Homologs in group_526

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01135 FBDBKF_01135 89.6 Morganella morganii S1 iscS IscS subfamily cysteine desulfurase
EHELCC_00410 EHELCC_00410 89.6 Morganella morganii S2 iscS IscS subfamily cysteine desulfurase
NLDBIP_03050 NLDBIP_03050 89.6 Morganella morganii S4 iscS IscS subfamily cysteine desulfurase
LHKJJB_04565 LHKJJB_04565 89.6 Morganella morganii S3 iscS IscS subfamily cysteine desulfurase
HKOGLL_02480 HKOGLL_02480 89.6 Morganella morganii S5 iscS IscS subfamily cysteine desulfurase
F4V73_RS07205 F4V73_RS07205 87.9 Morganella psychrotolerans - IscS subfamily cysteine desulfurase

Distribution of the homologs in the orthogroup group_526

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_526

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EZU8 0.0 832 100 0 404 3 iscS Cysteine desulfurase IscS Proteus mirabilis (strain HI4320)
P0A6C0 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Shigella flexneri
Q0T1Y9 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Shigella flexneri serotype 5b (strain 8401)
B2TXV5 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LNI6 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain SMS-3-5 / SECEC)
B6I5A2 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain SE11)
B7N6B7 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0A6B7 0.0 756 88 0 404 1 iscS Cysteine desulfurase IscS Escherichia coli (strain K12)
B1IWD1 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6B8 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEV5 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A336 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O9:H4 (strain HS)
B1XB05 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain K12 / DH10B)
C4ZXA5 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7N3 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O8 (strain IAI1)
B7MYG3 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O81 (strain ED1a)
B7NRH9 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z104 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A6B9 0.0 756 88 0 404 1 iscS Cysteine desulfurase IscS Escherichia coli O157:H7
B7LDC2 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli (strain 55989 / EAEC)
B7MIM0 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGX6 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZPX4 0.0 756 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia coli O139:H28 (strain E24377A / ETEC)
B7LKA9 0.0 754 88 0 404 3 iscS Cysteine desulfurase IscS Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6TCF1 0.0 749 87 0 404 3 iscS Cysteine desulfurase IscS Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XNJ7 0.0 748 87 0 404 3 iscS Cysteine desulfurase IscS Klebsiella pneumoniae (strain 342)
A4WDB1 0.0 748 87 0 404 3 iscS Cysteine desulfurase IscS Enterobacter sp. (strain 638)
B4TRX5 0.0 747 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella schwarzengrund (strain CVM19633)
A9MHJ4 0.0 747 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZN40 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BAW6 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella paratyphi A (strain AKU_12601)
C0PYK7 0.0 745 86 0 404 3 iscS Cysteine desulfurase IscS Salmonella paratyphi C (strain RKS4594)
A9N1X5 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNG1 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0S2 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella newport (strain SL254)
B4TDB6 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella heidelberg (strain SL476)
B5RD12 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R5A2 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella enteritidis PT4 (strain P125109)
B5FR85 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella dublin (strain CT_02021853)
Q57LG9 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella choleraesuis (strain SC-B67)
B5F1C0 0.0 745 87 0 404 3 iscS Cysteine desulfurase IscS Salmonella agona (strain SL483)
A7MGX8 0.0 745 86 0 404 3 iscS Cysteine desulfurase IscS Cronobacter sakazakii (strain ATCC BAA-894)
Q8Z4N0 0.0 744 86 0 404 3 iscS Cysteine desulfurase IscS Salmonella typhi
Q6D259 0.0 744 86 0 404 3 iscS Cysteine desulfurase IscS Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GHY3 0.0 742 86 0 404 3 iscS Cysteine desulfurase IscS Serratia proteamaculans (strain 568)
C6DBJ1 0.0 739 86 0 404 3 iscS Cysteine desulfurase IscS Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q7N224 0.0 736 87 0 404 3 iscS Cysteine desulfurase IscS Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C5BEU5 0.0 711 83 0 404 3 iscS Cysteine desulfurase IscS Edwardsiella ictaluri (strain 93-146)
A0KJ32 0.0 697 80 0 404 3 iscS Cysteine desulfurase IscS Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SP14 0.0 695 80 0 404 3 iscS Cysteine desulfurase IscS Aeromonas salmonicida (strain A449)
P57803 0.0 688 79 0 404 3 iscS Cysteine desulfurase IscS Pasteurella multocida (strain Pm70)
A8FXA5 0.0 687 79 0 404 3 iscS Cysteine desulfurase IscS Shewanella sediminis (strain HAW-EB3)
B1KNI3 0.0 683 79 0 404 3 iscS Cysteine desulfurase IscS Shewanella woodyi (strain ATCC 51908 / MS32)
B0UVL5 0.0 678 78 0 404 3 iscS Cysteine desulfurase IscS Histophilus somni (strain 2336)
A6VMN7 0.0 678 79 0 404 3 iscS Cysteine desulfurase IscS Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q0I1L2 0.0 677 78 0 404 3 iscS Cysteine desulfurase IscS Histophilus somni (strain 129Pt)
