Homologs in group_932

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05060 FBDBKF_05060 71.6 Morganella morganii S1 rnb exoribonuclease II
EHELCC_12530 EHELCC_12530 71.6 Morganella morganii S2 rnb exoribonuclease II
NLDBIP_12870 NLDBIP_12870 71.6 Morganella morganii S4 rnb exoribonuclease II
LHKJJB_12730 LHKJJB_12730 71.6 Morganella morganii S3 rnb exoribonuclease II
HKOGLL_11345 HKOGLL_11345 71.6 Morganella morganii S5 rnb exoribonuclease II
F4V73_RS05500 F4V73_RS05500 72.6 Morganella psychrotolerans - exoribonuclease II

Distribution of the homologs in the orthogroup group_932

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_932

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EW02 0.0 1340 100 0 647 3 rnb Exoribonuclease 2 Proteus mirabilis (strain HI4320)
Q7N4F5 0.0 1010 73 1 646 3 rnb Exoribonuclease 2 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
D3V184 0.0 1003 73 3 649 3 rnb Exoribonuclease 2 Xenorhabdus bovienii (strain SS-2004)
A1JM34 0.0 971 72 5 648 3 rnb Exoribonuclease 2 Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JKP2 0.0 958 70 3 647 3 rnb Exoribonuclease 2 Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TJ37 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pestis (strain Pestoides F)
Q1CIZ7 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8T9 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pestis bv. Antiqua (strain Angola)
Q8ZED8 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pestis
Q1C7L1 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AH3 0.0 957 69 3 647 3 rnb Exoribonuclease 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K4J2 0.0 957 69 3 647 3 rnb Exoribonuclease 2 Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FI01 0.0 957 70 3 647 3 rnb Exoribonuclease 2 Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7MMD8 0.0 951 69 3 647 3 rnb Exoribonuclease 2 Cronobacter sakazakii (strain ATCC BAA-894)
C6DK05 0.0 949 69 4 647 3 rnb Exoribonuclease 2 Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A8GF49 0.0 939 68 3 646 3 rnb Exoribonuclease 2 Serratia proteamaculans (strain 568)
B7N4A3 0.0 937 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FHT6 0.0 937 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI78 0.0 937 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7LRZ1 0.0 936 69 3 647 3 rnb Exoribonuclease 2 Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1AAQ4 0.0 936 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O1:K1 / APEC
B7MLW3 0.0 936 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O45:K1 (strain S88 / ExPEC)
Q6D5S7 0.0 936 69 4 647 3 rnb Exoribonuclease 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5XS03 0.0 935 68 3 646 3 rnb Exoribonuclease 2 Klebsiella pneumoniae (strain 342)
A6T7Z4 0.0 935 68 3 646 3 rnb Exoribonuclease 2 Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7UR96 0.0 935 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1LGE7 0.0 933 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain SMS-3-5 / SECEC)
Q1RC77 0.0 932 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain UTI89 / UPEC)
Q31ZY2 0.0 932 69 3 647 3 rnb Exoribonuclease 2 Shigella boydii serotype 4 (strain Sb227)
B2U0I4 0.0 932 69 3 647 3 rnb Exoribonuclease 2 Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1ITG7 0.0 932 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZZM6 0.0 932 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O9:H4 (strain HS)
B6IA03 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain SE11)
P30850 0.0 931 69 3 647 1 rnb Exoribonuclease 2 Escherichia coli (strain K12)
B1XBN7 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain K12 / DH10B)
C4ZTY2 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain K12 / MC4100 / BW2952)
B7NVR1 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L4C3 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli (strain 55989 / EAEC)
A7ZLA9 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T5B1 0.0 931 69 3 647 3 rnb Exoribonuclease 2 Shigella flexneri serotype 5b (strain 8401)
B7LY47 0.0 930 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O8 (strain IAI1)
B5YZR8 0.0 930 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X7D6 0.0 930 69 3 647 3 rnb Exoribonuclease 2 Escherichia coli O157:H7
P59107 0.0 929 69 3 647 3 rnb Exoribonuclease 2 Shigella flexneri
Q3Z135 0.0 929 69 3 647 3 rnb Exoribonuclease 2 Shigella sonnei (strain Ss046)
Q8Z7C9 0.0 928 69 3 646 3 rnb Exoribonuclease 2 Salmonella typhi
Q32GP4 0.0 927 69 3 647 3 rnb Exoribonuclease 2 Shigella dysenteriae serotype 1 (strain Sd197)
