Homologs in group_507

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01020 FBDBKF_01020 60.1 Morganella morganii S1 rimI GNAT family acetyltransferase
EHELCC_00525 EHELCC_00525 60.1 Morganella morganii S2 rimI GNAT family acetyltransferase
NLDBIP_02935 NLDBIP_02935 60.1 Morganella morganii S4 rimI GNAT family acetyltransferase
LHKJJB_04450 LHKJJB_04450 60.1 Morganella morganii S3 rimI GNAT family acetyltransferase
HKOGLL_02595 HKOGLL_02595 60.1 Morganella morganii S5 rimI GNAT family acetyltransferase
F4V73_RS07095 F4V73_RS07095 60.1 Morganella psychrotolerans - GNAT family acetyltransferase

Distribution of the homologs in the orthogroup group_507

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_507

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D8U7 6.43e-75 222 74 1 143 3 ECA0875 Acetyltransferase ECA0875 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2NS89 3.68e-74 220 72 1 143 3 SG1711 Acetyltransferase SG1711 Sodalis glossinidius (strain morsitans)
Q7N6Z8 1.8e-73 219 74 0 143 3 plu1384 Acetyltransferase plu1384 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JL38 3.33e-72 215 69 1 143 3 YE1169 Acetyltransferase YE1169 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZCG0 1.09e-71 214 69 1 143 3 YPO3031 Uncharacterized N-acetyltransferase YPO3031/y1452/YP_2654 Yersinia pestis
Q668I7 1.09e-71 214 69 1 143 3 YPTB2753 Acetyltransferase YPTB2753 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1C5T8 1.09e-71 214 69 1 143 3 YPA_2219 Acetyltransferase YPA_2219 Yersinia pestis bv. Antiqua (strain Antiqua)
A4TMK1 1.09e-71 214 69 1 143 3 YPDSF_2136 Acetyltransferase YPDSF_2136 Yersinia pestis (strain Pestoides F)
Q1CJZ6 1.09e-71 214 69 1 143 3 YPN_1354 Acetyltransferase YPN_1354 Yersinia pestis bv. Antiqua (strain Nepal516)
P63423 2.82e-70 211 67 1 143 3 ypeA Acetyltransferase YpeA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63424 2.82e-70 211 67 1 143 3 ypeA Acetyltransferase YpeA Salmonella typhi
Q5PI26 2.82e-70 211 67 1 143 3 ypeA Acetyltransferase YpeA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57LQ8 2.82e-70 211 67 1 143 3 ypeA Acetyltransferase YpeA Salmonella choleraesuis (strain SC-B67)
Q31Y46 8.54e-70 209 67 1 143 3 ypeA Acetyltransferase YpeA Shigella boydii serotype 4 (strain Sb227)
Q3YZA9 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Shigella sonnei (strain Ss046)
P63422 1.17e-69 209 67 1 143 1 ypeA Acetyltransferase YpeA Shigella flexneri
Q0T275 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Shigella flexneri serotype 5b (strain 8401)
Q32DB9 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Shigella dysenteriae serotype 1 (strain Sd197)
Q1R8T7 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Escherichia coli (strain UTI89 / UPEC)
P63420 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1ADU8 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Escherichia coli O1:K1 / APEC
P63421 1.17e-69 209 67 1 143 3 ypeA Acetyltransferase YpeA Escherichia coli O157:H7
P76539 4.42e-69 207 67 1 143 1 ypeA Acetyltransferase YpeA Escherichia coli (strain K12)
Q0TF35 7.99e-69 207 67 1 143 3 ypeA Acetyltransferase YpeA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
D6Y4C5 3.92e-07 51 31 2 113 3 mshD Mycothiol acetyltransferase Thermobispora bispora (strain ATCC 19993 / DSM 43833 / CBS 139.67 / JCM 10125 / KCTC 9307 / NBRC 14880 / R51)
Q58925 7.72e-07 49 29 3 127 3 MJ1530 Uncharacterized N-acetyltransferase MJ1530 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58ED9 2.85e-06 47 32 2 93 2 naa20 N-alpha-acetyltransferase 20 Danio rerio
Q7ZXR3 3.67e-06 47 32 2 93 2 naa20 N-alpha-acetyltransferase 20 Xenopus laevis
P61600 3.67e-06 47 32 2 93 1 Naa20 N-alpha-acetyltransferase 20 Mus musculus
Q2PFM2 3.67e-06 47 32 2 93 2 NAA20 N-alpha-acetyltransferase 20 Macaca fascicularis
P61599 3.67e-06 47 32 2 93 1 NAA20 N-alpha-acetyltransferase 20 Homo sapiens
Q6P632 3.98e-06 47 32 2 93 2 naa20 N-alpha-acetyltransferase 20 Xenopus tropicalis
A0LWI8 5e-06 48 29 5 146 3 mshD Mycothiol acetyltransferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
O80438 1.57e-05 45 30 1 84 1 MAK3 N-alpha-acetyltransferase MAK3 Arabidopsis thaliana
Q5EDG0 2.25e-05 46 30 2 98 3 mshD Mycothiol acetyltransferase Amycolatopsis mediterranei (strain U-32)
Q5YW78 7.81e-05 43 31 1 83 3 ectA L-2,4-diaminobutyric acid acetyltransferase Nocardia farcinica (strain IFM 10152)
A4FQD4 9.69e-05 44 33 0 57 3 mshD Mycothiol acetyltransferase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q82G40 0.000111 44 31 2 85 3 mshD Mycothiol acetyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9KZV0 0.000317 42 28 1 84 2 mshD Mycothiol acetyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7PCJ9 0.000473 41 27 3 110 2 SAT2 Thialysine N-epsilon-acetyltransferase Sus scrofa
C3PIU4 0.000534 42 26 0 57 3 mshD Mycothiol acetyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
D7GG24 0.000738 41 27 4 125 3 mshD Mycothiol acetyltransferase Propionibacterium freudenreichii subsp. shermanii (strain ATCC 9614 / DSM 4902 / CIP 103027 / NCIMB 8099 / CIRM-BIA1)
D2Q187 0.001 41 30 2 83 3 mshD Mycothiol acetyltransferase Kribbella flavida (strain DSM 17836 / JCM 10339 / NBRC 14399)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS09070
Feature type CDS
Gene -
Product GNAT family acetyltransferase
Location 1975624 - 1976061 (strand: -1)
Length 438 (nucleotides) / 145 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_507
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00583 Acetyltransferase (GNAT) family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1247 Amino acid transport and metabolism (E) E L-amino acid N-acyltransferase MnaT

