter atm1, mitochondrial Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B8K1W2 2.79e-51 193 32 12 482 1 Abcb11e Bile salt export pump Canis lupus familiaris
B8K1W2 1.78e-48 184 27 8 518 1 Abcb11e Bile salt export pump Canis lupus familiaris
Q6Q876 4.09e-51 192 30 13 525 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
Q6Q876 1.15e-48 185 31 10 423 2 sirA Multidrug resistance protein sirA Leptosphaeria maculans
H6TB12 7.02e-51 192 30 11 490 1 mdr Sophorolipid transporter Starmerella bombicola
H6TB12 3.4e-45 175 37 4 274 1 mdr Sophorolipid transporter Starmerella bombicola
Q71ED1 9.13e-51 186 26 11 569 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium vitis
Q57538 1.02e-50 186 27 8 503 1 HI_0664 Probable ABC transporter ATP-binding/permease protein HI_0664 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36372 1.43e-50 188 26 8 516 1 Tap2 Antigen peptide transporter 2 Rattus norvegicus
A0A348AXX9 1.44e-50 191 29 16 510 2 kk1G ABC-type transporter kk1G Curvularia clavata
A0A348AXX9 1.95e-42 167 26 16 570 2 kk1G ABC-type transporter kk1G Curvularia clavata
Q8P8W4 1.62e-50 186 27 7 543 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV65 1.62e-50 186 27 7 543 3 msbA ATP-dependent lipid A-core flippase Xanthomonas campestris pv. campestris (strain 8004)
Q8LPQ6 4.39e-50 187 32 6 430 2 ABCB28 ABC transporter B family member 28 Arabidopsis thaliana
Q9M0M2 4.62e-50 189 42 6 272 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q9M0M2 8.33e-50 188 41 3 247 3 ABCB9 ABC transporter B family member 9 Arabidopsis thaliana
Q6BXD7 4.92e-50 186 28 14 577 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q13BH6 7.1e-50 184 41 1 241 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB5)
G7CBF6 1.12e-49 183 27 9 477 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
P54683 2.17e-49 187 40 3 246 3 tagB Serine protease/ABC transporter B family protein tagB Dictyostelium discoideum
A0R6H8 2.6e-49 186 41 4 253 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9EXN5 2.81e-49 184 28 5 517 3 mchF Probable microcin-H47 secretion/processing ATP-binding protein MchF Escherichia coli
A0A1U9YI12 3.79e-49 186 29 14 503 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
A0A1U9YI12 1.12e-45 176 29 10 473 2 verA ABC-type transmembrane transporter verA Clonostachys rogersoniana
Q4WD46 3.91e-49 186 29 12 514 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WD46 1.85e-48 184 31 9 435 2 fsqE ABC-type transporter fsqE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 5.54e-49 186 27 12 523 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WA92 8.55e-34 140 26 19 532 2 abcE ABC multidrug transporter E Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P36619 6.61e-49 186 29 16 574 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P36619 4.77e-46 177 31 6 418 3 pmd1 Leptomycin B resistance protein pmd1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q89UT8 9.6e-49 181 29 4 420 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q983H5 1.94e-48 180 28 8 449 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P36371 2.18e-48 182 27 8 516 1 Tap2 Antigen peptide transporter 2 Mus musculus
Q9LZB8 2.19e-48 181 32 3 402 1 ABCB29 ABC transporter B family member 29, chloroplastic Arabidopsis thaliana
O95342 3.03e-48 184 27 7 518 1 ABCB11 Bile salt export pump Homo sapiens
O95342 2.6e-47 181 30 9 482 1 ABCB11 Bile salt export pump Homo sapiens
P9WQJ9 3.25e-48 183 39 3 254 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQJ8 3.25e-48 183 39 3 254 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63392 3.25e-48 183 39 3 254 3 irtA Mycobactin import ATP-binding/permease protein IrtA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
G7CBF5 3.52e-48 183 37 2 247 1 irtA Mycobactin import ATP-binding/permease protein IrtA Mycolicibacterium thermoresistibile (strain ATCC 19527 / DSM 44167 / CIP 105390 / JCM 6362 / NCTC 10409 / 316)