B5BIE3 0.0 927 69 3 646 3 rnb Exoribonuclease 2 Salmonella paratyphi A (strain AKU_12601)
Q5PCZ6 0.0 927 69 3 646 3 rnb Exoribonuclease 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A4WAX5 0.0 927 68 3 647 3 rnb Exoribonuclease 2 Enterobacter sp. (strain 638)
B4T6U4 0.0 925 68 3 646 3 rnb Exoribonuclease 2 Salmonella newport (strain SL254)
Q8ZP54 0.0 924 68 3 646 3 rnb Exoribonuclease 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MWU8 0.0 924 68 3 646 3 rnb Exoribonuclease 2 Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TX11 0.0 923 68 3 646 3 rnb Exoribonuclease 2 Salmonella schwarzengrund (strain CVM19633)
B4TJI0 0.0 923 68 3 646 3 rnb Exoribonuclease 2 Salmonella heidelberg (strain SL476)
B5FU93 0.0 923 68 3 646 3 rnb Exoribonuclease 2 Salmonella dublin (strain CT_02021853)
B5F571 0.0 923 68 3 646 3 rnb Exoribonuclease 2 Salmonella agona (strain SL483)
C0Q3R1 0.0 922 68 3 646 3 rnb Exoribonuclease 2 Salmonella paratyphi C (strain RKS4594)
B5R490 0.0 922 68 3 646 3 rnb Exoribonuclease 2 Salmonella enteritidis PT4 (strain P125109)
Q57NV9 0.0 922 68 3 646 3 rnb Exoribonuclease 2 Salmonella choleraesuis (strain SC-B67)
B5R9Y0 0.0 921 68 3 646 3 rnb Exoribonuclease 2 Salmonella gallinarum (strain 287/91 / NCTC 13346)
A8AG96 0.0 919 67 3 647 3 rnb Exoribonuclease 2 Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B2VKS8 0.0 913 66 2 648 3 rnb Exoribonuclease 2 Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9MQ20 0.0 912 67 3 646 3 rnb Exoribonuclease 2 Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
D0Z8E6 0.0 909 66 2 647 3 rnb Exoribonuclease 2 Edwardsiella tarda (strain EIB202)
Q2NST6 0.0 888 64 4 648 3 rnb Exoribonuclease 2 Sodalis glossinidius (strain morsitans)
Q1LTG8 0.0 776 57 5 649 3 rnb Exoribonuclease 2 Baumannia cicadellinicola subsp. Homalodisca coagulata
B8D7G3 0.0 753 52 2 647 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D959 0.0 753 52 2 647 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57354 0.0 752 52 2 647 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9Q5 0.0 728 52 3 646 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AM0 0.0 686 49 4 649 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
C3LW69 0.0 659 50 8 652 3 rnb Exoribonuclease 2 Vibrio cholerae serotype O1 (strain M66-2)
Q9KLE1 0.0 659 50 8 652 3 rnb Exoribonuclease 2 Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q4QJL5 0.0 657 49 5 658 3 rnb Exoribonuclease 2 Haemophilus influenzae (strain 86-028NP)
B0BP37 0.0 652 49 6 661 3 rnb Exoribonuclease 2 Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A5F0G1 0.0 652 50 8 652 3 rnb Exoribonuclease 2 Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P44440 0.0 651 49 5 658 3 rnb Exoribonuclease 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3GXJ4 0.0 650 49 6 661 3 rnb Exoribonuclease 2 Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0B9 0.0 650 49 6 661 3 rnb Exoribonuclease 2 Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q65SI5 0.0 650 49 5 659 3 rnb Exoribonuclease 2 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0KFR1 0.0 650 50 8 650 3 rnb Exoribonuclease 2 Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A5UFG3 0.0 649 49 5 658 3 rnb Exoribonuclease 2 Haemophilus influenzae (strain PittGG)
A6VN85 0.0 649 49 6 658 3 rnb Exoribonuclease 2 Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7MEL4 0.0 648 49 8 652 3 rnb Exoribonuclease 2 Vibrio vulnificus (strain YJ016)
Q8D7K6 0.0 647 49 8 652 3 rnb Exoribonuclease 2 Vibrio vulnificus (strain CMCP6)
Q9CP74 0.0 647 50 6 658 3 rnb Exoribonuclease 2 Pasteurella multocida (strain Pm70)
Q87IJ9 0.0 638 49 7 652 3 rnb Exoribonuclease 2 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VLX8 0.0 637 48 6 662 3 rnb Exoribonuclease 2 Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B7VSB8 0.0 636 49 7 652 3 rnb Exoribonuclease 2 Vibrio atlanticus (strain LGP32)
B8F4C5 0.0 627 47 7 661 3 rnb Exoribonuclease 2 Glaesserella parasuis serovar 5 (strain SH0165)
Q057Q9 0.0 564 43 6 651 3 rnb Exoribonuclease 2 Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A1SWZ6 1.14e-180 530 42 7 652 3 rnb Exoribonuclease 2 Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
P21499 1.82e-59 216 28 19 657 1 rnr Ribonuclease R Escherichia coli (strain K12)
P30851 6.74e-59 215 28 19 657 3 rnr Ribonuclease R Shigella flexneri
P44907 7.06e-56 206 28 18 653 3 rnr Ribonuclease R Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40611 8.78e-54 201 27 23 672 3 rnr Ribonuclease R Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KNY1 1.22e-51 194 26 23 669 3 rnr Ribonuclease R Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O67834 6.28e-49 185 28 15 588 3 rnr Ribonuclease R Aquifex aeolicus (strain VF5)
