Homologs in group_566

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01465 FBDBKF_01465 50.6 Morganella morganii S1 trmN6 tRNA1(Val) A37 N6-methylase TrmN6
EHELCC_00080 EHELCC_00080 50.6 Morganella morganii S2 trmN6 tRNA1(Val) A37 N6-methylase TrmN6
NLDBIP_03380 NLDBIP_03380 50.6 Morganella morganii S4 trmN6 tRNA1(Val) A37 N6-methylase TrmN6
LHKJJB_04895 LHKJJB_04895 50.6 Morganella morganii S3 trmN6 tRNA1(Val) A37 N6-methylase TrmN6
HKOGLL_02150 HKOGLL_02150 50.6 Morganella morganii S5 trmN6 tRNA1(Val) A37 N6-methylase TrmN6
F4V73_RS01940 F4V73_RS01940 51.8 Morganella psychrotolerans - tRNA1(Val) (adenine(37)-N6)-methyltransferase

Distribution of the homologs in the orthogroup group_566

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_566

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F055 0.0 528 100 0 252 3 PMI1896 tRNA1(Val) (adenine(37)-N6)-methyltransferase Proteus mirabilis (strain HI4320)
Q7N1W7 3.21e-106 310 60 2 252 3 plu3348 tRNA1(Val) (adenine(37)-N6)-methyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GI34 1.26e-103 304 59 1 241 3 Spro_3678 tRNA1(Val) (adenine(37)-N6)-methyltransferase Serratia proteamaculans (strain 568)
A4TKY7 7.79e-97 286 54 4 253 3 YPDSF_1562 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis (strain Pestoides F)
Q1CKF3 7.79e-97 286 54 4 253 3 YPN_1197 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3Z3 7.79e-97 286 54 4 253 3 YpAngola_A3602 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q1C564 7.79e-97 286 54 4 253 3 YPA_2443 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT0 7.79e-97 286 54 4 253 3 YpsIP31758_1127 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q667U2 2.84e-96 285 55 4 247 3 YPTB2899 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q74SR9 2.84e-96 285 55 4 247 3 YPO2709 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis
B2KA56 2.84e-96 285 55 4 247 3 YPTS_3010 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JRB8 5.97e-96 284 55 4 247 3 YPK_1180 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
C6CNL2 1.11e-92 276 53 1 243 3 Dd1591_1060 tRNA1(Val) (adenine(37)-N6)-methyltransferase Dickeya chrysanthemi (strain Ech1591)
Q6D211 1.08e-91 273 52 1 251 3 ECA3286 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JKJ4 3.1e-91 272 55 2 246 3 YE1008 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B2VI36 1.15e-85 258 51 2 244 3 ETA_09820 tRNA1(Val) (adenine(37)-N6)-methyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C6DC08 1.69e-85 258 52 1 251 3 PC1_3079 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B7LUY9 2.29e-85 257 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5XNG1 3.04e-85 257 52 2 245 3 KPK_1222 tRNA1(Val) (adenine(37)-N6)-methyltransferase Klebsiella pneumoniae (strain 342)
A7MH06 1.74e-84 255 52 2 244 3 ESA_00683 tRNA1(Val) (adenine(37)-N6)-methyltransferase Cronobacter sakazakii (strain ATCC BAA-894)
B5BAS2 2.44e-84 254 50 2 243 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi A (strain AKU_12601)
A9N0W9 2.44e-84 254 50 2 243 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNB8 2.44e-84 254 50 2 243 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZMX8 3.95e-84 254 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PVY6 3.95e-84 254 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella paratyphi C (strain RKS4594)
B5RD57 5.53e-84 253 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTV6 5.53e-84 253 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella enteritidis PT4 (strain P125109)
A6TCI9 7.03e-84 253 51 2 245 3 KPN78578_28490 tRNA1(Val) (adenine(37)-N6)-methyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q57L59 1.51e-83 253 51 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella choleraesuis (strain SC-B67)
A9MGW2 2.41e-83 252 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8XA22 2.41e-83 252 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7
Q32CU6 3.14e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z4J9 3.42e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella typhi