Q2K342 5.4e-48 179 24 8 565 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q751N2 6.84e-48 180 27 13 518 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q59R09 1.12e-47 180 35 5 337 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8K984 1.48e-47 177 29 9 494 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9N0V3 2.53e-47 181 26 7 519 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
Q9N0V3 9.48e-40 159 40 1 243 2 ABCB11 Bile salt export pump Oryctolagus cuniculus
P33311 7.61e-47 178 31 8 415 1 MDL2 ATP-dependent permease MDL2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P23886 8.03e-47 176 26 10 519 1 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Escherichia coli (strain K12)
Q03024 1.18e-46 175 27 10 549 3 aprD Alkaline protease secretion ATP-binding protein AprD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0R6H7 1.72e-46 174 29 2 330 1 irtB Mycobactin import ATP-binding/permease protein IrtB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P94366 1.84e-46 174 27 10 523 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Bacillus subtilis (strain 168)
Q06034 1.94e-46 179 27 12 494 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q06034 4.33e-41 162 28 11 508 3 MDR1 Multidrug resistance protein 1 Leishmania enriettii
Q03519 2.13e-46 176 26 9 549 1 TAP2 Antigen peptide transporter 2 Homo sapiens
P0AAG5 4.46e-46 174 25 5 491 1 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli (strain K12)
P0AAG6 4.46e-46 174 25 5 491 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AAG7 4.46e-46 174 25 5 491 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Escherichia coli O157:H7
P57552 1.73e-45 172 35 5 314 3 mdlB Multidrug resistance-like ATP-binding protein MdlB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A0A059JK44 2.6e-45 175 25 11 576 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
A0A059JK44 2.3e-44 172 26 14 532 2 MDR4 ABC multidrug transporter MDR2 Trichophyton interdigitale (strain MR816)
S0EGU4 2.62e-45 175 30 6 391 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0EGU4 1.62e-26 118 36 8 293 2 BEA3 ABC transporter BEA3 Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
F2Q5G0 2.63e-45 175 25 11 581 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
F2Q5G0 4.93e-44 171 26 14 532 2 MDR4 ABC multidrug transporter MDR2 Trichophyton equinum (strain ATCC MYA-4606 / CBS 127.97)
P0A2V1 3.25e-45 171 27 7 448 1 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium radiobacter
P0A2V0 3.25e-45 171 27 7 448 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Agrobacterium fabrum (strain C58 / ATCC 33970)
F2RPA4 3.82e-45 175 25 11 576 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
F2RPA4 2.62e-43 169 37 3 241 2 MDR4 ABC multidrug transporter MDR2 Trichophyton tonsurans (strain CBS 112818)
Q1RJ91 4.03e-45 171 26 8 498 3 RBE_0492 Putative export ATP-binding/permease protein RBE_0492 Rickettsia bellii (strain RML369-C)
P33310 4.32e-45 172 33 8 421 1 MDL1 ATP-dependent permease MDL1, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P0CU83 4.61e-45 174 25 11 576 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
P0CU83 7.53e-45 174 26 11 524 2 MDR4 ABC multidrug transporter MDR2 Trichophyton rubrum (strain ATCC MYA-4607 / CBS 118892)
Q4UMZ3 5.39e-45 170 29 15 518 3 RF_0214 Putative export ATP-binding/permease protein RF_0214 Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1MAB5 5.64e-45 171 26 2 414 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q92GP9 1.03e-44 169 38 2 239 3 RC1073 Putative export ATP-binding/permease protein RC1073 Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P36370 1.06e-44 172 26 8 541 1 Tap1 Antigen peptide transporter 1 Rattus norvegicus
B2KWH4 1.78e-44 172 27 14 572 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
B2KWH4 6.29e-43 168 30 13 475 2 ABC1 ABC transporter 1 Ajellomyces capsulatus
Q9ZCM8 2.51e-44 169 28 10 514 3 RP696 Putative export ATP-binding/permease protein RP696 Rickettsia prowazekii (strain Madrid E)
