Homologs in group_589

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01060 FBDBKF_01060 43.7 Morganella morganii S1 rodZ cytoskeleton protein RodZ
EHELCC_00485 EHELCC_00485 43.7 Morganella morganii S2 rodZ cytoskeleton protein RodZ
NLDBIP_02975 NLDBIP_02975 43.7 Morganella morganii S4 rodZ cytoskeleton protein RodZ
LHKJJB_04490 LHKJJB_04490 43.7 Morganella morganii S3 rodZ cytoskeleton protein RodZ
HKOGLL_02555 HKOGLL_02555 43.7 Morganella morganii S5 rodZ cytoskeleton protein RodZ
F4V73_RS07135 F4V73_RS07135 44.7 Morganella psychrotolerans rodZ cytoskeleton protein RodZ

Distribution of the homologs in the orthogroup group_589

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_589

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A8GHW6 2.8e-86 265 44 11 331 3 rodZ Cytoskeleton protein RodZ Serratia proteamaculans (strain 568)
A1JKS1 3.46e-83 257 42 7 335 3 rodZ Cytoskeleton protein RodZ Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q3YZ36 3.9e-83 257 43 8 337 3 rodZ Cytoskeleton protein RodZ Shigella sonnei (strain Ss046)
Q83QK7 3.9e-83 257 43 8 337 3 rodZ Cytoskeleton protein RodZ Shigella flexneri
Q0T203 3.9e-83 257 43 8 337 3 rodZ Cytoskeleton protein RodZ Shigella flexneri serotype 5b (strain 8401)
B1LNH1 8.08e-83 256 42 8 336 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain SMS-3-5 / SECEC)
Q32D46 1.96e-82 255 42 8 337 3 rodZ Cytoskeleton protein RodZ Shigella dysenteriae serotype 1 (strain Sd197)
A4WD94 3.17e-82 255 43 10 340 3 rodZ Cytoskeleton protein RodZ Enterobacter sp. (strain 638)
B7NRG6 4.11e-82 254 41 8 341 3 rodZ Cytoskeleton protein RodZ Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MYF1 1.02e-81 253 42 8 335 3 rodZ Cytoskeleton protein RodZ Escherichia coli O81 (strain ED1a)
Q8FF56 2.28e-81 253 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R8L7 2.87e-81 252 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain UTI89 / UPEC)
A1AE54 2.87e-81 252 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli O1:K1 / APEC
B7MI01 2.87e-81 252 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UGW2 2.87e-81 252 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7MGV6 1.15e-80 251 40 9 337 3 rodZ Cytoskeleton protein RodZ Cronobacter sakazakii (strain ATCC BAA-894)
Q0TEW9 2.64e-80 250 40 8 340 3 rodZ Cytoskeleton protein RodZ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5XNL4 4.98e-79 246 40 7 331 3 rodZ Cytoskeleton protein RodZ Klebsiella pneumoniae (strain 342)
B7N6A4 2.09e-78 245 41 8 337 3 rodZ Cytoskeleton protein RodZ Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M7M0 2.09e-78 245 41 8 337 3 rodZ Cytoskeleton protein RodZ Escherichia coli O8 (strain IAI1)
B7LDA8 2.09e-78 245 41 8 337 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain 55989 / EAEC)
A6TCD5 2.21e-78 245 40 5 325 3 rodZ Cytoskeleton protein RodZ Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7ZPV9 7.35e-78 244 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli O139:H28 (strain E24377A / ETEC)
B2TXU1 8.01e-78 244 39 7 343 3 rodZ Cytoskeleton protein RodZ Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B6I588 8.01e-78 244 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain SE11)
B1IWE5 8.01e-78 244 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A322 8.01e-78 244 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli O9:H4 (strain HS)
B2VE88 8.31e-78 244 40 9 342 3 rodZ Cytoskeleton protein RodZ Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
C0PYM9 1.24e-77 243 40 6 328 3 rodZ Cytoskeleton protein RodZ Salmonella paratyphi C (strain RKS4594)
B4TD94 1.24e-77 243 40 6 328 3 rodZ Cytoskeleton protein RodZ Salmonella heidelberg (strain SL476)
Q57LI5 1.24e-77 243 40 6 328 3 rodZ Cytoskeleton protein RodZ Salmonella choleraesuis (strain SC-B67)
