Homologs in group_4272

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4272

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4272

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F088 0.0 1042 100 0 498 3 mqo Probable malate:quinone oxidoreductase Proteus mirabilis (strain HI4320)
Q2KX12 0.0 743 68 0 492 3 mqo Probable malate:quinone oxidoreductase Bordetella avium (strain 197N)
B3QK65 0.0 742 69 0 492 3 mqo Probable malate:quinone oxidoreductase Rhodopseudomonas palustris (strain TIE-1)
Q6NA55 0.0 738 69 0 492 3 mqo Probable malate:quinone oxidoreductase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0BTB0 0.0 694 65 0 496 3 mqo Probable malate:quinone oxidoreductase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q89XM4 0.0 678 62 0 496 3 mqo Probable malate:quinone oxidoreductase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A8I2M2 0.0 663 65 2 489 3 mqo Probable malate:quinone oxidoreductase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q5FP90 0.0 603 56 0 488 3 mqo Probable malate:quinone oxidoreductase Gluconobacter oxydans (strain 621H)
Q9HVF1 0.0 553 52 1 495 3 mqo2 Probable malate:quinone oxidoreductase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2NS49 0.0 548 52 1 488 3 mqo Probable malate:quinone oxidoreductase Sodalis glossinidius (strain morsitans)
A1R7M9 0.0 548 54 2 492 3 mqo Probable malate:quinone oxidoreductase Paenarthrobacter aurescens (strain TC1)
A8GBY8 0.0 547 52 2 496 3 mqo Probable malate:quinone oxidoreductase Serratia proteamaculans (strain 568)
Q1QUD2 0.0 545 51 2 493 3 mqo Probable malate:quinone oxidoreductase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B8HAT7 0.0 540 53 2 492 3 mqo Probable malate:quinone oxidoreductase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A6H0E6 0.0 538 52 0 488 3 mqo Probable malate:quinone oxidoreductase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A7MNG1 0.0 536 50 0 493 3 mqo Probable malate:quinone oxidoreductase Cronobacter sakazakii (strain ATCC BAA-894)
A4IMR6 0.0 535 51 3 487 3 mqo Probable malate:quinone oxidoreductase Geobacillus thermodenitrificans (strain NG80-2)
C5DAE0 0.0 535 51 3 488 3 mqo Probable malate:quinone oxidoreductase Geobacillus sp. (strain WCH70)
C6DAM1 0.0 534 51 1 495 3 mqo Probable malate:quinone oxidoreductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q88PU7 0.0 533 51 2 490 3 mqo1 Probable malate:quinone oxidoreductase 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A7GQI9 0.0 531 51 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q2SF51 0.0 531 50 0 487 3 mqo Probable malate:quinone oxidoreductase Hahella chejuensis (strain KCTC 2396)
A5CPE3 0.0 531 51 3 491 3 mqo Probable malate:quinone oxidoreductase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q887Z4 0.0 530 50 2 490 3 mqo Probable malate:quinone oxidoreductase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5FGX2 0.0 530 48 0 495 3 mqo Probable malate:quinone oxidoreductase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q9HYF4 0.0 529 51 1 488 3 mqo1 Probable malate:quinone oxidoreductase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6D2L3 0.0 528 51 1 495 3 mqo Probable malate:quinone oxidoreductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5L055 0.0 528 51 4 488 3 mqo Probable malate:quinone oxidoreductase Geobacillus kaustophilus (strain HTA426)
B1YG64 0.0 528 52 3 492 3 mqo Probable malate:quinone oxidoreductase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
B7N5H2 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TFN1 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7NN21 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P33940 0.0 526 50 0 489 1 mqo Malate:quinone oxidoreductase Escherichia coli (strain K12)