Q68W42 2.51e-44 169 27 10 552 3 RT0691 Putative export ATP-binding/permease protein RT0691 Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P13568 4.77e-44 171 35 6 295 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
P13568 8.12e-35 144 26 11 534 3 MDR1 Multidrug resistance protein Plasmodium falciparum (isolate FC27 / Papua New Guinea)
Q4WSI1 8.67e-44 171 26 9 487 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WSI1 8.23e-43 167 26 6 451 2 mdr4 ABC multidrug transporter mdr4 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q10185 1.11e-43 170 27 12 478 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q10185 5.72e-14 79 26 12 383 1 abc2 ATP-binding cassette transporter abc2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P21958 1.29e-43 168 27 11 546 1 Tap1 Antigen peptide transporter 1 Mus musculus
Q7ANN4 1.51e-43 166 24 5 552 1 prsD Type I secretion system ATP-binding protein PrsD Rhizobium meliloti (strain 1021)
Q0P9C4 4.31e-43 165 39 3 241 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9Y7M7 5.64e-43 167 32 6 340 3 mdl1 ATP-dependent permease MDL1, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9M3B9 5.09e-42 165 30 9 460 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q9M3B9 1.6e-41 164 29 9 436 1 ABCB20 ABC transporter B family member 20 Arabidopsis thaliana
Q8LPT1 6.9e-42 165 29 7 455 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
Q8LPT1 1.1e-39 158 27 16 565 1 ABCB6 ABC transporter B family member 6 Arabidopsis thaliana
P0A4W5 1.96e-41 160 25 16 578 3 BQ2027_MB1304C Uncharacterized ABC transporter ATP-binding protein Mb1304c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WQJ1 1.96e-41 160 25 16 578 1 Rv1273c Uncharacterized ABC transporter ATP-binding protein Rv1273c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54P13 4.97e-41 162 29 13 482 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
Q54P13 3.97e-22 105 27 16 424 3 abcC8 ABC transporter C family member 8 Dictyostelium discoideum
P9WQJ0 5.44e-41 159 25 16 578 3 MT1311 Uncharacterized ABC transporter ATP-binding protein MT1311 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5A762 3.3e-40 160 27 15 516 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5A762 2.4e-14 80 23 19 515 1 MLT1 Multiple drug resistance-associated protein-like transporter 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
K3VYH8 1.4e-39 158 30 11 395 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
K3VYH8 1.91e-36 149 32 6 292 3 FPSE_09185 ABC transporter FPSE_09185 Fusarium pseudograminearum (strain CS3096)
Q9LZJ5 1.49e-38 155 24 10 534 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q9LZJ5 6.19e-23 107 29 7 250 1 ABCC14 ABC transporter C family member 14 Arabidopsis thaliana
Q6Y306 4.94e-38 153 25 15 554 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q6Y306 9.29e-29 125 31 7 287 2 Abcc12 ATP-binding cassette sub-family C member 12 Rattus norvegicus
Q80WJ6 5.03e-38 153 25 13 539 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
Q80WJ6 3.56e-27 120 33 6 235 1 Abcc12 ATP-binding cassette sub-family C member 12 Mus musculus
P68580 6.68e-38 152 24 9 536 3 sunT Sublancin-168-processing and transport ATP-binding protein sunT Bacillus phage SPbeta
P68579 6.68e-38 152 24 9 536 3 sunT SPbeta prophage-derived sublancin-168-processing and transport ATP-binding protein SunT Bacillus subtilis (strain 168)
P53049 7.52e-38 153 28 15 495 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53049 8.69e-16 84 30 6 225 1 YOR1 Oligomycin resistance ATP-dependent permease YOR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54VJ0 1.95e-37 152 27 11 488 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
Q54VJ0 3.33e-15 82 32 5 195 3 abcC2 ABC transporter C family member 2 Dictyostelium discoideum
P23596 2.27e-37 149 27 8 537 3 prtD Proteases secretion ATP-binding protein PrtD Dickeya chrysanthemi
Q9R1X5 2.71e-37 151 27 12 514 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
