Homologs in group_676

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02510 FBDBKF_02510 64.4 Morganella morganii S1 - DUF2132 domain-containing protein
EHELCC_02980 EHELCC_02980 64.4 Morganella morganii S2 - DUF2132 domain-containing protein
NLDBIP_00480 NLDBIP_00480 64.4 Morganella morganii S4 - DUF2132 domain-containing protein
LHKJJB_01555 LHKJJB_01555 64.4 Morganella morganii S3 - DUF2132 domain-containing protein
HKOGLL_01595 HKOGLL_01595 64.4 Morganella morganii S5 - DUF2132 domain-containing protein
F4V73_RS04910 F4V73_RS04910 65.2 Morganella psychrotolerans - VF530 family protein

Distribution of the homologs in the orthogroup group_676

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_676

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q5E7H1 8.61e-22 84 55 0 67 1 VF_0530 DNA-binding protein VF_0530 Aliivibrio fischeri (strain ATCC 700601 / ES114)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06170
Feature type CDS
Gene -
Product VF530 family protein
Location 1354173 - 1354457 (strand: -1)
Length 285 (nucleotides) / 94 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_676
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF09905 DNA-binding protein VF530

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4628 Function unknown (S) S Uncharacterized conserved protein, DUF2132 family

Protein Sequence

MTEARSKDPLHGITLEMQVNALVAKYGWVKLSQRIKINCFRNEPSVKSSLKFLRRTPWARSEVEALYLNLVEENLDDTINYSESDPWANSRYKK

Flanking regions ( +/- flanking 50bp)

TACTTTCTTGTACTCTGCTACGCTTTATTATCAACCTATTTGAGTAAACCATGACAGAAGCTCGTTCTAAAGATCCACTACACGGTATCACGCTTGAAATGCAAGTTAATGCGTTAGTGGCTAAATATGGTTGGGTTAAATTAAGCCAACGAATCAAAATTAACTGTTTTAGAAACGAGCCAAGTGTAAAGTCGAGTTTGAAATTTTTGCGCAGAACCCCTTGGGCGCGCTCTGAGGTAGAAGCACTATATCTAAATCTTGTTGAAGAAAACCTTGATGATACAATCAATTATTCTGAAAGTGATCCTTGGGCAAATAGTCGCTATAAAAAATAATTGTTATTTTTATTAATTCTCATCTCTAAAATCCTTTGGTGTCATGCCAA