Homologs in group_4617

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4617

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4617

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P67091 5.63e-20 83 32 2 149 1 uspF Universal stress protein F Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67092 5.63e-20 83 32 2 149 3 uspF Universal stress protein F Salmonella typhi
P0A4P8 1.13e-18 80 33 2 149 3 uspF Universal stress protein F Shigella flexneri
P0A4P6 1.13e-18 80 33 2 149 3 uspF Universal stress protein F Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI19 1.13e-18 80 33 2 149 3 uspF Universal stress protein F Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P0A4P7 1.13e-18 80 33 2 149 3 uspF Universal stress protein F Escherichia coli O157:H7
P37903 1.65e-18 79 33 2 149 1 uspF Universal stress protein F Escherichia coli (strain K12)
Q8FK07 2.35e-11 60 29 3 148 3 uspG Universal stress protein G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBT3 1.26e-10 58 29 3 148 3 uspG Universal stress protein G Escherichia coli O157:H7
P39177 1.27e-10 58 29 3 148 1 uspG Universal stress protein UP12 Escherichia coli (strain K12)
P67093 3.76e-10 57 27 3 148 3 uspG Universal stress protein G Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P67094 3.76e-10 57 27 3 148 3 uspG Universal stress protein G Salmonella typhi
Q83M07 6.91e-10 57 28 3 148 3 uspG Universal stress protein G Shigella flexneri
Q57951 4.25e-06 47 31 2 83 3 MJ0531 Universal stress protein MJ0531 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P45680 2.06e-05 45 37 0 53 1 uspA2 Universal stress protein A homolog 2 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83AC1 7.92e-05 43 31 7 150 3 uspA1 Universal stress protein A homolog 1 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
E1VBK4 8.16e-05 43 29 1 67 1 teaD TRAP-T-associated universal stress protein TeaD Halomonas elongata (strain ATCC 33173 / DSM 2581 / NBRC 15536 / NCIMB 2198 / 1H9)
P74148 0.000205 42 29 1 54 3 sll1388 Universal stress protein Sll1388 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8ZE81 0.000659 42 26 6 151 3 uspE Universal stress protein E Yersinia pestis

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS07865
Feature type CDS
Gene -
Product universal stress protein
Location 1721378 - 1721821 (strand: 1)
Length 444 (nucleotides) / 147 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4617
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF00582 Universal stress protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0589 Signal transduction mechanisms (T) T Nucleotide-binding universal stress protein, UspA family

Protein Sequence

MAKTILVAIDLLEDDRIHRMVKDIQFLARKADHYFHFVTVMPNLRSLEAYGLDCDSPSVIEKKHQAVILLTEKLAHCVQQQFQLPKEQYQCHALIGTPNYNILELANKMDVDTIVIGSSSRNRHNILLGSTADYIVNNTNCSVLVIR

Flanking regions ( +/- flanking 50bp)

TTACCTATACTACTCGAGTGAAAAGGTTAATTTTTTACAGAAGGTAAATTATGGCTAAAACAATACTGGTAGCAATTGACTTATTAGAAGATGATAGAATTCACCGTATGGTTAAAGATATTCAATTTCTAGCAAGAAAAGCTGATCACTATTTTCATTTTGTCACAGTCATGCCTAATTTACGCTCTCTTGAAGCTTATGGACTTGATTGTGATAGCCCTTCAGTTATAGAGAAAAAACATCAAGCCGTTATTTTGTTAACTGAAAAACTAGCACACTGTGTTCAACAACAATTCCAATTACCTAAAGAGCAGTACCAATGCCATGCCCTTATAGGGACACCAAATTATAATATTCTCGAACTCGCCAATAAGATGGATGTAGACACTATTGTCATTGGCTCTAGCTCTCGTAATAGACATAATATATTGCTTGGCTCTACTGCAGATTATATTGTTAACAACACCAATTGTTCTGTTTTAGTGATCCGTTGATAATTGACGATACATTGTTAATAAAAAATGCTAGGATTAAAATCAAAAAC