Q8FFQ5 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1X8A6 0.0 526 50 0 489 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain K12 / DH10B)
C4ZU53 0.0 526 50 0 489 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MXP1 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O81 (strain ED1a)
B7UFM4 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q32I11 0.0 526 50 0 490 3 mqo Probable malate:quinone oxidoreductase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R9K7 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain UTI89 / UPEC)
A1AD63 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O1:K1 / APEC
B5YX02 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XE45 0.0 525 50 0 490 3 mqo Malate:quinone oxidoreductase Escherichia coli O157:H7
B7MFC3 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LKV7 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain SMS-3-5 / SECEC)
Q31Z33 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Shigella boydii serotype 4 (strain Sb227)
B2TV25 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I1A8 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain SE11)
B1IY62 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A273 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O9:H4 (strain HS)
B7M5Q1 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O8 (strain IAI1)
B7LAN4 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli (strain 55989 / EAEC)
A7ZP32 0.0 525 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YZZ7 0.0 524 50 0 490 3 mqo Probable malate:quinone oxidoreductase Shigella sonnei (strain Ss046)
A4WCM3 0.0 524 50 1 491 3 mqo Probable malate:quinone oxidoreductase Enterobacter sp. (strain 638)
B0RIH2 0.0 523 50 3 491 3 mqo Probable malate:quinone oxidoreductase Clavibacter sepedonicus
Q88NF9 0.0 523 50 0 493 3 mqo2 Probable malate:quinone oxidoreductase 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B7LMB2 0.0 522 50 0 490 3 mqo Probable malate:quinone oxidoreductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q8CN91 0.0 522 50 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLN0 0.0 521 50 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A8AE07 0.0 521 50 1 494 3 mqo Probable malate:quinone oxidoreductase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9Z9Q7 0.0 520 50 3 493 3 mqo Probable malate:quinone oxidoreductase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
C5CAA3 0.0 520 51 2 486 3 mqo Probable malate:quinone oxidoreductase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q1LU84 3.4e-180 518 49 2 490 3 mqo Probable malate:quinone oxidoreductase Baumannia cicadellinicola subsp. Homalodisca coagulata
A9WQR6 1.34e-179 516 50 2 491 3 mqo Probable malate:quinone oxidoreductase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
C0Z9W8 4.69e-179 514 50 2 492 3 mqo Probable malate:quinone oxidoreductase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8CV11 8.04e-179 514 49 3 490 3 mqo Probable malate:quinone oxidoreductase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
B1HNU2 2.41e-178 513 50 3 488 3 mqo Probable malate:quinone oxidoreductase Lysinibacillus sphaericus (strain C3-41)
Q1GXL1 4.63e-178 512 49 1 492 3 mqo Probable malate:quinone oxidoreductase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q6GE66 5.16e-178 511 49 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain MRSA252)