Kegg Ortholog Annotation(s)

Protein Sequence

MEIRVFRQDDFEAIITLWERCDLISPENDPEIDIERKINHSPDLFLIAEVAGEIVGSVMGGYDGHRGSLYYLGVHPEFRGRGIANALISRLEKKLIAKGCPQITLMIPEENDATICMFEKLLYEDQNQENTAYTKRLIIDQDFDL

Flanking regions ( +/- flanking 50bp)

AAACAAGGGATAATAAATTTAGTAACTTGTGAAAGATAACAGGCAAAACAATGGAAATACGTGTATTCCGTCAAGATGATTTTGAGGCAATCATTACACTTTGGGAACGTTGCGACTTGATCTCACCAGAAAATGATCCTGAAATTGATATTGAACGAAAGATTAACCACTCCCCCGATCTCTTTTTAATCGCAGAGGTTGCTGGCGAAATAGTCGGTAGTGTAATGGGAGGCTATGATGGTCATCGTGGCTCGCTTTACTATTTGGGCGTTCATCCTGAGTTTCGCGGTAGAGGAATTGCCAATGCACTAATCTCTCGGCTAGAGAAAAAACTCATTGCAAAAGGGTGTCCACAAATTACTTTAATGATCCCCGAAGAGAACGATGCCACTATTTGTATGTTTGAAAAGCTTCTCTATGAAGATCAAAATCAAGAGAATACGGCTTACACTAAACGCCTAATTATCGATCAGGACTTCGATCTTTAATTCTTCGCTAAATCCTCTTTTATTGACTGTTAAGATAATTTTAATCGGTT