B1LP88 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7N6G4 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P31825 3.5e-83 251 50 2 241 1 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12)
B1IVQ2 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A386 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O9:H4 (strain HS)
B1XBQ2 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZYJ8 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
C6UBI3 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain B / REL606)
C5W7S9 3.5e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain B / BL21-DE3)
B7NRM8 4.59e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q83QI2 5.71e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella flexneri
Q0T1T1 5.71e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella flexneri serotype 5b (strain 8401)
B6I5E9 5.71e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain SE11)
B7M8I9 5.71e-83 251 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O8 (strain IAI1)
Q3YYU0 8.28e-83 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella sonnei (strain Ss046)
C6UQY1 1.09e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5Z149 1.09e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
B7LDG8 1.2e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZQ20 1.2e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1R8F7 1.32e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain UTI89 / UPEC)
Q8FF14 1.32e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AEA5 1.32e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O1:K1 / APEC
B7MIR0 1.32e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH15 1.32e-82 250 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7MYK8 1.94e-82 249 49 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O81 (strain ED1a)
Q31XR1 2.28e-82 249 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TYI8 2.28e-82 249 50 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A4WDE6 4.25e-82 249 52 2 244 3 Ent638_3062 tRNA1(Val) (adenine(37)-N6)-methyltransferase Enterobacter sp. (strain 638)
A8AD10 4.95e-82 248 48 1 245 3 CKO_00207 tRNA1(Val) (adenine(37)-N6)-methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0TER3 5.23e-82 248 49 2 241 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
C6CB42 8.54e-77 235 45 1 240 3 Dd703_2793 tRNA1(Val) (adenine(37)-N6)-methyltransferase Musicola paradisiaca (strain Ech703)
B0UWL8 3.71e-66 208 42 2 241 3 HSM_0322 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 2336)
Q0I4T7 1.06e-65 207 42 2 241 3 HS_1296 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 129Pt)
C6AQR4 2.26e-64 203 44 3 242 3 NT05HA_1847 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aggregatibacter aphrophilus (strain NJ8700)
Q65W50 2.52e-62 198 41 4 243 3 MS0203 tRNA1(Val) (adenine(37)-N6)-methyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6VKA4 5.82e-62 197 42 3 245 3 Asuc_0019 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0KPC4 2.24e-61 196 45 4 239 3 AHA_3669 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C4LCN4 3.23e-60 192 43 4 237 3 Tola_0970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q9CJZ9 3.93e-60 192 39 2 241 3 PM1839 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pasteurella multocida (strain Pm70)
C5BAI6 3.44e-59 190 40 4 255 3 NT01EI_3041 tRNA1(Val) (adenine(37)-N6)-methyltransferase Edwardsiella ictaluri (strain 93-146)
A5UA66 3.83e-58 187 41 3 239 3 CGSHiEE_00885 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittEE)
Q4QNC1 4.13e-58 187 41 3 239 3 NTHI0547 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain 86-028NP)
A5UGT6 3.57e-57 185 41 3 237 3 CGSHiGG_05325 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittGG)
P44702 9.91e-57 184 40 3 237 3 HI_0423 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6LD46 1.8e-56 183 40 2 235 3 BDI_1875 tRNA1(Val) (adenine(37)-N6)-methyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q119M4 7.89e-56 181 40 3 242 3 Tery_0325 tRNA1(Val) (adenine(37)-N6)-methyltransferase Trichodesmium erythraeum (strain IMS101)