C4L056 1.28e-177 511 50 2 487 3 mqo Probable malate:quinone oxidoreductase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q88IS4 5.25e-177 511 50 1 493 3 mqo3 Probable malate:quinone oxidoreductase 3 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A0RFE8 7.47e-177 509 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus thuringiensis (strain Al Hakam)
B7H655 1.05e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain B4264)
B9J484 1.36e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain Q1)
B7HVJ1 1.36e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain AH187)
P65423 1.95e-176 508 48 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain MW2)
Q6G6V5 1.95e-176 508 48 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain MSSA476)
P65422 1.95e-176 508 48 2 487 1 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain N315)
P65421 1.95e-176 508 48 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q639Y8 2.06e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain ZK / E33L)
Q735Z0 2.5e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HHE0 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EYZ6 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain 03BB102)
B7JSX2 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain AH820)
Q81P44 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus anthracis
C3LEY8 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3NZS9 2.89e-176 508 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus anthracis (strain A0248)
B7ILI6 6.68e-176 506 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain G9842)
A9VJG1 1.09e-175 506 49 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus mycoides (strain KBAB4)
Q5HDJ0 1.11e-175 506 48 2 487 3 mqo1 Probable malate:quinone oxidoreductase 1 Staphylococcus aureus (strain COL)
Q8D1V2 1.14e-175 506 49 0 490 3 mqo Probable malate:quinone oxidoreductase Wigglesworthia glossinidia brevipalpis
Q8XRL7 3.72e-175 506 48 0 493 3 mqo Probable malate:quinone oxidoreductase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7MBG6 8.77e-174 501 49 1 488 3 mqo Probable malate:quinone oxidoreductase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q81C25 1.67e-173 500 50 3 492 3 mqo Probable malate:quinone oxidoreductase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1BKI8 1.75e-173 502 49 1 494 3 mqo Probable malate:quinone oxidoreductase Burkholderia orbicola (strain AU 1054)
A0AWY9 1.75e-173 502 49 1 494 3 mqo Probable malate:quinone oxidoreductase Burkholderia cenocepacia (strain HI2424)
Q390Q5 4.05e-173 501 48 1 494 3 mqo Probable malate:quinone oxidoreductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8UH73 5.71e-173 500 47 0 493 3 mqo Probable malate:quinone oxidoreductase Agrobacterium fabrum (strain C58 / ATCC 33970)
C4LEV7 6.1e-173 499 49 2 495 3 mqo Probable malate:quinone oxidoreductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q492E3 2.6e-172 498 47 1 493 3 mqo Probable malate:quinone oxidoreductase Blochmanniella pennsylvanica (strain BPEN)
B4RQQ5 3.8e-172 496 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria gonorrhoeae (strain NCCP11945)
Q5F5E9 3.8e-172 496 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JXD7 1.65e-171 495 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9M485 1.8e-171 495 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria meningitidis serogroup C (strain 053442)
Q9JWK3 4.97e-171 494 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6AGY2 8.24e-171 493 48 2 490 3 mqo Probable malate:quinone oxidoreductase Leifsonia xyli subsp. xyli (strain CTCB07)
A1KWH2 1.61e-170 492 49 4 492 3 mqo Probable malate:quinone oxidoreductase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q7VFF6 1.68e-170 493 46 2 491 3 mqo Probable malate:quinone oxidoreductase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A2CBH2 2.55e-170 492 49 3 486 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9303)
