Homologs in group_4267

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4267

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4267

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 7.61e-35 121 41 0 144 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 7.61e-35 121 41 0 144 3 uspF Universal stress protein F Salmonella typhi
P37903 3.79e-33 116 41 0 144 1 uspF Universal stress protein F Escherichia coli (strain K12)
P0A4P8 4.77e-33 116 41 0 144 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 4.77e-33 116 41 0 144 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 4.77e-33 116 41 0 144 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 4.77e-33 116 41 0 144 3 uspF Universal stress protein F Escherichia coli O157:H7
P67093 7.48e-26 98 34 2 144 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 7.48e-26 98 34 2 144 3 uspG Universal stress protein G Salmonella typhi
Q8XBT3 3.88e-25 96 33 2 144 3 uspG Universal stress protein G Escherichia coli O157:H7
Q8FK07 6.26e-25 95 34 2 144 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P39177 1.25e-24 95 32 2 144 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
Q83M07 2.45e-24 94 32 2 144 3 uspG Universal stress protein G Shigella flexneri
Q57951 2.86e-05 45 27 4 150 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07875
Feature type CDS
Gene -
Product universal stress protein
Location 1722878 - 1723312 (strand: -1)
Length 435 (nucleotides) / 144 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4267
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K14061 universal stress protein F - -

Protein Sequence

MYKTILVPIDIDEDNLLNKAITLVENIAKREDPYVHFLYVLPKLPQSSYYRLVMNGDQLDQVCLKKSAEKELKKIIARFDLPEDRIETHICIGKPRDGILQIADQVNADLIVVSSHNPEVDSYHLGSTAADITRYAKRSVMVAR

Flanking regions ( +/- flanking 50bp)

ATTTTTTTCAAAATAGACTATCCTACAATTAAAAAATAATAGGAGGCGATATGTATAAGACTATTTTGGTTCCCATTGATATCGATGAAGATAACTTACTAAATAAAGCCATTACATTAGTGGAGAACATTGCCAAAAGAGAAGATCCCTATGTCCATTTTTTGTATGTTTTACCAAAGTTGCCACAATCTTCTTATTATCGCTTAGTGATGAATGGCGATCAACTTGACCAAGTATGCTTAAAAAAATCAGCAGAAAAAGAGTTAAAAAAAATTATTGCTCGATTTGATTTACCGGAAGATCGTATTGAAACACATATCTGTATTGGTAAACCACGGGATGGCATATTGCAGATAGCCGATCAGGTTAATGCTGATTTAATTGTTGTTAGCTCACATAATCCTGAAGTAGACAGCTATCATTTAGGCTCAACAGCGGCAGATATTACCCGTTATGCGAAACGTTCAGTGATGGTAGCAAGATAGCCGACTCTTTATTTTATTAGCAATACCATTAAGCGGTTGACGGCGTCTTA