Q8A9H7 2.45e-55 180 39 2 236 3 BT_0838 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7MNQ4 5.84e-53 174 37 3 245 3 VV0662 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain YJ016)
A4SRS5 6.56e-53 174 41 3 239 3 ASA_3636 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas salmonicida (strain A449)
B3H2W9 8.51e-53 174 39 3 236 3 APP7_1987 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A6L532 9.33e-53 174 40 3 235 3 BVU_3164 tRNA1(Val) (adenine(37)-N6)-methyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5LCS1 2.27e-52 172 38 3 236 3 BF2394 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6GWI6 3.69e-52 172 37 3 236 3 FP0346 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q64TX7 4.03e-52 172 38 3 236 3 BF2305 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides fragilis (strain YCH46)
A7MXM2 6.95e-52 171 36 5 247 3 VIBHAR_00953 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q8DEQ3 2.9e-51 170 37 3 245 3 VV1_0533 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain CMCP6)
A3N3J4 1.01e-50 168 38 3 239 3 APL_1900 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q87SB8 2.07e-50 167 37 5 247 3 VP0506 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B8F678 2.1e-50 167 40 4 237 3 HAPS_1234 tRNA1(Val) (adenine(37)-N6)-methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q6LUN9 2.2e-50 167 41 3 238 3 PBPRA0563 tRNA1(Val) (adenine(37)-N6)-methyltransferase Photobacterium profundum (strain SS9)
A5FKD7 5.15e-50 166 36 3 236 3 Fjoh_1299 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A0LXM6 8.42e-50 166 38 5 238 3 GFO_0132 tRNA1(Val) (adenine(37)-N6)-methyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
A0L0I8 3.42e-49 165 39 3 240 3 Shewana3_3333 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain ANA-3)
Q0HM44 7.63e-48 161 39 3 238 3 Shewmr4_0793 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain MR-4)
Q0HRP2 8.5e-48 161 39 3 238 3 Shewmr7_3230 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain MR-7)
C3LSR6 1.06e-47 160 36 5 247 3 VCM66_0619 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KU62 1.06e-47 160 36 5 247 3 VC_0661 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EI95 1.89e-47 160 37 3 238 3 SO_0948 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B6EMW5 5.19e-47 159 38 5 239 3 VSAL_I0559 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio salmonicida (strain LFI1238)
Q3IG80 9.27e-47 158 35 4 237 3 PSHAa0511 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas translucida (strain TAC 125)
Q15NR8 1.33e-46 159 33 4 263 3 Patl_3970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q12R91 9.85e-46 156 35 3 262 3 Sden_0745 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A3QAZ2 9.93e-46 156 39 4 241 3 Shew_0768 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KF36 1.49e-45 155 36 3 244 3 Swoo_0893 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
A1RN54 2.32e-45 155 37 3 238 3 Sputw3181_3285 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain W3-18-1)
A4Y3T4 3.94e-45 154 37 3 238 3 Sputcn32_0888 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
C6VS84 7.87e-45 153 33 2 241 3 Dfer_5119 tRNA1(Val) (adenine(37)-N6)-methyltransferase Dyadobacter fermentans (strain ATCC 700827 / DSM 18053 / CIP 107007 / KCTC 52180 / NS114)
B0TUD3 5.67e-44 151 37 3 244 3 Shal_0858 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella halifaxensis (strain HAW-EB4)
A9L1L1 7.38e-44 151 37 4 242 3 Sbal195_3645 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS195)
A8FRM9 9.49e-44 150 34 4 245 3 Ssed_0891 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sediminis (strain HAW-EB3)
A6WS64 1.39e-43 150 35 3 240 3 Shew185_3526 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS185)
A3D0V3 1.62e-43 150 36 4 242 3 Sbal_0841 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5T2 1.62e-43 150 36 4 242 3 Sbal223_3451 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS223)
Q5E7Q6 1.92e-43 150 38 5 239 3 VF_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B8CU29 2.76e-43 149 36 6 242 3 swp_4230 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q087P4 6.92e-43 149 35 3 248 3 Sfri_0661 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella frigidimarina (strain NCIMB 400)