Q8K917 2.04e-46 178 26 20 658 3 rnr Ribonuclease R Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9WZI1 6.6e-45 174 26 20 637 3 rnr Ribonuclease R Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P57628 1.3e-43 170 24 19 661 3 rnr Ribonuclease R Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O32231 1.12e-41 165 26 24 657 1 rnr Ribonuclease R Bacillus subtilis (strain 168)
O84402 1.68e-41 164 27 15 600 3 rnr Ribonuclease R Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q9PK00 4.64e-41 162 27 15 592 3 rnr Ribonuclease R Chlamydia muridarum (strain MoPn / Nigg)
Q9Z848 3.04e-40 160 25 16 612 3 rnr Ribonuclease R Chlamydia pneumoniae
P75529 4.41e-40 160 30 10 436 3 rnr Ribonuclease R Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47350 1.21e-37 152 27 12 467 1 rnr Ribonuclease R Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q9PR88 1.65e-34 143 29 14 442 3 rnr Ribonuclease R Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9CH00 2.27e-33 140 25 24 598 3 rnr1 Ribonuclease R 1 Lactococcus lactis subsp. lactis (strain IL1403)
Q98QL0 2.99e-33 139 23 17 631 3 rnr Ribonuclease R Mycoplasmopsis pulmonis (strain UAB CTIP)
Q9ZJX9 1.23e-30 130 27 11 393 3 rnr Ribonuclease R Helicobacter pylori (strain J99 / ATCC 700824)
Q02146 8.25e-30 128 24 20 668 3 rnr2 Ribonuclease R 2 Lactococcus lactis subsp. lactis (strain IL1403)
Q17632 2.94e-29 127 26 13 465 1 dis-3 Probable exosome complex exonuclease RRP44 Caenorhabditis elegans
P56123 3.73e-29 126 25 15 496 3 rnr Ribonuclease R Helicobacter pylori (strain ATCC 700392 / 26695)
Q9CSH3 1.38e-28 125 29 7 348 1 Dis3 Exosome complex exonuclease RRP44 Mus musculus
Q9Y2L1 5.92e-27 120 27 6 348 1 DIS3 Exosome complex exonuclease RRP44 Homo sapiens
Q5U2P0 6.76e-27 120 27 13 443 2 Dis3l DIS3-like exonuclease 1 Rattus norvegicus
Q8C0S1 8.57e-27 120 27 11 445 1 Dis3l DIS3-like exonuclease 1 Mus musculus
P37202 4.59e-26 117 27 14 443 1 dis3 Exosome complex exonuclease dis3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P73177 5.79e-26 116 29 7 331 3 sll1290 Uncharacterized ribonuclease sll1290 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0JN80 7.34e-26 117 26 12 461 2 DIS3L DIS3-like exonuclease 1 Bos taurus
O14040 9.06e-26 116 26 10 443 1 dis32 DIS3-like exonuclease 2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54084 9.32e-26 114 29 14 351 3 rnr Ribonuclease R (Fragment) Acidithiobacillus ferrooxidans
Q5R5N8 1.5e-25 116 27 11 444 2 DIS3L DIS3-like exonuclease 1 Pongo abelii
Q09568 1.68e-24 112 25 8 386 1 disl-2 DIS3-like exonuclease 2 Caenorhabditis elegans
Q8TF46 6.44e-24 111 26 11 444 1 DIS3L DIS3-like exonuclease 1 Homo sapiens
Q0P4R5 1.02e-23 110 27 19 499 2 dis3l DIS3-like exonuclease 1 Xenopus tropicalis
Q6GN11 8.27e-23 107 28 14 432 2 dis3l DIS3-like exonuclease 1 Xenopus laevis
Q0WPN0 2.3e-22 106 28 10 362 2 SOV Inactive exonuclease DIS3L2 Arabidopsis thaliana
Q8CI75 2.96e-22 105 24 9 398 1 Dis3l2 DIS3-like exonuclease 2 Mus musculus
P0DM58 4.12e-22 105 28 10 362 1 SOV DIS3-like exonuclease 2 Arabidopsis thaliana
Q0V9R3 5.63e-22 104 25 9 401 2 dis3l2 DIS3-like exonuclease 2 Xenopus tropicalis
Q8IYB7 3.23e-20 99 25 10 359 1 DIS3L2 DIS3-like exonuclease 2 Homo sapiens
Q08162 2.36e-19 96 24 12 428 1 DIS3 Exosome complex exonuclease DIS3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2RV18 5.15e-19 95 26 12 409 2 dis3l DIS3-like exonuclease 1 Danio rerio
Q9SHL7 6.42e-18 92 26 9 338 2 RRP44A Exosome complex exonuclease RRP44 homolog A Arabidopsis thaliana
P39112 9.66e-14 78 21 15 421 1 DSS1 Exoribonuclease II, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6NQJ6 5.72e-12 72 33 0 112 2 RNR1 Ribonuclease II, chloroplastic/mitochondrial Arabidopsis thaliana
Q5AK62 1.85e-10 68 22 11 351 2 SSD1 Virulence protein SSD1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q46363 2.78e-07 57 22 25 537 3 zam Acetazolamide conferring resistance protein zam Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P47950 4.42e-07 57 33 2 109 3 cyt-4 Mitochondrial protein cyt-4 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q9BYK8 4.16e-05 50 26 2 127 1 HELZ2 3'-5' exoribonuclease HELZ2 Homo sapiens
E9QAM5 0.000118 49 22 12 369 1 Helz2 3'-5' exoribonuclease HELZ2 Mus musculus
Q1MTN7 0.000364 47 30 1 109 2 rpm1 Exoribonuclease II, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q86MA2 0.000467 47 23 16 375 1 DSS1 Mitochondrial exoribonuclease DSS-1 Trypanosoma brucei brucei