B2FSQ8 2.23e-169 492 48 1 487 3 mqo Probable malate:quinone oxidoreductase Stenotrophomonas maltophilia (strain K279a)
Q7V8S6 2.77e-169 489 49 3 486 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9313)
Q9S3Q5 4.72e-169 489 49 2 481 3 mqo Probable malate:quinone oxidoreductase Pseudomonas fluorescens
A5GRE3 2.96e-168 486 48 4 471 3 mqo Probable malate:quinone oxidoreductase Synechococcus sp. (strain RCC307)
Q7VRS0 1.91e-167 486 47 5 496 3 mqo Probable malate:quinone oxidoreductase Blochmanniella floridana
B2GFJ0 1.58e-166 483 47 4 492 3 mqo Probable malate:quinone oxidoreductase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q6NGL9 7.96e-166 481 48 5 493 3 mqo Probable malate:quinone oxidoreductase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q5HL19 8.41e-166 481 46 2 492 3 mqo4 Probable malate:quinone oxidoreductase 4 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ96 1.5e-165 480 46 2 490 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q3ALG7 2.3e-165 480 48 4 491 3 mqo Probable malate:quinone oxidoreductase Synechococcus sp. (strain CC9605)
Q8CMY4 4.35e-165 479 46 2 492 3 mqo4 Probable malate:quinone oxidoreductase 4 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKN2 5.35e-165 479 46 2 490 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B0U4L2 1.2e-164 480 47 1 487 3 mqo Probable malate:quinone oxidoreductase Xylella fastidiosa (strain M12)
Q4JV42 1.27e-164 478 48 5 490 3 mqo Probable malate:quinone oxidoreductase Corynebacterium jeikeium (strain K411)
C3PH30 1.64e-164 478 48 6 495 3 mqo Probable malate:quinone oxidoreductase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
A9BE38 3.09e-164 477 46 3 487 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9211)
Q7VDF8 3.66e-164 476 46 3 487 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q87AS0 4.21e-164 479 47 1 487 3 mqo Probable malate:quinone oxidoreductase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I8R2 4.21e-164 479 47 1 487 3 mqo Probable malate:quinone oxidoreductase Xylella fastidiosa (strain M23)
Q9PET6 1.62e-163 477 47 1 487 3 mqo Probable malate:quinone oxidoreductase Xylella fastidiosa (strain 9a5c)
Q46GZ7 2.11e-163 474 46 3 486 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain NATL2A)
Q3AWX1 3.32e-163 474 48 5 491 3 mqo Probable malate:quinone oxidoreductase Synechococcus sp. (strain CC9902)
A0QVL2 6.86e-163 474 46 3 496 1 mqo Probable malate:quinone oxidoreductase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A2C0M6 7.31e-163 473 46 3 486 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain NATL1A)
O69282 1.68e-162 473 47 5 493 1 mqo Malate:quinone oxidoreductase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QF08 1.68e-162 473 47 5 493 3 mqo Probable malate:quinone oxidoreductase Corynebacterium glutamicum (strain R)
A3M361 3.32e-162 473 46 3 487 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HV78 3.32e-162 473 46 3 487 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baumannii (strain ACICU)
B0V946 9.22e-162 472 45 3 487 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baumannii (strain AYE)
B7I894 9.22e-162 472 45 3 487 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baumannii (strain AB0057)
A4TCE3 1.22e-161 471 46 2 493 3 mqo Probable malate:quinone oxidoreductase Mycolicibacterium gilvum (strain PYR-GCK)
B7GYG6 4.57e-160 468 45 3 487 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baumannii (strain AB307-0294)
Q7U5L7 9.79e-160 466 47 4 494 3 mqo Probable malate:quinone oxidoreductase Parasynechococcus marenigrum (strain WH8102)