Q87S28 0.0 675 77 0 404 3 iscS Cysteine desulfurase IscS Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65RS7 0.0 675 78 0 404 3 iscS Cysteine desulfurase IscS Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3QFD5 0.0 674 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8EEU9 0.0 673 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TNY1 0.0 673 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella halifaxensis (strain HAW-EB4)
B8CMW5 0.0 670 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella piezotolerans (strain WP3 / JCM 13877)
A8H2M6 0.0 669 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1S544 0.0 669 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
C4L7K2 0.0 668 77 0 404 3 iscS Cysteine desulfurase IscS Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q7MNG2 0.0 667 76 0 404 3 iscS Cysteine desulfurase IscS Vibrio vulnificus (strain YJ016)
Q6LU62 0.0 667 76 0 404 3 iscS Cysteine desulfurase IscS Photobacterium profundum (strain SS9)
Q57337 0.0 666 77 0 404 3 iscS Cysteine desulfurase IscS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UGI1 0.0 666 77 0 404 3 iscS Cysteine desulfurase IscS Haemophilus influenzae (strain PittGG)
Q8DEY7 0.0 665 76 0 404 3 iscS Cysteine desulfurase IscS Vibrio vulnificus (strain CMCP6)
A5UAA8 0.0 665 77 0 404 3 iscS Cysteine desulfurase IscS Haemophilus influenzae (strain PittEE)
Q080P6 0.0 664 75 0 404 3 iscS Cysteine desulfurase IscS Shewanella frigidimarina (strain NCIMB 400)
Q0HJF4 0.0 662 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella sp. (strain MR-4)
C3LT01 0.0 661 77 0 404 3 iscS Cysteine desulfurase IscS Vibrio cholerae serotype O1 (strain M66-2)
Q0HVP4 0.0 661 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella sp. (strain MR-7)
A0KXJ0 0.0 661 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella sp. (strain ANA-3)
Q9KTY2 0.0 661 77 0 404 3 iscS Cysteine desulfurase IscS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G4 0.0 661 77 0 404 3 iscS Cysteine desulfurase IscS Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A7MU48 0.0 661 75 0 404 3 iscS Cysteine desulfurase IscS Vibrio campbellii (strain ATCC BAA-1116)
A1RJ52 0.0 660 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella sp. (strain W3-18-1)
A4Y7D7 0.0 660 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12P83 0.0 659 75 0 404 3 iscS Cysteine desulfurase IscS Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B7VJS6 0.0 658 74 0 404 3 iscS Cysteine desulfurase IscS Vibrio atlanticus (strain LGP32)
A9L3R0 0.0 657 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella baltica (strain OS195)
A6WNY5 0.0 657 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella baltica (strain OS185)
B8E9D2 0.0 657 78 0 404 3 iscS Cysteine desulfurase IscS Shewanella baltica (strain OS223)
A3D577 0.0 655 77 0 404 3 iscS Cysteine desulfurase IscS Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q486Z0 0.0 653 75 0 404 3 iscS Cysteine desulfurase IscS Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A1SUI4 0.0 649 75 0 403 3 iscS Cysteine desulfurase IscS Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B8F356 0.0 649 74 1 406 3 iscS Cysteine desulfurase IscS Glaesserella parasuis serovar 5 (strain SH0165)
B2VI32 0.0 643 76 0 393 3 iscS Cysteine desulfurase IscS Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q7VMA9 0.0 642 75 1 406 3 iscS Cysteine desulfurase IscS Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B7UWH7 0.0 641 74 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas aeruginosa (strain LESB58)
Q9HXI8 0.0 641 74 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RW8 0.0 641 74 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas aeruginosa (strain UCBPP-PA14)
Q3IFI3 0.0 639 71 1 405 3 iscS Cysteine desulfurase IscS Pseudoalteromonas translucida (strain TAC 125)
A6V0U8 0.0 638 74 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas aeruginosa (strain PA7)
Q887A1 0.0 633 73 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XY43 0.0 632 72 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas mendocina (strain ymp)
A4VNY2 0.0 631 71 0 404 3 iscS Cysteine desulfurase IscS Stutzerimonas stutzeri (strain A1501)
Q4ZX34 0.0 631 73 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas syringae pv. syringae (strain B728a)
Q48M05 0.0 631 73 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C1DE68 0.0 630 73 0 404 3 iscS Cysteine desulfurase IscS Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3K7A5 0.0 628 73 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas fluorescens (strain Pf0-1)
O31269 0.0 627 72 0 404 1 iscS Cysteine desulfurase IscS Azotobacter vinelandii
Q1IEJ2 0.0 626 72 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas entomophila (strain L48)
C3K1M5 0.0 625 72 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas fluorescens (strain SBW25)
B1JDR3 0.0 624 71 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas putida (strain W619)
Q4K6T8 0.0 624 72 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B8D8B6 0.0 624 70 0 403 3 iscS Cysteine desulfurase IscS Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57657 0.0 624 70 0 403 3 iscS Cysteine desulfurase IscS Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D8F9 0.0 624 70 0 403 3 iscS Cysteine desulfurase IscS Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B0KPH6 0.0 622 72 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas putida (strain GB-1)