Q8Z4P3 1.27e-77 243 41 9 325 3 rodZ Cytoskeleton protein RodZ Salmonella typhi
A4TMT8 1.61e-77 243 38 8 352 3 rodZ Cytoskeleton protein RodZ Yersinia pestis (strain Pestoides F)
Q1CK92 1.85e-77 243 38 8 352 3 rodZ Cytoskeleton protein RodZ Yersinia pestis bv. Antiqua (strain Nepal516)
A9R803 1.85e-77 243 38 8 352 3 rodZ Cytoskeleton protein RodZ Yersinia pestis bv. Antiqua (strain Angola)
Q7CJM7 1.85e-77 243 38 8 352 3 rodZ Cytoskeleton protein RodZ Yersinia pestis
Q1C5I7 1.85e-77 243 38 8 352 3 rodZ Cytoskeleton protein RodZ Yersinia pestis bv. Antiqua (strain Antiqua)
B5Z0Y5 4.2e-77 242 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q7ABM8 4.2e-77 242 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli O157:H7
B7LKC2 5.61e-77 241 41 7 336 3 rodZ Cytoskeleton protein RodZ Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4T0Q0 6.35e-77 241 40 8 336 3 rodZ Cytoskeleton protein RodZ Salmonella newport (strain SL254)
A9MHL4 7.39e-77 241 42 10 327 3 rodZ Cytoskeleton protein RodZ Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P27434 1.73e-76 240 39 7 343 1 rodZ Cytoskeleton protein RodZ Escherichia coli (strain K12)
B1XAZ1 1.73e-76 240 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain K12 / DH10B)
C4ZX91 1.73e-76 240 39 7 343 3 rodZ Cytoskeleton protein RodZ Escherichia coli (strain K12 / MC4100 / BW2952)
B4TR96 2.5e-76 240 40 9 335 3 rodZ Cytoskeleton protein RodZ Salmonella schwarzengrund (strain CVM19633)
B5R583 3.07e-76 239 40 8 334 3 rodZ Cytoskeleton protein RodZ Salmonella enteritidis PT4 (strain P125109)
B5FR64 3.07e-76 239 40 8 334 3 rodZ Cytoskeleton protein RodZ Salmonella dublin (strain CT_02021853)
Q8ZN53 3.77e-76 239 40 9 339 3 rodZ Cytoskeleton protein RodZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BAY4 3.77e-76 239 40 9 339 3 rodZ Cytoskeleton protein RodZ Salmonella paratyphi A (strain AKU_12601)
A9N200 3.77e-76 239 40 9 339 3 rodZ Cytoskeleton protein RodZ Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PNI3 3.77e-76 239 40 9 339 3 rodZ Cytoskeleton protein RodZ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5F199 3.77e-76 239 40 9 339 3 rodZ Cytoskeleton protein RodZ Salmonella agona (strain SL483)
B5RCZ3 4.33e-76 239 40 8 334 3 rodZ Cytoskeleton protein RodZ Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q31XX4 2.11e-75 238 39 7 343 3 rodZ Cytoskeleton protein RodZ Shigella boydii serotype 4 (strain Sb227)
A8AD70 5.41e-74 234 39 6 337 3 rodZ Cytoskeleton protein RodZ Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q667Z8 1.11e-73 234 37 8 361 3 rodZ Cytoskeleton protein RodZ Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9Q1 1.11e-73 234 37 8 361 3 rodZ Cytoskeleton protein RodZ Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JS04 1.23e-73 234 37 8 367 3 rodZ Cytoskeleton protein RodZ Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A7FFY8 1.25e-71 229 36 8 367 3 rodZ Cytoskeleton protein RodZ Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q6D275 1.4e-71 228 41 9 336 3 rodZ Cytoskeleton protein RodZ Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q57065 8.39e-25 104 27 14 333 4 HI_0367 Uncharacterized protein HI_0367 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09110
Feature type CDS
Gene rodZ
Product cytoskeleton protein RodZ
Location 1983746 - 1984708 (strand: -1)
Length 963 (nucleotides) / 320 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_589
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13413 Helix-turn-helix domain
PF13464 RodZ C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1426 Cell cycle control, cell division, chromosome partitioning (D) D Cytoskeletal protein RodZ, contains Xre-like HTH and DUF4115 domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15539 cytoskeleton protein RodZ - -