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06325
Feature type CDS
Gene -
Product exoribonuclease II
Location 1385905 - 1387848 (strand: 1)
Length 1944 (nucleotides) / 647 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_932
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00575 S1 RNA binding domain
PF00773 RNB domain
PF08206 Ribonuclease B OB domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4776 Transcription (K) K Exoribonuclease II

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01147 exoribonuclease II [EC:3.1.13.1] - -

Protein Sequence

MFQDNPLLAQLKQQLHAQTPRVEGLVKGTDKGFGFLEVDGQKSYFIPPPQMKKVMHGDRIIAAVHTNNDKESAEPEELVEPFLTRFVGRVQKKEGDNRLWIIPDHPLLKDAIPCRPIKSLTHPFADQDWAVAEMRRHPLKGDKHFQAELTDFITDKDDHFAPWWVTLMRHQLERNAPEVDSETLTLHDDLPREDLTALSFVTIDSASTEDMDDALYIRKEENGQLSLYIAIADPTAYIQPNSELDTIAAQRALTNYLPGFNIPMLPRELSDNLCSLRPNEKRPALVCQVGIMEDGALTDEIHFYSAWVESKAKLVYDNISDWLEGEETQWAPENEIVHEQVMLLKEMSEKRHVWREQHALVFKERPDYRFILDDSGNVLDIVAEKRRTANRIVEEAMITANICAAKVLSRNLGFGIYNVHTGFDPLYIDQVSQTLKEHGIETNADELLTLEGFCRLRRELDNQPNQFLDSRIRRFQNFAEIKTEPGPHFGLGLEAYATWTSPIRKYSDILNHRLLKAIISKSAAEKPQDEDCVRIAERRRANRMAERDVGDWLYARFLKPFAGTESTFNAEIIDITRGGIRVRLVENGAIAFIPAPFLHAVRDEIQCSQETGSVIIKGETAYKLNDIIPVRIEDVKLETRNIVARPI