Q88PK8 0.0 621 71 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VYS4 0.0 621 71 0 404 3 iscS Cysteine desulfurase IscS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A9M029 0.0 605 71 1 404 3 iscS Cysteine desulfurase IscS Neisseria meningitidis serogroup C (strain 053442)
B4RMB8 0.0 605 71 1 404 3 iscS Cysteine desulfurase IscS Neisseria gonorrhoeae (strain NCCP11945)
Q5F8X4 0.0 605 71 1 404 3 iscS Cysteine desulfurase IscS Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1KUK1 0.0 604 71 1 404 3 iscS Cysteine desulfurase IscS Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A5CWM6 0.0 601 69 0 404 3 iscS Cysteine desulfurase IscS Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q1H361 0.0 600 69 2 405 3 iscS Cysteine desulfurase IscS Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q9JTX0 0.0 600 70 1 404 3 iscS Cysteine desulfurase IscS Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q47EN5 0.0 596 69 2 405 3 iscS Cysteine desulfurase IscS Dechloromonas aromatica (strain RCB)
Q60C64 0.0 595 70 1 402 3 iscS Cysteine desulfurase IscS Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
B0VD51 0.0 593 67 1 405 3 iscS Cysteine desulfurase IscS Acinetobacter baumannii (strain AYE)
B2HZI5 0.0 593 67 1 405 3 iscS Cysteine desulfurase IscS Acinetobacter baumannii (strain ACICU)
B7I5Q3 0.0 593 67 1 405 3 iscS Cysteine desulfurase IscS Acinetobacter baumannii (strain AB0057)
B7H3H0 0.0 593 67 1 405 3 iscS Cysteine desulfurase IscS Acinetobacter baumannii (strain AB307-0294)
B0VNW2 0.0 592 66 1 405 3 iscS Cysteine desulfurase IscS Acinetobacter baumannii (strain SDF)
O51886 0.0 590 69 0 403 3 iscS Cysteine desulfurase IscS Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9JYY0 0.0 587 69 1 404 3 iscS Cysteine desulfurase IscS Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q89A19 0.0 585 68 0 404 3 iscS Cysteine desulfurase IscS Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1AWM1 0.0 581 68 0 404 3 iscS Cysteine desulfurase IscS Ruthia magnifica subsp. Calyptogena magnifica
P0DN31 4.55e-180 513 59 2 403 3 ARB_05732-2 Cysteine desulfurase, mitochondrial Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
B4UCP2 3.42e-179 507 61 2 404 3 iscS Cysteine desulfurase IscS Anaeromyxobacter sp. (strain K)
Q5RDE7 5.95e-179 509 57 2 402 2 NFS1 Cysteine desulfurase Pongo abelii
Q2INI7 1.17e-178 506 61 2 404 3 iscS Cysteine desulfurase IscS Anaeromyxobacter dehalogenans (strain 2CP-C)
B8JC53 1.42e-178 506 61 2 404 3 iscS Cysteine desulfurase IscS Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
Q9Y697 1.47e-178 508 57 2 402 1 NFS1 Cysteine desulfurase Homo sapiens
Q99P39 2.75e-176 502 56 2 402 2 Nfs1 Cysteine desulfurase Rattus norvegicus
Q9Z1J3 5.27e-176 501 56 2 402 1 Nfs1 Cysteine desulfurase Mus musculus
Q92HP1 1.54e-174 496 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8F204 2.98e-174 495 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia massiliae (strain Mtu5)
A8GSG4 3.18e-174 495 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia rickettsii (strain Sheila Smith)
B0BXX6 3.18e-174 495 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia rickettsii (strain Iowa)
C4K1Z7 3.74e-174 495 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia peacockii (strain Rustic)
P87185 7.06e-174 497 56 2 403 2 NFS1 Cysteine desulfurase, mitochondrial Candida albicans (strain SC5314 / ATCC MYA-2876)
A8GWB2 1.15e-173 493 58 2 403 3 iscS Cysteine desulfurase IscS Rickettsia bellii (strain OSU 85-389)
P87187 1.47e-173 496 57 2 403 3 SPL1 Cysteine desulfurase, mitochondrial Candida maltosa
C3PNQ8 1.62e-173 493 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia africae (strain ESF-5)
O74351 4.12e-173 496 56 1 401 3 SPBC21D10.11c Probable cysteine desulfurase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q1RHY6 5.82e-173 492 57 2 403 3 iscS Cysteine desulfurase IscS Rickettsia bellii (strain RML369-C)
Q4UL77 4.02e-172 489 57 2 403 3 iscS Cysteine desulfurase IscS Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A8GNU0 4.49e-172 489 57 2 405 3 iscS Cysteine desulfurase IscS Rickettsia akari (strain Hartford)
O60028 7.24e-172 492 56 1 401 3 NFS1 Cysteine desulfurase, mitochondrial Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7H804 8.16e-172 489 61 2 404 3 iscS Cysteine desulfurase IscS Anaeromyxobacter sp. (strain Fw109-5)
P25374 2.89e-171 491 56 1 401 1 NFS1 Cysteine desulfurase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O49543 7.37e-171 488 57 2 402 1 NIFS1 Cysteine desulfurase, mitochondrial Arabidopsis thaliana
Q9ZD60 8.67e-171 486 56 2 405 3 iscS Cysteine desulfurase IscS Rickettsia prowazekii (strain Madrid E)
A8EYH9 5.93e-170 484 56 2 403 3 iscS Cysteine desulfurase IscS Rickettsia canadensis (strain McKiel)
Q2GGJ4 1.27e-169 483 57 3 406 3 iscS Cysteine desulfurase IscS Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q68WP6 4.59e-168 479 55 2 405 3 iscS Cysteine desulfurase IscS Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9VKD3 1.3e-166 478 55 2 402 1 Nfs1 Cysteine desulfurase, mitochondrial Drosophila melanogaster
Q8SQS2 7.34e-157 452 56 4 401 3 NFS1 Cysteine desulfurase, mitosomal Encephalitozoon cuniculi (strain GB-M1)
Q54X04 4.69e-155 448 55 2 403 1 nfs1 Probable cysteine desulfurase, mitochondrial Dictyostelium discoideum
B0YLW6 1.58e-149 433 53 4 405 1 NFS1 Cysteine desulfurase, mitosomal Trachipleistophora hominis