Q9R1X5 2.24e-18 93 30 5 220 1 Abcc5 ATP-binding cassette sub-family C member 5 Mus musculus
P71355 2.78e-37 148 25 12 544 3 HI_0663 Uncharacterized ABC transporter ATP-binding protein HI_0663 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9P5N0 4.53e-37 150 24 12 524 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P5N0 6.48e-13 75 27 4 213 1 abc3 Vacuolar heme ABC transmembrane exporter abc3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P33527 7.09e-37 150 28 12 487 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
P33527 5.16e-22 104 26 13 400 1 ABCC1 Multidrug resistance-associated protein 1 Homo sapiens
Q8HXQ5 7.56e-37 150 27 12 489 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
Q8HXQ5 6.2e-20 98 25 11 398 1 ABCC1 Multidrug resistance-associated protein 1 Bos taurus
P94367 7.74e-37 147 32 6 292 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Bacillus subtilis (strain 168)
P39109 1.25e-36 149 26 13 482 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P39109 4.78e-11 69 24 17 412 1 YCF1 Metal resistance protein YCF1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O15440 1.4e-36 149 27 13 514 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
O15440 3.86e-18 92 31 6 223 1 ABCC5 ATP-binding cassette sub-family C member 5 Homo sapiens
P78966 1.47e-36 149 28 6 412 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P78966 2.09e-31 133 35 4 242 3 mam1 Mating factor M secretion protein mam1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P12866 1.54e-36 149 26 13 537 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12866 2.05e-29 127 34 3 250 1 STE6 Alpha-factor-transporting ATPase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q52402 2.31e-36 146 25 9 554 3 aarD Transport ATP-binding protein AarD Providencia stuartii
Q864R9 3.1e-36 148 27 12 490 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q864R9 2.08e-22 105 27 13 400 1 ABCC1 Multidrug resistance-associated protein 1 Macaca fascicularis
Q7DM58 5.29e-36 147 24 10 565 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q7DM58 5.59e-23 107 30 7 245 1 ABCC4 ABC transporter C family member 4 Arabidopsis thaliana
Q9QYM0 7.19e-36 147 27 13 514 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q9QYM0 4.28e-18 92 30 5 220 2 Abcc5 ATP-binding cassette sub-family C member 5 Rattus norvegicus
Q8CG09 7.25e-36 147 26 9 481 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
Q8CG09 1.71e-22 105 22 15 565 1 Abcc1 Multidrug resistance-associated protein 1 Rattus norvegicus
P47260 8.08e-36 145 32 4 284 3 MG014 Putative ABC transporter ATP-binding protein MG014 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9VL32 8.73e-36 147 33 4 269 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q9VL32 5.38e-09 63 28 7 196 1 Sur ATP-binding cassette sub-family C member Sur Drosophila melanogaster
Q6UR05 9.28e-36 147 27 12 487 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q6UR05 8.57e-20 97 25 12 400 1 ABCC1 Multidrug resistance-associated protein 1 Canis lupus familiaris
Q9LYS2 1.03e-35 146 25 10 493 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q9LYS2 5.36e-16 85 25 7 296 2 ABCC10 ABC transporter C family member 10 Arabidopsis thaliana
Q8ST87 4.52e-35 144 27 15 513 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q8ST87 1.79e-16 87 30 6 213 3 abcC10 ABC transporter C family member 10 Dictyostelium discoideum
Q54NL1 1.33e-34 143 25 18 512 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q54NL1 1.83e-12 74 29 6 203 3 abcC9 ABC transporter C family member 9 Dictyostelium discoideum
Q5F364 2.18e-34 142 25 8 480 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q5F364 5.02e-24 110 30 5 241 2 ABCC1 Multidrug resistance-associated protein 1 Gallus gallus
Q92887 2.21e-34 142 26 12 522 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
Q92887 8.17e-19 94 25 11 379 1 ABCC2 ATP-binding cassette sub-family C member 2 Homo sapiens