Flanking regions ( +/- flanking 50bp)

AAAACTATTGCCCACTTTTATTATTAAAATTGCCGACTTTCCGGAAAAATATGTTTCAAGACAATCCGCTGCTTGCTCAGCTAAAACAGCAACTCCATGCCCAAACACCGCGCGTGGAAGGCCTTGTAAAAGGGACAGATAAAGGCTTTGGCTTCCTTGAAGTTGATGGTCAGAAAAGCTATTTTATCCCTCCTCCTCAAATGAAAAAAGTGATGCACGGTGATCGCATTATTGCTGCCGTACATACTAATAATGATAAAGAGTCCGCTGAGCCTGAAGAGCTGGTAGAACCCTTTTTGACTCGCTTTGTCGGCCGTGTTCAGAAAAAAGAAGGTGATAATCGTCTATGGATTATTCCTGATCACCCTCTACTCAAAGATGCCATTCCTTGTCGTCCTATAAAAAGCTTAACGCATCCATTTGCCGATCAAGATTGGGCAGTGGCGGAAATGCGCCGACATCCTCTTAAAGGTGATAAACATTTTCAAGCTGAATTAACTGATTTTATTACCGATAAAGATGACCATTTTGCACCTTGGTGGGTGACATTAATGCGTCATCAATTAGAGCGAAATGCACCTGAAGTAGACAGTGAAACATTAACCTTACATGATGATCTACCGCGTGAAGATTTAACCGCGCTCTCCTTTGTGACCATCGATAGTGCTTCAACCGAAGATATGGACGATGCGTTATATATTCGTAAAGAAGAAAATGGCCAACTTTCACTGTATATCGCTATTGCCGATCCAACGGCTTATATTCAGCCTAATAGTGAATTAGATACCATTGCAGCACAACGAGCGCTAACAAACTATCTACCGGGCTTTAATATCCCGATGTTACCTCGTGAGCTATCAGATAATCTCTGCTCATTGCGCCCTAATGAAAAACGTCCTGCGTTAGTCTGCCAAGTGGGTATCATGGAGGATGGTGCATTAACCGATGAGATCCACTTCTACTCAGCATGGGTAGAATCAAAAGCAAAACTGGTTTATGACAATATTTCTGATTGGCTAGAAGGTGAAGAAACACAGTGGGCACCTGAAAATGAGATTGTTCATGAACAAGTCATGCTATTAAAAGAGATGAGCGAGAAACGTCATGTATGGCGTGAACAACATGCTCTCGTCTTTAAAGAGCGTCCTGACTATCGCTTTATTCTTGATGACAGTGGCAACGTATTAGATATCGTGGCGGAAAAACGTCGTACTGCCAACCGTATCGTGGAAGAAGCGATGATCACCGCCAATATTTGTGCGGCAAAGGTACTTAGTCGCAATCTCGGTTTTGGTATTTATAACGTTCATACTGGTTTTGATCCGCTCTATATTGATCAAGTCTCACAAACCTTAAAAGAGCACGGTATTGAAACCAACGCAGATGAGTTATTAACCCTTGAAGGTTTCTGTCGCTTACGTCGTGAACTGGATAATCAGCCAAACCAATTCCTTGATAGCCGTATTCGTCGTTTCCAAAACTTCGCTGAAATAAAAACAGAGCCAGGTCCTCACTTTGGTTTAGGCCTTGAAGCTTATGCGACATGGACATCACCGATCCGTAAATACAGTGATATTTTAAATCACCGTTTATTAAAAGCGATTATCAGCAAAAGTGCGGCAGAAAAACCGCAAGATGAAGATTGTGTTCGTATTGCCGAACGTCGTCGTGCTAACCGTATGGCCGAGCGCGATGTCGGTGATTGGTTATATGCGCGCTTCTTAAAACCTTTTGCTGGCACTGAGAGTACCTTTAATGCCGAAATTATTGATATTACTCGTGGTGGTATTCGGGTACGTTTAGTTGAAAATGGGGCTATTGCCTTTATTCCTGCACCATTTTTACATGCGGTACGTGACGAAATTCAATGTAGTCAAGAAACTGGCTCTGTCATTATTAAAGGTGAAACAGCCTATAAGCTCAACGACATTATTCCGGTACGTATTGAAGATGTGAAACTAGAAACGCGTAATATTGTTGCTCGTCCGATTTAACAGCTATTTAGCGTAATAGATATTATCAAGCTGATAACCTACTCAGGTTA