C1FTC4 5.05e-118 352 46 6 393 3 iscS Cysteine desulfurase IscS Clostridium botulinum (strain Kyoto / Type A2)
A5I4Z9 1.05e-117 351 46 6 393 3 iscS Cysteine desulfurase IscS Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FWJ9 1.05e-117 351 46 6 393 3 iscS Cysteine desulfurase IscS Clostridium botulinum (strain ATCC 19397 / Type A)
P57795 4.44e-116 347 46 4 384 3 iscS Cysteine desulfurase IscS Methanosarcina thermophila
B8DZS1 1.04e-113 340 47 6 398 3 iscS Cysteine desulfurase IscS Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P12623 1.41e-111 335 46 7 388 3 nifS Cysteine desulfurase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q43884 3.99e-111 334 46 7 388 3 nifS Cysteine desulfurase Trichormus azollae
Q44507 3.99e-111 334 46 7 388 3 nifS1 Cysteine desulfurase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O30052 1.05e-105 320 44 6 385 3 iscS1 Cysteine desulfurase IscS 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q44482 1.17e-103 315 46 7 385 3 nifS2 Cysteine desulfurase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
O29689 3.59e-103 313 43 6 385 1 iscS2 Cysteine desulfurase IscS 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O54055 6.87e-103 313 43 5 392 1 iscS Cysteine desulfurase IscS Ruminococcus flavefaciens
O34599 4.35e-96 295 43 6 380 3 iscS1 Putative cysteine desulfurase IscS 1 Bacillus subtilis (strain 168)
Q52069 4.6e-95 293 41 8 391 3 nifS Cysteine desulfurase Enterobacter agglomerans
B2US50 3.72e-93 288 43 8 387 3 iscS Cysteine desulfurase IscS Helicobacter pylori (strain Shi470)
Q9ZML2 2.87e-92 285 43 8 387 3 iscS Cysteine desulfurase IscS Helicobacter pylori (strain J99 / ATCC 700824)
O25008 1.28e-91 284 43 8 387 1 iscS Cysteine desulfurase IscS Helicobacter pylori (strain ATCC 700392 / 26695)
B6JKF2 1.69e-91 283 43 8 387 3 iscS Cysteine desulfurase IscS Helicobacter pylori (strain P12)
P05344 4.06e-91 283 41 9 391 3 nifS Cysteine desulfurase Klebsiella pneumoniae
P05341 7.18e-90 280 40 7 387 1 nifS Cysteine desulfurase NifS Azotobacter vinelandii
P57794 5.02e-88 275 40 9 390 3 nifS Cysteine desulfurase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q9Z5X5 4.86e-85 268 40 6 409 3 nifS Cysteine desulfurase Frankia sp. (strain EuIK1)
P23120 2.91e-80 255 38 7 386 3 nifS Cysteine desulfurase Azotobacter chroococcum mcd 1
P55690 1.61e-78 250 39 10 391 3 nifS Cysteine desulfurase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P37030 6.94e-78 249 37 7 384 3 nifS Cysteine desulfurase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
O34874 1.15e-75 243 38 6 383 3 iscS2 Putative cysteine desulfurase IscS 2 Bacillus subtilis (strain 168)
Q01179 8.65e-74 238 39 9 387 3 nifS Cysteine desulfurase Cereibacter sphaeroides
P70727 3.1e-70 229 38 13 391 3 nifS Cysteine desulfurase Azospirillum brasilense
P38033 1.58e-69 227 35 9 399 2 nifS Putative cysteine desulfurase NifS Bacillus subtilis (strain 168)
P9WQ71 1.79e-68 224 38 11 379 1 iscS IscS-like cysteine desulfurase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ70 1.79e-68 224 38 11 379 3 iscS Iscs-like cysteine desulfurase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P31672 2.74e-66 218 37 9 387 3 Ldb0724 NifS/IcsS protein homolog Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q07177 1.54e-63 211 37 8 383 3 nifS Cysteine desulfurase Rhodobacter capsulatus
A2VDS1 1.03e-58 200 33 15 421 2 SCLY Selenocysteine lyase Bos taurus
Q9KDJ6 2.37e-57 195 32 7 380 3 nifS Putative cysteine desulfurase NifS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q96I15 3.7e-54 188 32 14 420 1 SCLY Selenocysteine lyase Homo sapiens
Q9JLI6 3.82e-53 186 30 14 413 1 Scly Selenocysteine lyase Mus musculus
Q68FT9 5.02e-53 185 30 13 413 1 Scly Selenocysteine lyase Rattus norvegicus
Q66IQ6 2.13e-51 181 31 14 407 2 scly Selenocysteine lyase Xenopus laevis
Q5U4Q9 6.8e-51 179 32 12 404 2 scly Selenocysteine lyase Xenopus tropicalis
Q55793 8.03e-30 122 27 10 402 1 csd Probable cysteine desulfurase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9V242 1.32e-29 121 32 5 232 3 csd Probable cysteine desulfurase Pyrococcus abyssi (strain GE5 / Orsay)
D4GYV5 3.04e-29 121 25 8 393 1 sufS Cysteine desulfurase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
O27442 9.09e-28 116 26 13 401 3 csd Probable cysteine desulfurase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P99177 3.01e-27 115 24 10 389 1 csd Probable cysteine desulfurase Staphylococcus aureus (strain N315)
P63518 3.01e-27 115 24 10 389 3 csd Probable cysteine desulfurase Staphylococcus aureus (strain Mu50 / ATCC 700699)
O32164 8.99e-27 114 25 11 392 1 sufS Cysteine desulfurase SufS Bacillus subtilis (strain 168)
O84693 1.03e-26 113 28 14 396 3 csd Probable cysteine desulfurase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q8NXH0 1.34e-26 113 24 11 391 3 csd Probable cysteine desulfurase Staphylococcus aureus (strain MW2)
Q6GB11 1.34e-26 113 24 11 391 3 csd Probable cysteine desulfurase Staphylococcus aureus (strain MSSA476)
Q6GIH2 1.34e-26 113 24 11 391 3 csd Probable cysteine desulfurase Staphylococcus aureus (strain MRSA252)
Q5HHH0 1.34e-26 113 24 11 391 3 csd Probable cysteine desulfurase Staphylococcus aureus (strain COL)
Q9YAB6 1.49e-26 113 27 7 353 3 csd Probable cysteine desulfurase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q9PLP0 4.66e-26 111 30 14 374 3 csd Probable cysteine desulfurase Chlamydia muridarum (strain MoPn / Nigg)