O35379 2.46e-34 142 26 9 481 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
O35379 1.1e-24 112 23 16 564 1 Abcc1 Multidrug resistance-associated protein 1 Mus musculus
Q96J65 3.1e-34 142 25 14 485 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q96J65 5.08e-27 120 33 5 224 1 ABCC12 ATP-binding cassette sub-family C member 12 Homo sapiens
Q63120 3.18e-34 142 25 11 481 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q63120 2.6e-20 99 26 11 381 1 Abcc2 ATP-binding cassette sub-family C member 2 Rattus norvegicus
Q54V86 3.91e-34 142 27 15 526 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q54V86 1.86e-13 77 31 5 195 3 abcC13 ABC transporter C family member 13 Dictyostelium discoideum
Q96J66 9.66e-34 140 25 12 500 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q96J66 6.04e-22 104 31 5 223 1 ABCC11 ATP-binding cassette sub-family C member 11 Homo sapiens
Q54JR2 1.39e-33 140 26 10 501 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
Q54JR2 6.76e-17 88 24 12 417 3 abcC3 ABC transporter C family member 3 Dictyostelium discoideum
B2RX12 1.85e-33 139 25 11 500 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
B2RX12 2.67e-24 111 23 21 579 1 Abcc3 ATP-binding cassette sub-family C member 3 Mus musculus
O95255 1.95e-33 139 25 8 493 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
O95255 1.25e-17 90 27 5 237 1 ABCC6 ATP-binding cassette sub-family C member 6 Homo sapiens
Q54U44 2.46e-33 139 25 10 509 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q54U44 1.77e-16 87 24 11 417 3 abcC12 ABC transporter C family member 12 Dictyostelium discoideum
Q8ETV7 3.12e-33 131 36 4 237 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P38735 3.6e-33 139 26 16 542 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P38735 4.49e-21 101 26 20 473 2 VMR1 ABC transporter ATP-binding protein/permease VMR1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
G4N2B5 3.95e-33 139 30 13 408 3 ABC7 ABC transporter 7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G4N2B5 1.61e-16 87 33 9 209 3 ABC7 ABC transporter 7 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q9SKX0 5.59e-33 138 25 12 526 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q9SKX0 3.56e-15 82 23 15 417 2 ABCC13 ABC transporter C family member 13 Arabidopsis thaliana
Q54EK2 5.9e-33 138 27 15 526 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
Q54EK2 3.99e-13 76 34 7 197 3 abcC7 ABC transporter C family member 7 Dictyostelium discoideum
O88269 7.01e-33 138 25 9 494 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
O88269 1.16e-18 94 22 16 521 1 Abcc6 ATP-binding cassette sub-family C member 6 Rattus norvegicus
S3D778 8.4e-33 137 27 13 473 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
S3D778 8.17e-11 68 26 7 232 3 gloK ABC transporter gloK Glarea lozoyensis (strain ATCC 20868 / MF5171)
Q8R4P9 1.01e-32 137 36 2 220 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q8R4P9 9.86e-16 84 23 12 413 1 Abcc10 ATP-binding cassette sub-family C member 10 Mus musculus
Q55DA7 1.01e-32 137 26 14 498 3 abcB7 ABC transporter B family member 7 Dictyostelium discoideum
P33116 1.07e-32 135 27 6 330 3 spaT Subtilin transport ATP-binding protein SpaT Bacillus subtilis
P37608 1.36e-32 136 28 13 483 3 lcnDR3 Lacticin-481/lactococcin-DR transport/processing ATP-binding protein lcnDR3 Lactococcus lactis subsp. lactis
Q9C8H1 1.59e-32 137 27 14 514 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
Q9C8H1 3.42e-23 108 25 12 480 2 ABCC11 ABC transporter C family member 11 Arabidopsis thaliana
O15438 1.8e-32 137 25 12 488 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
O15438 1.71e-19 96 23 17 573 1 ABCC3 ATP-binding cassette sub-family C member 3 Homo sapiens
Q8LGU1 1.85e-32 136 24 18 592 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q8LGU1 1.54e-16 87 28 7 232 2 ABCC8 ABC transporter C family member 8 Arabidopsis thaliana