C6Y2G0 9.72e-42 145 35 4 240 3 Phep_2972 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pedobacter heparinus (strain ATCC 13125 / DSM 2366 / CIP 104194 / JCM 7457 / NBRC 12017 / NCIMB 9290 / NRRL B-14731 / HIM 762-3)
A8H0P3 3.87e-41 144 34 4 262 3 Spea_0803 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B7VJ58 7.38e-40 140 33 5 250 3 VS_0507 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio atlanticus (strain LGP32)
B5F9T8 2.35e-39 139 37 5 238 3 VFMJ11_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain MJ11)
Q11RK8 4.06e-37 133 34 3 241 3 CHU_2705 tRNA1(Val) (adenine(37)-N6)-methyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A1S987 2.72e-36 131 37 4 238 3 Sama_2741 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C6X2D2 8.56e-36 130 31 5 238 3 FIC_02159 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacteriaceae bacterium (strain 3519-10)
Q7MVG0 2.45e-33 124 35 5 248 3 PG_1104 tRNA1(Val) (adenine(37)-N6)-methyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RK25 3.44e-33 124 35 5 248 3 PGN_1201 tRNA1(Val) (adenine(37)-N6)-methyltransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
P37543 7.77e-09 58 31 4 125 3 yabB Probable RNA methyltransferase YabB Bacillus subtilis (strain 168)
Q8KCD5 3.49e-08 56 28 5 166 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q9CNN7 5.56e-08 56 29 4 131 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pasteurella multocida (strain Pm70)
P40816 7.59e-08 55 29 6 164 3 prmC Release factor glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KQ26 2.13e-07 54 40 3 84 3 prmC Release factor glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7W022 4.52e-07 53 38 4 115 3 prmC Release factor glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q89DG5 5.55e-07 53 27 4 133 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q8A1D7 6.02e-07 52 35 2 81 3 prmC Release factor glutamine methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8Y4A9 9.74e-07 52 29 3 124 3 prmC Release factor glutamine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q748B2 1.79e-06 51 36 3 85 3 prmC Release factor glutamine methyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q057M1 2.22e-06 51 37 5 80 3 rsmC Ribosomal RNA small subunit methyltransferase C Buchnera aphidicola subsp. Cinara cedri (strain Cc)
Q32GZ5 2.52e-06 50 40 3 80 3 prmC Release factor glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q8ECQ4 2.61e-06 51 28 5 146 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q58338 3.07e-06 50 30 3 95 3 MJ0928 Putative protein N5-glutamine methyltransferase MJ0928 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q5E6T2 3.19e-06 50 35 3 88 3 prmC Release factor glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1RH40 3.88e-06 51 25 4 152 3 prmC/trmB Bifunctional methyltransferase Rickettsia bellii (strain RML369-C)
Q0WDE1 4.41e-06 50 33 2 80 3 prmB Ribosomal protein uL3 glutamine methyltransferase Yersinia pestis
P45253 4.6e-06 50 27 9 186 3 prmC Release factor glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9K4E3 4.61e-06 50 29 6 164 3 prmC Release factor glutamine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P39200 5.4e-06 50 33 2 86 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio anguillarum (strain ATCC 68554 / 775)
Q63SZ9 5.76e-06 50 35 3 84 3 prmB Ribosomal protein uL3 glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q831F7 6.33e-06 49 40 3 80 3 prmC Release factor glutamine methyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q8DPZ3 6.75e-06 49 39 3 79 3 prmC Release factor glutamine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B9LZ49 7.21e-06 49 26 6 151 3 prmA Ribosomal protein L11 methyltransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q4UJU4 7.91e-06 50 28 6 128 3 prmC/trmB Bifunctional methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q97F67 8.96e-06 49 26 5 176 3 prmC Release factor glutamine methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9KQ83 9.16e-06 49 35 2 80 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45873 1.21e-05 48 35 2 78 3 prmC Release factor glutamine methyltransferase Bacillus subtilis (strain 168)