Q9KII6 4.75e-26 114 29 10 348 1 cyd Probable cysteine desulfurase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9K7A0 6.05e-26 111 25 8 384 3 csd Probable cysteine desulfurase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9HMM6 7.01e-26 111 25 9 355 3 csd Probable cysteine desulfurase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9PDA6 8.37e-26 111 26 11 406 3 csd Probable cysteine desulfurase Xylella fastidiosa (strain 9a5c)
Q87DJ2 1.78e-25 110 26 11 406 3 csd Probable cysteine desulfurase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
C6DKM6 7.78e-25 108 25 8 360 3 sufS Cysteine desulfurase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P57989 8.57e-25 108 26 18 403 3 csd Probable cysteine desulfurase Pasteurella multocida (strain Pm70)
Q9KPQ7 9.22e-25 108 26 15 409 3 csd Probable cysteine desulfurase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6D625 9.82e-25 108 25 8 360 3 sufS Cysteine desulfurase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9Z7L5 1.06e-24 108 27 11 399 3 csd Probable cysteine desulfurase Chlamydia pneumoniae
Q8CTA4 1.07e-23 105 24 12 394 3 csd Probable cysteine desulfurase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQQ0 1.15e-23 105 24 12 394 3 csd Probable cysteine desulfurase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P9WQ69 2.04e-23 104 31 7 306 1 csd Probable cysteine desulfurase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ68 2.04e-23 104 31 7 306 3 csd Probable cysteine desulfurase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63517 2.04e-23 104 31 7 306 3 csd Probable cysteine desulfurase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O51111 3.61e-23 103 25 12 406 3 csd Probable cysteine desulfurase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q9HXX3 5.84e-23 102 28 11 368 3 csd Probable cysteine desulfurase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O32975 1.08e-22 103 28 10 357 3 cyd Probable cysteine desulfurase 1 Mycobacterium leprae (strain TN)
B1JJ48 8.5e-22 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TIP2 8.5e-22 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pestis (strain Pestoides F)
Q1CIJ6 8.5e-22 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8D0M6 8.5e-22 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pestis
Q1C761 8.5e-22 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FHJ2 9.18e-22 99 30 4 215 3 sufS Cysteine desulfurase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q9Z408 9.9e-22 99 27 14 405 3 csdA Probable cysteine desulfurase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q66A22 1.63e-21 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K5J4 1.63e-21 99 32 2 179 3 sufS Cysteine desulfurase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A9QZC9 1.73e-21 99 30 4 215 3 sufS Cysteine desulfurase Yersinia pestis bv. Antiqua (strain Angola)
Q8KUU5 2.39e-21 99 26 10 362 1 cyd Cysteine desulfurase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
B4TUT5 2.6e-21 98 26 9 360 3 sufS Cysteine desulfurase Salmonella schwarzengrund (strain CVM19633)
B5F7C4 2.92e-21 98 26 9 360 3 sufS Cysteine desulfurase Salmonella agona (strain SL483)
Q7CQN5 3.57e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF77 3.57e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella typhi
B4T4R6 3.57e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella newport (strain SL254)
B4TGK9 3.57e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella heidelberg (strain SL476)
B5QVS9 3.57e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella enteritidis PT4 (strain P125109)
A9N142 5.03e-21 97 25 9 360 3 sufS Cysteine desulfurase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q57PR2 5.58e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella choleraesuis (strain SC-B67)
B5RAT4 6.08e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5FIM3 7.72e-21 97 26 9 360 3 sufS Cysteine desulfurase Salmonella dublin (strain CT_02021853)
Q3Z233 8.74e-21 96 34 2 181 3 sufS Cysteine desulfurase Shigella sonnei (strain Ss046)
Q321D9 1.28e-20 96 33 2 181 3 sufS Cysteine desulfurase Shigella boydii serotype 4 (strain Sb227)
B2U2I4 1.28e-20 96 33 2 181 3 sufS Cysteine desulfurase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7N516 1.96e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q7UAH4 2.37e-20 95 33 2 181 3 sufS Cysteine desulfurase Shigella flexneri
B6IBB9 2.46e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain SE11)
Q1RBB6 2.49e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain UTI89 / UPEC)
A1ABL8 2.49e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O1:K1 / APEC
B7MV59 2.49e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O81 (strain ED1a)
B7L5N2 2.49e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain 55989 / EAEC)
B7MA32 2.49e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O45:K1 (strain S88 / ExPEC)
P77444 2.51e-20 95 33 2 181 1 sufS Cysteine desulfurase Escherichia coli (strain K12)
B1XFY8 2.51e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain K12 / DH10B)
C4ZYE2 2.51e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain K12 / MC4100 / BW2952)
Q8FH54 2.68e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0THE9 2.68e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5Z4B3 2.68e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q7ADI4 2.68e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O157:H7