Q9R1S7 2.01e-32 136 24 13 547 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q9R1S7 3.23e-21 102 23 16 527 1 Abcc6 ATP-binding cassette sub-family C member 6 Mus musculus
Q9C8H0 1e-31 134 25 15 504 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
Q9C8H0 4.91e-19 95 25 16 493 2 ABCC12 ABC transporter C family member 12 Arabidopsis thaliana
P45081 1e-31 132 30 4 280 3 cydC Glutathione/L-cysteine transport system ATP-binding/permease protein CydC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q81J16 1.17e-31 127 36 5 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q42093 1.68e-31 134 26 13 494 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q42093 1.53e-25 115 24 12 440 1 ABCC2 ABC transporter C family member 2 Arabidopsis thaliana
Q28689 3.02e-31 133 25 10 503 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
Q28689 2.78e-23 108 24 19 577 1 ABCC2 ATP-binding cassette sub-family C member 2 Oryctolagus cuniculus
O88563 3.12e-31 133 24 12 499 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
O88563 2.17e-25 115 26 11 396 1 Abcc3 ATP-binding cassette sub-family C member 3 Rattus norvegicus
P32386 3.32e-31 133 23 12 518 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32386 2.93e-21 102 25 16 446 1 YBT1 ATP-dependent bile acid permease Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8T6H8 4.85e-31 132 31 4 263 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q8T6H8 1.45e-13 77 31 5 195 3 abcC1 ABC transporter C family member 1 Dictyostelium discoideum
Q9X2W0 5.81e-31 130 33 2 231 1 mcjD Microcin-J25 export ATP-binding/permease protein McjD Escherichia coli
P47425 8.16e-31 124 34 4 241 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75095 8.57e-31 130 31 4 283 3 MPN_018 Putative ABC transporter ATP-binding protein MG014 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P29018 9.54e-31 130 22 5 505 1 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Escherichia coli (strain K12)
P45082 1.11e-30 129 26 10 438 3 cydD Glutathione/L-cysteine transport system ATP-binding/permease protein CydD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q50294 1.49e-30 123 34 7 247 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q03203 1.69e-30 129 30 3 248 3 nisT Nisin transport ATP-binding protein NisT Lactococcus lactis subsp. lactis
Q73F67 1.8e-30 123 35 5 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q9U2G5 2.43e-30 130 25 13 499 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q9U2G5 2.41e-17 89 22 18 505 2 mrp-7 Multidrug resistance protein mrp-7 Caenorhabditis elegans
Q8SQI5 3.1e-30 128 31 4 238 3 ECU01_0200 Probable ABC transporter ECU01_0200/ECU01_1410 Encephalitozoon cuniculi (strain GB-M1)
Q9LK62 3.5e-30 129 25 14 546 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q9LK62 3.49e-15 82 30 7 238 1 ABCC7 ABC transporter C family member 7 Arabidopsis thaliana
Q6HPN0 3.85e-30 122 34 5 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 3.85e-30 122 34 5 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 3.85e-30 122 34 5 227 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q63H62 4.42e-30 122 35 5 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q8EUF1 4.59e-30 122 35 8 255 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Malacoplasma penetrans (strain HF-2)
Q9P7V2 7.02e-30 129 24 16 525 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9P7V2 2.96e-12 73 28 8 245 3 abc4 ATP-binding cassette transporter abc4 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8VI47 9.05e-30 128 26 12 485 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q8VI47 1.09e-20 100 24 8 402 1 Abcc2 ATP-binding cassette sub-family C member 2 Mus musculus
Q63GR8 1.3e-29 122 36 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q7NAQ6 1.51e-29 120 33 6 234 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasmoides gallisepticum (strain R(low / passage 15 / clone 2))
Q7FB56 1.67e-29 127 25 15 499 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
