Homologs in group_2467

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_19940 FBDBKF_19940 53.6 Morganella morganii S1 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
EHELCC_07675 EHELCC_07675 53.6 Morganella morganii S2 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
NLDBIP_08000 NLDBIP_08000 53.6 Morganella morganii S4 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
LHKJJB_06265 LHKJJB_06265 53.6 Morganella morganii S3 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
HKOGLL_19120 HKOGLL_19120 53.6 Morganella morganii S5 acrR DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA
F4V73_RS02425 F4V73_RS02425 53.6 Morganella psychrotolerans - CerR family C-terminal domain-containing protein

Distribution of the homologs in the orthogroup group_2467

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2467

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACU1 2.28e-23 96 30 7 228 3 cecR HTH-type transcriptional dual regulator CecR Shigella flexneri
P0ACU0 2.28e-23 96 30 7 228 1 cecR HTH-type transcriptional dual regulator CecR Escherichia coli (strain K12)
Q9R9T9 5.24e-06 49 36 0 60 1 srpR HTH-type transcriptional regulator SrpR Pseudomonas putida
Q93PU7 3.08e-05 45 33 0 60 1 ttgW Uncharacterized HTH-type transcriptional regulator TtgW Pseudomonas putida (strain DOT-T1E)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09200
Feature type CDS
Gene -
Product CerR family C-terminal domain-containing protein
Location 2004510 - 2005184 (strand: -1)
Length 675 (nucleotides) / 224 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2467
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF09209 HTH-type transcriptional dual regulator CecR, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K23777 TetR/AcrR family transcriptional regulator, regulator of cefoperazone and chloramphenicol sensitivity - -

Protein Sequence

MKNTSKTAVSTEQTQEKLVQEGIRLFALYGISGLRTRQLAQDAGVNQSAIPYHFGGKLGVYTAVIRYIATELASEIQFDQFDNKLQFLLKENRPYKNEKVAELVLLLVTGLTRALLSPKRHYYSQLILREQLEPTENYDLIYSNLIEPFHLRLSRLVGLMDTKSDEVTITIRAHALIGQILGFVIARKAFLLRVNKQEITSQLLDKIAQEISQLSVNALLIENA

Flanking regions ( +/- flanking 50bp)

ACAATTAATGCGGGCAGATATATAGTCCTAATAGTAACCAGTTGATTATAATGAAAAACACCAGTAAAACTGCAGTAAGTACAGAACAAACTCAAGAGAAATTAGTGCAAGAAGGTATTAGGCTTTTTGCACTATATGGGATCAGTGGATTGAGAACGCGACAACTTGCGCAAGATGCTGGTGTTAATCAATCAGCAATACCTTACCACTTTGGCGGAAAATTAGGGGTTTATACAGCAGTGATCCGATATATTGCTACAGAATTAGCCTCTGAAATTCAGTTTGACCAATTTGATAATAAGCTTCAGTTTTTATTGAAAGAAAACCGACCTTATAAAAATGAAAAAGTGGCTGAATTAGTTCTATTACTAGTCACAGGTTTAACTCGTGCATTATTATCACCAAAACGCCATTATTACAGTCAGTTGATCCTACGTGAACAGTTAGAACCGACGGAAAATTACGATCTTATTTATAGTAATCTGATAGAGCCTTTTCATCTTCGCCTTTCTCGCTTAGTTGGATTAATGGATACAAAGAGTGATGAAGTAACAATCACTATTCGTGCTCATGCTCTTATTGGTCAGATATTAGGGTTTGTCATTGCAAGAAAAGCTTTTCTATTACGTGTTAATAAGCAAGAGATAACATCACAACTATTAGATAAGATTGCACAAGAAATTAGCCAACTTTCAGTAAATGCCCTTTTAATTGAAAACGCATAGGCAATAAAAAAGACCCCCAGTAATTGGCTGTCCAACTACTGGGGATCATT