B7US19 2.68e-20 95 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P42253 2.75e-20 94 33 5 178 3 ycbU Uncharacterized aminotransferase YcbU Bacillus subtilis (strain 168)
Q49690 2.99e-20 95 31 9 277 3 csd2 Probable cysteine desulfurase 2 Mycobacterium leprae (strain TN)
A7MF59 3.6e-20 95 25 9 363 3 sufS Cysteine desulfurase Cronobacter sakazakii (strain ATCC BAA-894)
B7M0N5 4.07e-20 94 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O8 (strain IAI1)
B7NTV6 4.97e-20 94 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A6TAE4 5.73e-20 94 24 8 362 3 sufS Cysteine desulfurase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B1LE56 6.24e-20 94 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain SMS-3-5 / SECEC)
Q9PQ36 7.09e-20 94 27 11 347 3 csd Probable cysteine desulfurase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B7LQ96 8.77e-20 94 33 2 181 3 sufS Cysteine desulfurase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5XQH2 1.12e-19 93 25 9 360 3 sufS Cysteine desulfurase Klebsiella pneumoniae (strain 342)
A4W9R3 1.8e-19 92 32 2 181 3 sufS Cysteine desulfurase Enterobacter sp. (strain 638)
A7ZME5 1.83e-19 92 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O139:H28 (strain E24377A / ETEC)
A8A0M6 2.13e-19 92 33 2 181 3 sufS Cysteine desulfurase Escherichia coli O9:H4 (strain HS)
B1IQ76 2.17e-19 92 33 2 181 3 sufS Cysteine desulfurase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A9MEP3 6.24e-19 91 33 2 181 3 sufS Cysteine desulfurase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A8GDU4 9.44e-19 90 29 2 182 3 sufS Cysteine desulfurase Serratia proteamaculans (strain 568)
A8AH80 9.71e-19 90 25 8 360 3 sufS Cysteine desulfurase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q9EXP2 1.19e-18 90 23 6 353 1 sufS Cysteine desulfurase Dickeya dadantii (strain 3937)
Q7N3U5 3.31e-18 89 25 12 370 3 sufS Cysteine desulfurase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q57476 3.33e-18 89 25 17 402 3 csd Probable cysteine desulfurase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q93WX6 6.44e-18 89 31 6 218 1 NFS2 Cysteine desulfurase 1, chloroplastic Arabidopsis thaliana
Q9XAD5 2.32e-17 86 25 5 280 3 csd Probable cysteine desulfurase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8D2J7 4.12e-17 85 23 7 367 3 sufS Cysteine desulfurase Wigglesworthia glossinidia brevipalpis
Q46925 5.79e-17 85 24 12 407 1 csdA Cysteine desulfurase CsdA Escherichia coli (strain K12)
Q9X191 5.97e-16 82 24 11 390 3 csd Probable cysteine desulfurase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O83623 1.99e-15 80 27 5 234 3 csd Probable cysteine desulfurase Treponema pallidum (strain Nichols)
A0A509AF62 4.89e-15 80 27 11 292 1 SufS Putative cysteine desulfurase PbSufS Plasmodium berghei (strain Anka)
P75298 2.05e-14 77 24 6 247 3 csd Probable cysteine desulfurase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q49420 8.13e-14 76 23 7 318 3 csd Probable cysteine desulfurase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9UZD5 1.51e-11 68 30 11 231 3 mfnA Probable L-aspartate decarboxylase Pyrococcus abyssi (strain GE5 / Orsay)
A0A2K8FTN3 8.13e-11 67 29 5 190 1 SufS Cysteine desulfurase SufS Plasmodium vivax
B8NM72 3.26e-10 65 28 6 182 1 ustD Cysteine desulfurase-like protein ustD Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
P71379 4.14e-10 63 32 1 120 5 HI_1343 Putative csd-like protein HI_1343 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O58679 1.18e-09 63 27 10 255 1 mfnA L-aspartate/L-glutamate decarboxylase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
P9WQ67 4.41e-09 61 23 12 360 1 Rv3778c Uncharacterized protein Rv3778c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ66 4.41e-09 61 23 12 360 3 MT3887 Uncharacterized protein MT3887 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q4WD47 5.51e-09 62 29 6 176 2 fsqF Nonribosomal peptide synthetase-like enzyme fsqF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8U1P6 8.85e-09 60 26 7 221 3 mfnA Probable L-aspartate decarboxylase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P18549 9.5e-09 60 28 6 215 1 cefD Isopenicillin N epimerase Streptomyces clavuligerus
P0C9D1 2.26e-08 59 22 12 362 3 Ken-136 NifS-like protein African swine fever virus (isolate Pig/Kenya/KEN-50/1950)
Q03046 2.77e-08 58 29 6 170 3 cefD Isopenicillin N epimerase Amycolatopsis lactamdurans
A4IT57 2.81e-08 58 30 7 173 3 kynU Kynureninase Geobacillus thermodenitrificans (strain NG80-2)
Q8IBT4 3e-08 59 25 8 244 1 SufS Cysteine desulfurase SufS Plasmodium falciparum (isolate 3D7)
Q10089 3.26e-08 58 23 15 400 3 SPAC11D3.10 Uncharacterized protein C11D3.10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O69668 4.16e-08 58 28 7 207 1 egtE Probable hercynylcysteine sulfoxide lyase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7D515 4.18e-08 58 28 7 207 2 egtE Probable hercynylcysteine sulfoxide lyase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0C9D0 5.19e-08 58 22 8 275 3 War-134 NifS-like protein African swine fever virus (isolate Warthog/Namibia/Wart80/1980)
B0WSX1 1.1e-07 57 27 14 280 3 mal2 Molybdenum cofactor sulfurase 2 Culex quinquefasciatus
A0R5M7 2.12e-07 56 27 5 186 1 egtE Probable hercynylcysteine sulfoxide lyase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B0WSW8 3.03e-07 56 25 13 263 3 mal1 Molybdenum cofactor sulfurase 1 Culex quinquefasciatus