Q7FB56 4.15e-17 89 29 4 237 5 ABCC15 Putative ABC transporter C family member 15 Arabidopsis thaliana
Q54K24 2.64e-29 127 32 5 250 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q54K24 9.72e-08 58 31 6 153 3 abcC14 ABC transporter C family member 14 Dictyostelium discoideum
Q8T6H3 3.72e-29 126 31 4 249 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q8T6H3 3.89e-12 73 30 9 222 3 abcC6 ABC transporter C family member 6 Dictyostelium discoideum
Q6XYZ4 3.77e-29 120 35 5 230 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Spiroplasma kunkelii
J9VQH1 4.01e-29 126 25 14 517 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
J9VQH1 4.75e-15 82 32 6 220 3 YOR1 ATP-dependent permease YOR1 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
G5EE72 4.17e-29 126 25 14 507 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
G5EE72 7.8e-17 88 27 4 210 2 mrp-5 Multidrug resistance-associated protein 5 Caenorhabditis elegans
Q81ZF5 4.43e-29 121 36 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q6HP89 4.74e-29 121 36 9 234 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q73EL7 5.49e-29 120 36 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q65P77 1.13e-28 118 34 7 236 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P26363 1.2e-28 125 25 18 596 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
P26363 6.2e-16 85 28 6 231 2 cftr Cystic fibrosis transmembrane conductance regulator Xenopus laevis
Q54LE6 1.31e-28 125 27 18 495 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
Q54LE6 5.94e-07 56 25 5 213 3 abcC5 ABC transporter C family member 5 Dictyostelium discoideum
K0E4D9 1.36e-28 125 26 12 469 1 ecdL ABC transporter ecdL Aspergillus rugulosus
K0E4D9 1.05e-12 75 27 8 242 1 ecdL ABC transporter ecdL Aspergillus rugulosus
Q81IN8 2e-28 119 36 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5D1Z7 2.85e-28 124 25 16 520 2 CFTR Cystic fibrosis transmembrane conductance regulator Trichosurus vulpecula
Q5D1Z7 1.42e-14 80 28 5 221 2 CFTR Cystic fibrosis transmembrane conductance regulator Trichosurus vulpecula
Q839D5 3.08e-28 117 35 5 223 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q88RB3 3.72e-28 119 35 6 242 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q07DZ6 4.16e-28 123 24 14 535 3 CFTR Cystic fibrosis transmembrane conductance regulator Ornithorhynchus anatinus
Q07DZ6 3.55e-15 82 27 6 234 3 CFTR Cystic fibrosis transmembrane conductance regulator Ornithorhynchus anatinus
Q88UV2 4.24e-28 118 35 7 241 3 metN2 Methionine import ATP-binding protein MetN 2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
F1M3J4 4.38e-28 123 27 13 471 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
F1M3J4 1.51e-12 74 26 5 213 1 Abcc4 ATP-binding cassette subfamily C member 4 Rattus norvegicus
Q9PPV1 4.86e-28 117 33 6 224 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9M1C7 4.92e-28 123 25 17 504 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
Q9M1C7 1.47e-11 71 31 2 156 2 ABCC9 ABC transporter C family member 9 Arabidopsis thaliana
P82451 6.4e-28 122 23 10 491 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
P82451 6.16e-18 91 29 6 258 2 ABCC9 ATP-binding cassette sub-family C member 9 Oryctolagus cuniculus
Q54VC1 7.43e-28 122 25 14 486 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
Q54VC1 4.5e-10 66 27 5 213 3 abcC15 ABC transporter C family member 15 Dictyostelium discoideum
E9Q236 7.44e-28 122 34 2 219 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
E9Q236 9.01e-14 78 26 4 215 1 Abcc4 ATP-binding cassette sub-family C member 4 Mus musculus
Q9C8G9 7.64e-28 122 32 3 253 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
Q9C8G9 3.2e-24 111 24 12 440 1 ABCC1 ABC transporter C family member 1 Arabidopsis thaliana
O60706 7.65e-28 122 24 11 497 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
O60706 6.48e-17 88 30 4 223 1 ABCC9 ATP-binding cassette sub-family C member 9 Homo sapiens