Q0S251 2.79e-159 464 45 2 493 3 mqo Probable malate:quinone oxidoreductase Rhodococcus jostii (strain RHA1)
C0ZY77 5.09e-159 464 44 2 493 3 mqo Probable malate:quinone oxidoreductase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q8FP91 7.67e-159 468 46 5 495 3 mqo Probable malate:quinone oxidoreductase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B0BR13 8.55e-159 462 46 4 494 3 mqo Probable malate:quinone oxidoreductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2E6 8.55e-159 462 46 4 494 3 mqo Probable malate:quinone oxidoreductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q8CQE8 1.98e-158 462 46 2 491 3 mqo3 Probable malate:quinone oxidoreductase 3 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HKD6 2.57e-158 461 46 2 491 3 mqo3 Probable malate:quinone oxidoreductase 3 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6G669 3.54e-158 461 45 3 492 3 mqo Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain MSSA476)
Q6GDJ6 3.54e-158 461 45 3 492 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain MRSA252)
P99115 3.54e-158 461 45 3 492 1 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain N315)
P65424 3.54e-158 461 45 3 492 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCU5 3.54e-158 461 45 3 492 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain COL)
Q6FDG0 3.77e-158 463 46 3 478 3 mqo Probable malate:quinone oxidoreductase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A3N262 4.14e-158 461 46 4 494 3 mqo Probable malate:quinone oxidoreductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q8NUM4 8.35e-158 460 45 3 492 3 mqo2 Probable malate:quinone oxidoreductase 2 Staphylococcus aureus (strain MW2)
Q7VPC3 5.57e-157 458 47 4 475 3 mqo Probable malate:quinone oxidoreductase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1T7G4 1.78e-156 457 45 2 490 3 mqo Probable malate:quinone oxidoreductase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1BAA7 3.1e-155 454 46 3 489 3 mqo Probable malate:quinone oxidoreductase Mycobacterium sp. (strain MCS)
A1UEQ5 3.1e-155 454 46 3 489 3 mqo Probable malate:quinone oxidoreductase Mycobacterium sp. (strain KMS)
A3PY62 3.1e-155 454 46 3 489 3 mqo Probable malate:quinone oxidoreductase Mycobacterium sp. (strain JLS)
Q7V2Q2 1.15e-153 450 48 5 465 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A3PBD7 2.39e-150 441 48 4 445 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9301)
A2BV78 4.16e-150 441 45 3 486 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9515)
A2BPP7 2.13e-149 439 48 3 441 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain AS9601)
A8G3D1 8.54e-149 437 48 3 441 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9215)
Q31CB9 2.82e-148 436 48 3 441 3 mqo Probable malate:quinone oxidoreductase Prochlorococcus marinus (strain MIT 9312)
P9WJP5 8.77e-138 409 41 2 488 1 mqo Probable malate:quinone oxidoreductase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJP4 8.77e-138 409 41 2 488 3 mqo Probable malate:quinone oxidoreductase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U6K4 8.77e-138 409 41 2 488 3 mqo Probable malate:quinone oxidoreductase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AFW6 8.77e-138 409 41 2 488 3 mqo Probable malate:quinone oxidoreductase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KMJ5 8.77e-138 409 41 2 488 3 mqo Probable malate:quinone oxidoreductase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P65420 8.77e-138 409 41 2 488 3 mqo Probable malate:quinone oxidoreductase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q73VU0 2.12e-136 406 41 3 491 3 mqo Probable malate:quinone oxidoreductase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B2HJU4 2.98e-136 405 41 2 492 3 mqo Probable malate:quinone oxidoreductase Mycobacterium marinum (strain ATCC BAA-535 / M)