A9AA73 1.24e-06 53 35 1 70 3 MmarC6_1433 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q6LXV6 1.44e-06 53 35 1 70 3 MMP1240 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A4FWT8 1.44e-06 53 35 1 70 3 MmarC5_0351 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A6VGH9 1.56e-06 53 35 1 70 3 MmarC7_0486 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B1Z0T3 1.65e-06 53 28 6 179 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia ambifaria (strain MC40-6)
A6UPN9 1.65e-06 53 35 1 70 3 Mevan_0554 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
O74542 3.33e-06 52 23 9 289 3 SPCC777.03c Uncharacterized aminotransferase C777.03c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q16P90 4.97e-06 52 23 21 461 3 mal3 Molybdenum cofactor sulfurase 3 Aedes aegypti
O94431 6.36e-06 51 24 5 195 3 egt2 Hercynylcysteine sulfoxide lyase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8IU29 6.78e-06 52 22 8 258 2 mal Molybdenum cofactor sulfurase Bombyx mori
Q1INU0 7.2e-06 51 23 9 215 3 gcvPA Probable glycine dehydrogenase (decarboxylating) subunit 1 Koribacter versatilis (strain Ellin345)
Q5JJ82 8.6e-06 51 24 8 268 1 mfnA L-aspartate decarboxylase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A7GPY3 1.77e-05 50 26 4 179 3 kynU Kynureninase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q39AP8 2.26e-05 49 28 6 180 3 phnW1 2-aminoethylphosphonate--pyruvate transaminase 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C5A2X8 2.31e-05 49 26 3 147 3 mfnA Probable L-aspartate decarboxylase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
Q8D3M4 2.44e-05 49 26 2 109 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio vulnificus (strain CMCP6)
Q7MF44 2.5e-05 49 26 2 109 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio vulnificus (strain YJ016)
Q16GH0 2.59e-05 50 23 19 458 3 mal1 Molybdenum cofactor sulfurase 1 Aedes aegypti
P0DXC4 3.13e-05 49 28 5 150 1 JFQ02_10020 Canavanine gamma-lyase Pseudomonas canavaninivorans
Q2T3K6 3.37e-05 49 30 2 112 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5WKB5 3.43e-05 49 26 7 174 3 kynU Kynureninase Shouchella clausii (strain KSM-K16)
O27139 3.62e-05 49 25 7 176 3 MTH_1067 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q7QFL7 3.9e-05 49 27 16 269 3 mal Molybdenum cofactor sulfurase Anopheles gambiae
A0LMC0 4.15e-05 48 31 2 96 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B2JLS3 4.18e-05 48 27 6 182 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q9VRA2 4.83e-05 49 33 4 102 1 mal Molybdenum cofactor sulfurase Drosophila melanogaster
Q59072 4.89e-05 48 24 4 154 1 pscS O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B3NY19 5.41e-05 49 33 4 102 3 mal Molybdenum cofactor sulfurase Drosophila erecta
O30207 6.88e-05 48 23 7 174 1 AF_0028 O-phospho-L-seryl-tRNA:Cys-tRNA synthase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6UUU3 7.68e-05 48 33 0 60 3 Maeo_0681 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q2SHM3 7.75e-05 48 25 7 182 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Hahella chejuensis (strain KCTC 2396)
B4PYH5 8e-05 48 33 4 102 3 mal Molybdenum cofactor sulfurase Drosophila yakuba
B3MZN7 0.000119 48 32 5 112 3 mal Molybdenum cofactor sulfurase Drosophila ananassae
B4N1V2 0.000126 48 25 18 314 3 mal Molybdenum cofactor sulfurase Drosophila willistoni
Q183T0 0.000147 47 26 4 134 3 phnXW Bifunctional phosphonoacetaldehyde hydrolase/aminoethylphosphonate transaminase Clostridioides difficile (strain 630)
Q73BH8 0.000165 47 27 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63NF6 0.000169 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia pseudomallei (strain K96243)
A3NGW6 0.00017 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia pseudomallei (strain 668)
B4TMB1 0.000171 47 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella schwarzengrund (strain CVM19633)
Q3JH97 0.000175 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia pseudomallei (strain 1710b)
A3P2G7 0.000175 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia pseudomallei (strain 1106a)
O35423 0.000176 47 26 2 117 1 Agxt Alanine--glyoxylate aminotransferase Mus musculus
Q8RLU1 0.00018 47 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase (Fragment) Bacillus cereus
A1UZE5 0.000196 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia mallei (strain SAVP1)
Q62CM5 0.000196 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia mallei (strain ATCC 23344)
A2S233 0.000196 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia mallei (strain NCTC 10229)
A3MCV7 0.000196 47 34 2 88 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Burkholderia mallei (strain NCTC 10247)
Q63E45 0.000198 47 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain ZK / E33L)
Q9C509 0.0002 47 25 8 247 1 DPL1 Sphingosine-1-phosphate lyase Arabidopsis thaliana
B9IUR6 0.000205 47 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain Q1)
B7HK48 0.000215 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain AH187)
B1HPR6 0.000268 46 34 2 82 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Lysinibacillus sphaericus (strain C3-41)
Q6HLM0 0.000272 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JFQ9 0.000272 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain AH820)
Q81TE0 0.000272 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus anthracis
C3LAM8 0.000272 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4E3 0.000272 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus anthracis (strain A0248)
C1EM34 0.00028 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain 03BB102)