Protein Sequence

MNTENKTEEVKLTAGQLLRQAREKAGLTQQTVADRLCLKLTTVCEIEADTISSGIAPTFLRGYMRSYAKLVGVPESAILGLIDQQAPIKQVKVTTTQNYSLGKRHKKREGWLMKLTWVIVIAMIALVGLWWWQGHQADQQELVSMASQDIGQNSPQENTNTIESPLSTLDNNSPSSEGENVQVPASPLVDNQANKVAEPSVTDATPEAEVKTVPLPVSPLTTSTTSRADSAEGNSTPAPIVENQLVLMFDGECWLEIRNAQNKVLFNGIKKAGDRLEFNGEQPYKLKIGAPSVTRLQFNGEAVDLSRFTGKIAKITVPSA

Flanking regions ( +/- flanking 50bp)

TCGTGTTCATCAATGTTAAACATCCAATAGCCACAGTGCCTAGATTGCTAATGAATACTGAAAACAAAACCGAAGAAGTGAAATTAACAGCGGGTCAACTTTTACGTCAGGCACGTGAAAAAGCGGGGCTAACTCAGCAGACTGTTGCTGATCGACTTTGTTTGAAGTTAACAACAGTATGTGAAATTGAAGCTGATACTATCTCTTCTGGTATTGCACCGACATTTTTACGTGGTTATATGCGCTCTTATGCAAAACTTGTCGGTGTTCCTGAAAGCGCAATTCTAGGTCTAATTGATCAACAAGCCCCAATAAAACAAGTCAAAGTAACAACAACACAAAATTACTCATTGGGTAAACGTCATAAAAAGCGTGAAGGCTGGTTGATGAAATTGACTTGGGTTATTGTAATAGCAATGATAGCTTTAGTCGGTTTATGGTGGTGGCAGGGGCATCAAGCCGATCAACAAGAATTAGTCTCTATGGCTTCGCAAGACATAGGACAAAATAGTCCGCAAGAAAACACCAATACGATAGAATCTCCTTTATCAACCTTAGATAATAATAGCCCATCATCTGAGGGTGAAAATGTACAAGTGCCTGCTTCTCCATTAGTAGATAATCAGGCTAATAAGGTTGCCGAGCCATCAGTAACAGACGCCACACCTGAGGCAGAAGTTAAAACAGTTCCATTACCGGTGTCACCATTAACCACATCAACGACTTCTCGTGCTGATTCTGCTGAAGGCAATTCAACACCCGCACCAATTGTGGAAAATCAACTGGTCTTGATGTTTGATGGTGAATGCTGGTTAGAAATTCGTAATGCTCAAAATAAAGTTTTATTTAATGGTATTAAGAAAGCCGGTGACCGTTTGGAATTTAATGGTGAGCAACCTTATAAACTAAAAATAGGCGCACCTTCTGTTACTCGTTTACAGTTTAATGGTGAAGCTGTTGACTTAAGCCGTTTTACTGGAAAAATAGCAAAAATAACAGTACCGAGCGCTTAATCTGACTATACATTTGAGCAAGCATGGAAGCATGGGAGAATTAATCAATG