O32719 7.2e-15 74 41 0 84 3 mqo Probable malate:quinone oxidoreductase (Fragment) Klebsiella pneumoniae
P56954 1.75e-12 72 23 20 455 3 mqo Probable malate:quinone oxidoreductase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q17VT7 4.29e-09 62 24 19 465 3 mqo Probable malate:quinone oxidoreductase Helicobacter acinonychis (strain Sheeba)
O24913 7.89e-09 61 23 11 329 1 mqo Malate:quinone oxidoreductase Helicobacter pylori (strain ATCC 700392 / 26695)
Q1CV68 8.17e-09 61 23 11 329 3 mqo Probable malate:quinone oxidoreductase Helicobacter pylori (strain HPAG1)
Q9ZMY5 8.24e-09 61 23 11 329 3 mqo Malate:quinone oxidoreductase Helicobacter pylori (strain J99 / ATCC 700824)
B6JPI8 1.95e-08 60 23 11 329 3 mqo Probable malate:quinone oxidoreductase Helicobacter pylori (strain P12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09515
Feature type CDS
Gene mqo
Product malate dehydrogenase (quinone)
Location 2075140 - 2076636 (strand: 1)
Length 1497 (nucleotides) / 498 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4272
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF06039 Malate:quinone oxidoreductase (Mqo)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0579 Carbohydrate transport and metabolism (G) G L-2-hydroxyglutarate oxidase LhgO

Kegg Ortholog Annotation(s)

Protein Sequence

MNKTISEHVDVALIGAGIMSATLGTLLKELESNLKVAMFERLNDCGQESSNSWNNAGTGHAANCELNYTPPNPDGTVNISKALEVNTEFDLSRQLWSYLVTKGKIADPRDFIHACPHMSFVWGADNVKFLHQRYRQMSANHCYENMQYSEDKQQIEDWAPLIMEGRDPNQQLAVTRVATGTDVDYGALTHLLVKQLSQQDNFELHYKHDVIDIKRNETGGWNIEVKDLTTHDKYLITAKYVFVGAGGRAIDLLQKSGIPEGKGYGGFPVSGIWLRCDEDKISSRHHAKVYGKADVGSPPMSVPHLDTRIIAGKRSLLFGPYAGFSSKFLKHGSYLDLFESIRPSNIEPMLDVAKDNWSLTEYLIGQVLQTSAHQFEMLKQFYPQAQHEDWQEAVAGQRVQIIKPAAKHHGVLEFGTELISSADKSFSVLLGASPGASTAAFIAINIIKSCFKQQLENEGWEDRLKTIIPTYGIDLKIDADACRNIRASTAKILKLETP

Flanking regions ( +/- flanking 50bp)

GCAGGATTATGTTTTAAACCGACCAAAACAACTAAGTAATTGGGGTCTGTATGAATAAAACTATTAGTGAACATGTAGATGTCGCGCTCATTGGTGCTGGCATTATGAGTGCAACACTTGGCACACTTCTTAAAGAACTAGAGTCTAATTTAAAAGTCGCGATGTTTGAAAGACTTAATGATTGTGGTCAAGAAAGCTCTAACTCATGGAATAACGCGGGAACAGGACATGCTGCTAACTGTGAGCTAAATTATACGCCACCAAATCCTGACGGCACCGTTAATATCAGTAAAGCGTTAGAAGTGAACACCGAGTTCGATTTATCGCGCCAATTATGGTCTTATTTAGTAACAAAAGGAAAAATTGCCGATCCGCGTGATTTTATTCATGCTTGCCCTCATATGAGTTTTGTTTGGGGTGCAGATAACGTTAAATTCCTTCATCAACGCTATCGCCAAATGTCTGCCAATCACTGTTATGAAAATATGCAATACAGTGAAGACAAACAGCAAATTGAAGATTGGGCGCCATTAATTATGGAAGGGCGTGATCCGAATCAACAGCTTGCTGTCACCCGAGTAGCTACTGGTACTGATGTCGATTATGGCGCATTAACACATCTATTAGTTAAGCAACTTTCTCAACAAGATAATTTTGAGTTGCACTATAAACATGATGTTATTGATATCAAAAGAAATGAGACTGGCGGTTGGAATATCGAAGTTAAAGATCTCACCACCCATGATAAATACCTAATTACAGCTAAATATGTATTTGTTGGTGCCGGTGGACGCGCTATCGATTTACTCCAAAAATCAGGTATTCCAGAAGGTAAAGGCTACGGTGGTTTCCCTGTTAGTGGTATTTGGCTGCGTTGTGATGAAGATAAAATCAGCTCTCGCCATCATGCCAAAGTTTATGGAAAAGCAGATGTAGGCTCACCACCGATGTCTGTCCCCCATCTTGATACTCGTATTATTGCAGGTAAACGCTCCCTACTCTTTGGCCCTTATGCTGGTTTTTCAAGTAAATTTTTAAAACACGGCTCCTATTTAGATTTATTTGAGTCAATTCGCCCCAGCAATATTGAACCTATGCTAGATGTCGCGAAAGATAACTGGTCATTAACTGAATATTTAATTGGTCAAGTATTACAAACGTCAGCACATCAATTTGAAATGCTTAAACAGTTCTATCCTCAGGCTCAACATGAGGATTGGCAAGAAGCTGTTGCAGGTCAACGAGTGCAGATTATTAAACCCGCAGCTAAACATCATGGCGTATTAGAGTTTGGTACTGAGCTAATTAGTAGCGCAGATAAATCATTTTCAGTGTTATTGGGGGCATCACCTGGCGCTTCTACAGCAGCATTTATTGCCATCAATATCATTAAATCTTGCTTTAAACAGCAACTTGAAAATGAGGGTTGGGAAGATCGTCTTAAAACGATTATTCCAACTTATGGTATTGATCTCAAAATAGATGCCGATGCTTGTCGTAATATTCGTGCATCAACGGCTAAGATATTAAAATTAGAAACACCTTAGTTATATCTTACCGATAAAAATAAAACAGACCGGAAATTAAAGGTCTGTTT