B7HH81 0.000285 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain B4264)
Q81G81 0.000287 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A0KJL8 0.000299 46 27 2 127 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q87JL4 0.000347 46 27 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A0RBE9 0.000352 46 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus thuringiensis (strain Al Hakam)
A3CVZ3 0.000409 45 25 5 199 3 Memar_1614 O-phospho-L-seryl-tRNA:Cys-tRNA synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
Q13P97 0.000494 45 26 5 182 3 phnW2 2-aminoethylphosphonate--pyruvate transaminase 2 Paraburkholderia xenovorans (strain LB400)
P96060 0.000527 45 24 4 166 1 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0JZT9 0.000533 45 27 5 140 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B5QTH9 0.000541 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella enteritidis PT4 (strain P125109)
B5FKT6 0.000541 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella dublin (strain CT_02021853)
B5R6T2 0.00056 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MWZ9 0.000585 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5EXH1 0.000628 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella agona (strain SL483)
B4SWS3 0.000657 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella newport (strain SL254)
B4T9C6 0.000657 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella heidelberg (strain SL476)
B7IN19 0.000721 45 25 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cereus (strain G9842)
A9VKQ3 0.000734 45 26 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus mycoides (strain KBAB4)
A7GMM0 0.00074 45 27 2 91 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q5L9Q0 0.000742 45 29 1 86 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
O30056 0.000769 45 20 8 272 3 AF_0181 O-phospho-L-seryl-tRNA:Cys-tRNA synthase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P09139 0.000806 45 26 2 117 1 Agxt Alanine--glyoxylate aminotransferase Rattus norvegicus
Q64PZ3 0.000825 45 29 1 86 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Bacteroides fragilis (strain YCH46)
C0Q7V5 0.000834 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella paratyphi C (strain RKS4594)
Q57SD3 0.000834 45 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella choleraesuis (strain SC-B67)
B5BDA1 0.001 44 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella paratyphi A (strain AKU_12601)
Q5PFR0 0.001 44 24 4 166 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
C3LVL9 0.001 44 27 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio cholerae serotype O1 (strain M66-2)
Q9KLY7 0.001 44 27 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F049 0.001 44 27 2 100 3 phnW 2-aminoethylphosphonate--pyruvate transaminase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q81PP8 0.001 44 25 4 177 3 kynU Kynureninase Bacillus anthracis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09180
Feature type CDS
Gene -
Product IscS subfamily cysteine desulfurase
Location 2000841 - 2002055 (strand: -1)
Length 1215 (nucleotides) / 404 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_526
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00266 Aminotransferase class-V

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1104 Amino acid transport and metabolism (E) E Cysteine desulfurase/Cysteine sulfinate desulfinase IscS or related enzyme, NifS family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04487 cysteine desulfurase [EC:2.8.1.7] Thiamine metabolism
Metabolic pathways
Biosynthesis of cofactors
Sulfur relay system
-

Protein Sequence

MKLPIYLDYSATTPVDPRVAEKMMQCLTIDGIFGNPASRSHRFGWQAEEAIDIARNQIADLIGADPREIVFTSGATEADNLALKGVANFYQKKGKHIITSKTEHKAILDTCRQLEREGFEVTYLAPKSDGLIDLKELEAAMRDDTILVSIMHVNNEIGVVQDIAAIGELCRSKGIIYHVDATQSVGKLPIDLSKLKVDLLSLSAHKVYGPMGIGALYVRRKPRIRLEAQMHGGGHERGMRSGTLAVHQIVGMGEAYRILKEEMADETKRLNELRLRLWNGIKDIEEVYINGSLEHTAPNILNVSFNYVEGESLMMALKDLAVSSGSACTSASLEPSYVLRALGLTDELAHSSIRFSLGRFTTEEEIDYAIEQIHSAIGRLRDLSPLWEMHKQGVDINSIEWSHH

Flanking regions ( +/- flanking 50bp)

ACAAAACAAAATTATTAAAGAAGATCTGTCGTCTTTGGAGTTAGTGAGCAATGAAATTACCCATTTATCTAGATTATTCAGCAACCACACCCGTTGATCCTCGAGTTGCTGAAAAAATGATGCAATGCCTGACTATTGACGGCATTTTTGGTAACCCAGCCTCTCGTTCGCACCGTTTTGGATGGCAAGCTGAAGAAGCGATCGATATCGCTCGTAATCAGATTGCTGATCTTATTGGTGCTGATCCTCGTGAAATTGTTTTCACCTCAGGGGCAACTGAAGCAGATAACTTGGCACTAAAAGGTGTTGCAAACTTTTATCAGAAAAAAGGTAAGCACATCATCACATCAAAAACTGAGCATAAAGCGATTTTAGATACTTGTCGTCAGCTTGAGCGTGAAGGTTTTGAAGTGACCTACTTAGCACCAAAAAGCGATGGCTTAATTGATTTGAAAGAACTCGAAGCCGCTATGCGTGATGACACTATTTTAGTTTCTATCATGCACGTGAATAATGAAATTGGTGTGGTGCAAGATATTGCTGCTATTGGTGAATTATGCCGTAGCAAAGGCATTATTTACCACGTTGACGCAACGCAAAGCGTCGGTAAATTACCAATCGATCTCTCCAAATTAAAAGTCGATTTACTTTCTCTTTCTGCACATAAAGTTTACGGACCTATGGGTATTGGTGCGCTTTATGTTCGCCGTAAACCACGCATTCGCTTAGAGGCACAAATGCATGGTGGTGGGCATGAGCGTGGTATGCGTTCAGGTACATTAGCCGTTCACCAAATTGTGGGTATGGGTGAAGCTTACCGTATATTGAAAGAAGAAATGGCTGATGAAACTAAACGTTTAAATGAATTACGTTTACGTTTATGGAATGGCATCAAAGATATTGAAGAAGTGTATATCAATGGTTCTTTAGAACATACAGCGCCAAATATTCTTAATGTCAGCTTCAACTATGTTGAAGGTGAATCATTAATGATGGCACTGAAAGATCTTGCTGTATCTTCAGGTTCAGCCTGTACATCAGCAAGTTTAGAGCCTTCTTATGTACTACGTGCTTTAGGATTAACTGATGAATTAGCACATAGTTCTATTCGTTTCTCTTTAGGTCGTTTCACCACTGAAGAAGAAATCGATTATGCAATTGAACAAATTCACAGTGCAATTGGTCGCTTACGTGATCTTTCTCCACTTTGGGAAATGCATAAACAAGGCGTTGATATCAACAGTATCGAATGGTCTCACCATTAATCAGACGTTTTCAGGAGTTAAATCATGGCTTATAGCGATAAAGTAATTGA