Q09428 7.92e-28 122 26 16 540 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q09428 2.58e-16 86 30 7 246 1 ABCC8 ATP-binding cassette sub-family C member 8 Homo sapiens
Q92337 7.97e-28 122 26 15 508 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q92337 1.41e-15 84 31 8 230 3 abc1 ATP-binding cassette transporter abc1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q87UN4 1.04e-27 117 34 8 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5T3U5 1.08e-27 122 38 3 221 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q5T3U5 4.62e-16 85 23 10 408 1 ABCC10 ATP-binding cassette sub-family C member 10 Homo sapiens
Q03P57 1.28e-27 117 34 6 227 3 metN Methionine import ATP-binding protein MetN Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q07E42 1.35e-27 122 25 17 525 3 CFTR Cystic fibrosis transmembrane conductance regulator Dasypus novemcinctus
Q07E42 3.14e-13 76 25 7 251 3 CFTR Cystic fibrosis transmembrane conductance regulator Dasypus novemcinctus
Q4ZZR8 1.44e-27 117 34 8 235 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q38WL5 1.75e-27 116 40 6 205 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10000
Feature type CDS
Gene -
Product ABC transporter transmembrane domain-containing protein
Location 2168452 - 2170128 (strand: 1)
Length 1677 (nucleotides) / 558 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_371
Orthogroup size 8
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter
PF00664 ABC transporter transmembrane region

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2274 Defense mechanisms (V) V ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain

Protein Sequence

MKYRILFQSVLFYSLILQLLALASPIITQIIMDKVIIHQALSTLDVLIIGLIFVAVSESVLKGIREYIYHHTANKIDMLLSLKLTNHLFKLPISYFKSRQTGIIVTRVKELDIIREFITKTLLMLLVDFSFIFIFLFVMAYLSLKLTLIFLATIPLYFILAKLIAPKIEKTVQQLYQYSATNSAFLTETLGGIETIKSLSLEPRFTQQWHTQIHQLTNENLKLQNIDNLSQYIVSFLQKITTAILLCLGAFEVISLAMTIGQLIAFNMLLNHCLQPLSSAIEVWGKYIRAKTAIYNLQDILNLPIEQEKANKKMTLQGEVSFENVSFSYQHDAPPVVRQISFRINEYETIGIVGTSGSGKSTLARIIAGLYIPQLGQVKLDDIPVCEIPPAVLRQQIGFVLQENFLFHLTVLDNIRLTQPSASLDDVIHVAKLAGAHEFILKLPLGYDTLIAENGRSLSGGQCQRIAIARALLSSPKILIFDEATSALDGESQAIIEKNLPLITQDKTVIMIAHRLSTIKNCDRIIVLEKGQIIEEGKHNELIRKDGAYKKLWQHQQG

Flanking regions ( +/- flanking 50bp)

ACTTTGCAGAAAAGCATTTTTTTGATATCACTTGGTTTGTCCCAACCTTTATGAAATATCGTATATTATTTCAAAGTGTATTATTTTACTCGTTAATTCTTCAACTGCTAGCACTTGCCTCGCCGATTATTACGCAAATAATTATGGATAAGGTAATTATCCATCAAGCCCTATCCACGCTTGATGTGTTAATAATAGGTCTTATTTTTGTCGCCGTTTCAGAATCTGTATTAAAGGGGATAAGAGAGTATATTTATCATCATACAGCAAATAAAATTGATATGTTGCTAAGTTTGAAATTAACTAACCATTTATTCAAACTTCCTATCAGTTATTTTAAATCTCGCCAAACAGGTATTATTGTTACACGAGTAAAAGAGCTTGATATCATTCGAGAGTTTATAACAAAAACCTTATTAATGTTATTGGTTGATTTCTCATTTATCTTTATTTTCCTATTTGTTATGGCTTATTTGTCATTAAAGTTAACATTAATCTTTCTTGCCACCATCCCACTCTATTTTATCTTAGCTAAATTAATTGCCCCTAAAATAGAAAAAACCGTACAACAGCTTTATCAATATTCAGCAACAAATAGTGCTTTTTTAACAGAAACGCTAGGAGGTATAGAAACAATAAAAAGCCTTTCATTAGAACCACGTTTTACACAACAGTGGCATACGCAAATTCATCAACTGACTAATGAAAATTTAAAATTACAAAATATTGATAACTTATCGCAATACATTGTTTCATTTTTACAAAAAATAACGACAGCGATACTTTTATGTCTAGGTGCTTTTGAAGTCATTTCACTTGCAATGACAATAGGTCAACTCATTGCTTTTAATATGCTATTAAACCACTGTCTACAACCTTTAAGTTCTGCAATAGAAGTTTGGGGAAAGTATATCCGAGCCAAAACGGCTATTTATAATTTACAAGACATTCTTAATCTCCCAATAGAGCAAGAAAAAGCCAATAAGAAAATGACCTTACAAGGTGAAGTGAGTTTTGAGAATGTCAGTTTTAGTTATCAACATGATGCCCCCCCTGTTGTAAGGCAAATTTCATTTAGAATAAATGAATATGAAACTATTGGTATCGTTGGGACGTCTGGATCAGGGAAAAGTACATTAGCACGCATCATCGCAGGGCTTTATATCCCACAATTAGGTCAGGTTAAGCTTGATGACATTCCGGTTTGTGAAATTCCCCCCGCAGTATTACGTCAACAAATAGGGTTTGTCTTACAAGAGAATTTTTTATTTCATTTAACCGTGCTCGACAATATCCGTTTAACGCAACCATCAGCCTCATTAGATGATGTTATTCATGTAGCTAAATTAGCAGGTGCTCATGAGTTTATTTTAAAACTTCCTTTAGGGTACGACACACTCATTGCTGAAAATGGCAGATCTTTATCTGGGGGACAATGCCAACGTATTGCAATTGCCAGAGCCTTACTCTCATCTCCTAAAATTTTAATTTTTGATGAAGCTACCAGCGCATTGGATGGTGAGTCTCAAGCCATCATCGAAAAAAATCTTCCCCTTATTACCCAAGATAAGACCGTCATTATGATTGCTCATCGCCTTTCCACAATAAAAAACTGTGACCGCATTATTGTATTAGAAAAAGGCCAGATAATCGAAGAAGGCAAACATAATGAATTGATTAGAAAAGATGGCGCTTATAAGAAACTTTGGCAACATCAACAAGGATAACAATGATGAAATCAAAAATAAAACAAATGATTGCTCACTACTTTAAAACT