P0A293 1.26e-05 48 29 5 134 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A294 1.26e-05 48 29 5 134 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhi
A6H162 1.27e-05 48 34 4 96 3 prmC Release factor glutamine methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q9JTA1 1.45e-05 48 35 2 79 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYC0 1.6e-05 48 35 2 79 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5G9G5 1.75e-05 48 35 2 76 3 prmA Ribosomal protein L11 methyltransferase Geotalea uraniireducens (strain Rf4)
Q7ULT2 1.78e-05 48 32 2 82 3 prmC Release factor glutamine methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
P0ACC2 1.8e-05 48 40 3 80 3 prmC Release factor glutamine methyltransferase Shigella flexneri
P0ACC1 1.8e-05 48 40 3 80 1 prmC Release factor glutamine methyltransferase Escherichia coli (strain K12)
Q9CHX0 2.01e-05 48 29 5 152 3 prmC Release factor glutamine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
Q5F783 2.12e-05 48 34 2 81 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q892Z2 2.72e-05 48 34 2 82 3 CTC_01941 Uncharacterized RNA methyltransferase CTC_01941 Clostridium tetani (strain Massachusetts / E88)
Q921L7 2.94e-05 48 37 3 83 2 Hemk1 MTRF1L release factor glutamine methyltransferase Mus musculus
A9CG70 3.28e-05 47 34 2 79 3 prmC Release factor glutamine methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q32DK7 3.5e-05 47 29 5 130 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q2S0V8 4.61e-05 47 38 3 85 3 prmC Release factor glutamine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
A4W687 5.34e-05 47 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Enterobacter sp. (strain 638)
P39199 5.7e-05 47 29 5 130 1 prmB Ribosomal protein uL3 glutamine methyltransferase Escherichia coli (strain K12)
Q8PC99 6.08e-05 47 35 2 89 3 prmC Release factor glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8EAR4 6.55e-05 47 36 5 101 3 prmC Release factor glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A9WBM9 7.3e-05 46 35 2 78 3 prmC Release factor glutamine methyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q49404 8.74e-05 47 32 2 96 4 MG259 Uncharacterized protein MG259 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q87DF7 9.02e-05 46 34 1 81 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
A5UFI6 0.000102 46 33 6 104 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain PittGG)
B2VH94 0.000102 46 29 4 117 3 rsmC Ribosomal RNA small subunit methyltransferase C Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q9Y5R4 0.000114 46 29 6 148 1 HEMK1 MTRF1L release factor glutamine methyltransferase Homo sapiens
Q8R933 0.000122 46 29 2 86 3 TTE1797 Uncharacterized RNA methyltransferase TTE1797 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q814U1 0.000122 45 27 3 118 3 prmC Release factor glutamine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9ZCB3 0.000125 46 28 3 109 3 prmC/trmB Bifunctional methyltransferase Rickettsia prowazekii (strain Madrid E)
Q9PD67 0.000128 45 34 1 81 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
A7MGA7 0.000151 45 28 5 101 3 rsmC Ribosomal RNA small subunit methyltransferase C Cronobacter sakazakii (strain ATCC BAA-894)
Q6FE96 0.000157 45 29 7 157 3 rsmC Ribosomal RNA small subunit methyltransferase C Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q81JX2 0.000222 45 27 3 118 3 prmC Release factor glutamine methyltransferase Bacillus anthracis
Q83WC4 0.000224 45 26 4 136 1 None Glycine/sarcosine N-methyltransferase Aphanothece halophytica
Q1II29 0.000264 45 34 3 78 3 prmC Release factor glutamine methyltransferase Koribacter versatilis (strain Ellin345)
