Homologs in group_747

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02510 FBDBKF_02510 69.0 Morganella morganii S1 - DUF2132 domain-containing protein
EHELCC_02980 EHELCC_02980 69.0 Morganella morganii S2 - DUF2132 domain-containing protein
NLDBIP_00480 NLDBIP_00480 69.0 Morganella morganii S4 - DUF2132 domain-containing protein
LHKJJB_01555 LHKJJB_01555 69.0 Morganella morganii S3 - DUF2132 domain-containing protein
HKOGLL_01595 HKOGLL_01595 69.0 Morganella morganii S5 - DUF2132 domain-containing protein
PMI_RS06170 PMI_RS06170 65.2 Proteus mirabilis HI4320 - VF530 family protein

Distribution of the homologs in the orthogroup group_747

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_747

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q5E7H1 7.27e-23 86 60 0 61 1 VF_0530 DNA-binding protein VF_0530 Aliivibrio fischeri (strain ATCC 700601 / ES114)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS04910
Feature type CDS
Gene -
Product VF530 family protein
Location 1043933 - 1044211 (strand: 1)
Length 279 (nucleotides) / 92 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_747
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF09905 DNA-binding protein VF530

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4628 Function unknown (S) S Uncharacterized conserved protein, DUF2132 family

Protein Sequence

MTANTPKDPLHGVTLEMQVNALVARYGWVKLSQIIKINCFKSDPSVKSSLKFLRRTPWARAEVEALYLDSRDEDIQEEETHPGFNPWTKTIE

Flanking regions ( +/- flanking 50bp)

TCCGGCTGTTTCCCTATTTTTGATATCTGATATAACAGGACACTTTATTCATGACAGCGAATACGCCTAAAGACCCTTTGCACGGCGTCACACTTGAAATGCAGGTTAATGCACTCGTTGCCAGATATGGCTGGGTCAAACTGTCTCAAATTATTAAGATAAATTGTTTTAAAAGTGACCCGAGCGTGAAGTCGAGTCTGAAATTTTTGCGCAGAACCCCCTGGGCCCGTGCAGAAGTTGAAGCGCTGTATCTTGATTCACGGGATGAGGATATTCAGGAAGAAGAGACGCATCCGGGATTCAATCCCTGGACCAAAACTATCGAATAAATATTATCCGGTTTTTCTGCTGCTCAGTGATTAATAACCTGAACCAGGCG