P74003 0.000272 45 31 3 116 3 prmC Release factor glutamine methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8R619 0.000277 45 32 3 80 3 prmC Release factor glutamine methyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P45106 0.000302 45 33 2 80 3 prmB Ribosomal protein uL3 glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37872 0.000304 44 29 4 117 3 ybxB Uncharacterized protein YbxB Bacillus subtilis (strain 168)
B5YIQ8 0.000331 44 25 5 166 3 prmC Release factor glutamine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P44453 0.000361 44 32 6 104 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3J2B7 0.000362 44 34 3 114 3 prmC Release factor glutamine methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B4T4F9 0.000363 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella newport (strain SL254)
Q2RFW1 0.000446 44 27 7 177 3 prmC Release factor glutamine methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B5R9T9 0.00046 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5BL07 0.000532 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain AKU_12601)
Q5PK16 0.000532 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZJW6 0.000542 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R2I6 0.000542 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella enteritidis PT4 (strain P125109)
B5FTB3 0.000542 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella dublin (strain CT_02021853)
A9N7C4 0.000547 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TGY8 0.000547 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella heidelberg (strain SL476)
Q6D984 0.000558 44 31 3 94 3 rsmC Ribosomal RNA small subunit methyltransferase C Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B4TU29 0.000567 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella schwarzengrund (strain CVM19633)
B5F512 0.000567 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella agona (strain SL483)
Q8Z0V2 0.000583 44 27 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhi
Q9Z721 0.000642 44 29 3 85 3 CPn_0885 Uncharacterized RNA methyltransferase CPn_0885/CP_0981/CPj0885/CpB0914 Chlamydia pneumoniae
Q8F6B7 0.000651 43 21 3 146 3 prmA Ribosomal protein L11 methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PX0 0.000651 43 21 3 146 3 prmA Ribosomal protein L11 methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8BNV1 0.000728 44 40 1 59 1 Trmt2a tRNA (uracil-5-)-methyltransferase homolog A Mus musculus

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09355
Feature type CDS
Gene -
Product tRNA1(Val) (adenine(37)-N6)-methyltransferase
Location 2041495 - 2042253 (strand: -1)
Length 759 (nucleotides) / 252 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_566
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF05175 Methyltransferase small domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4123 Translation, ribosomal structure and biogenesis (J) J tRNA1(Val) A37 N6-methylase TrmN6

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15460 tRNA1Val (adenine37-N6)-methyltransferase [EC:2.1.1.223] - -

Protein Sequence

MKQKKVKKAGLRKGGFTFKQFFVAHDKCEMKVGTDGVLLGAWAPITKAKTVLDIGTGSGLIALMLAQRAPQVERIDGIELDEDAALQASENAQQSQWSSLIHIYHHDIYQYAQQAPTRYDLIVSNPPYFEPAVACRNQEREQARYTKTLTHEGLLDSAQQLITDEGLFCVVLPYLIGEQFIEISQRKGWNVVQRVNIKDSADKPYHRILLAFQRQYQGETKPCNIEELIIRNNDGHYTTQFQSWVTDFYLYY

Flanking regions ( +/- flanking 50bp)

GCGTTCATTCTAAGAATAGAAAGAGTTATACAAATCATTAGAGCGATTCAATGAAGCAAAAGAAAGTAAAGAAAGCAGGTTTACGCAAAGGCGGGTTTACATTTAAACAATTTTTTGTCGCTCATGATAAGTGTGAAATGAAAGTGGGTACTGATGGCGTTTTATTAGGTGCTTGGGCGCCTATCACTAAAGCAAAAACGGTGCTTGATATTGGTACGGGAAGTGGATTAATTGCCTTGATGTTAGCGCAACGTGCCCCGCAGGTTGAGCGTATTGATGGTATTGAACTTGATGAAGATGCCGCATTACAGGCGAGTGAAAATGCGCAACAATCACAGTGGAGTTCGTTAATCCATATTTATCATCATGATATTTATCAATATGCGCAACAAGCGCCAACTCGCTATGATCTTATTGTGAGTAATCCACCCTATTTTGAGCCAGCGGTTGCATGCCGTAACCAAGAGCGCGAGCAAGCCCGTTATACGAAAACGTTGACCCATGAAGGTTTGCTTGACAGTGCACAACAACTTATTACAGATGAAGGCCTATTTTGTGTGGTGTTACCCTATTTAATCGGTGAACAGTTTATTGAAATCTCACAAAGAAAAGGGTGGAATGTCGTACAGCGAGTTAATATTAAAGATAGTGCAGATAAGCCTTACCATCGCATATTGCTAGCCTTTCAAAGACAGTATCAAGGCGAAACTAAACCATGTAATATTGAAGAGCTGATTATCCGCAATAATGACGGTCATTACACAACCCAGTTCCAATCTTGGGTCACAGATTTTTATTTATATTATTAAAGACTAATGTTGCCGTTAATATTACATTGTTTAAGATTGTATATATTGTT