Homologs in group_755

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02640 FBDBKF_02640 91.0 Morganella morganii S1 uup ABC-F family ATPase
EHELCC_03110 EHELCC_03110 91.0 Morganella morganii S2 uup ABC-F family ATPase
NLDBIP_00350 NLDBIP_00350 91.0 Morganella morganii S4 uup ABC-F family ATPase
LHKJJB_01685 LHKJJB_01685 91.0 Morganella morganii S3 uup ABC-F family ATPase
HKOGLL_01725 HKOGLL_01725 91.0 Morganella morganii S5 uup ABC-F family ATPase
F4V73_RS05095 F4V73_RS05095 87.6 Morganella psychrotolerans - ABC-F family ATPase

Distribution of the homologs in the orthogroup group_755

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_755

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9U3 0.0 944 84 1 531 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 0.0 944 84 1 531 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 0.0 944 84 1 531 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
O31716 2.11e-173 503 45 2 526 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O05519 1.14e-103 327 34 5 534 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.32e-17 89 27 6 250 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
A0A0H2VBH0 1.48e-92 298 32 9 528 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63389 1.95e-92 298 32 9 528 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 1.95e-92 298 32 9 528 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P44808 1.09e-91 296 33 6 528 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9LV93 8.63e-86 282 34 11 542 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 3.77e-20 97 29 7 259 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 1.17e-16 87 27 5 246 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9FIB4 2.27e-85 281 34 9 541 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 9.29e-21 99 28 6 259 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
O34512 2.92e-84 273 32 5 510 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 1.39e-26 116 29 4 248 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 1.84e-09 63 25 4 207 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q9FJH6 4.19e-81 267 30 6 523 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q8K268 9.2e-81 269 31 9 529 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 2.92e-13 76 24 10 328 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q9NUQ8 6.16e-80 267 31 9 529 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 6.14e-13 75 22 8 304 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
O59672 1.23e-79 267 31 6 542 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 6.98e-14 78 29 1 134 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P40024 2.03e-79 263 31 9 536 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5R9Z5 2.86e-79 265 31 9 529 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 2.61e-12 73 22 9 310 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q66H39 2.89e-79 265 31 9 529 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 1.96e-13 76 24 10 328 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
O42943 1.22e-78 261 30 9 532 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8H0V6 6.6e-77 259 28 9 544 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
P43535 4.02e-74 253 30 9 530 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 2.7e-11 70 25 5 235 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q99LE6 1.76e-73 248 29 7 534 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9UG63 4.6e-73 247 29 7 534 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
P43672 6.7e-73 246 32 9 504 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 4.95e-26 115 28 3 234 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 1.07e-10 67 24 3 225 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
Q9M1H3 1.94e-72 247 29 11 551 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q8T6B7 3.29e-72 244 29 7 519 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 7.18e-15 80 27 4 221 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 1.4e-13 77 25 5 239 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q2KJA2 4.24e-69 236 29 7 531 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q57242 3.93e-68 234 32 12 520 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 5.29e-23 106 26 3 234 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 2.09e-09 63 28 5 220 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8T6B4 8.12e-67 237 27 9 523 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 1.84e-14 80 26 8 241 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
O06476 4.88e-66 228 29 12 538 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 1.83e-24 110 29 5 248 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
P0A9W5 9.88e-64 220 30 12 523 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 1.98e-20 98 26 4 231 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 3.36e-18 91 30 8 251 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 9.88e-64 220 30 12 523 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 1.98e-20 98 26 4 231 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 3.36e-18 91 30 8 251 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 9.88e-64 220 30 12 523 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 1.98e-20 98 26 4 231 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 3.36e-18 91 30 8 251 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
Q8SRV5 6.47e-63 218 30 14 512 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 1.44e-15 83 26 4 235 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 6.19e-13 74 26 5 209 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
P45127 8.31e-63 218 30 11 526 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 3.54e-21 100 28 6 259 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 1.33e-20 99 27 4 231 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2VFI8 8.39e-63 218 30 12 523 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 2.07e-20 98 26 4 231 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 3.98e-18 91 30 8 251 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6MG08 3.54e-61 219 28 8 531 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 5.11e-12 72 26 4 236 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q767L0 3.06e-60 216 28 7 526 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 4.47e-12 72 27 4 229 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q8NE71 2.59e-59 213 28 7 526 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.31e-11 71 26 4 229 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 4.74e-59 212 28 7 526 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.08e-11 71 26 4 229 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
P9WQK3 1.2e-58 207 29 8 509 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 2.51e-15 82 27 3 229 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 1.2e-58 207 29 8 509 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 2.51e-15 82 27 3 229 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6P542 1.36e-58 211 28 8 531 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 1.27e-12 74 27 4 229 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q8K9I3 4.96e-57 203 29 11 517 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 5.14e-29 124 30 4 210 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P39115 1.47e-53 193 28 15 540 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 7.86e-19 93 30 4 193 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
Q9USH9 1.9e-52 194 25 10 529 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 2.65e-13 76 24 3 219 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 1e-11 71 24 4 247 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25256 1.04e-51 188 27 12 539 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 9.87e-10 64 31 0 91 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 1.9e-05 51 32 2 91 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P0DX93 7e-51 184 28 18 552 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.16e-18 91 29 4 182 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P57445 1.92e-48 180 27 8 515 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 1.07e-21 102 26 3 207 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q45978 1.62e-36 146 26 14 523 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 2.74e-19 95 31 3 194 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 1.2e-15 83 29 5 240 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P23212 1.53e-33 136 25 18 519 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 4.23e-16 84 32 5 176 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
O14134 2.79e-33 138 25 14 468 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.58e-12 72 28 7 205 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 9.03e-09 62 34 0 79 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 8.12e-08 58 31 1 92 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08972 3.87e-32 135 28 13 398 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.3e-13 77 27 6 198 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.14e-07 58 37 0 64 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 6.2e-06 53 32 1 80 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45167 7.4e-31 128 33 9 332 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 5.59e-09 62 27 5 220 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 7.51e-05 48 36 0 57 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O94489 2.76e-30 129 26 10 393 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.99e-13 77 27 3 195 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.21e-08 61 35 0 70 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 5.29e-07 56 39 0 64 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 0.000688 46 27 0 79 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93796 3.82e-30 129 26 12 399 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.93e-14 80 26 2 198 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.11e-09 65 42 1 76 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.2e-09 65 32 0 79 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P29551 1.13e-29 127 27 10 398 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 5.92e-14 78 27 4 197 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.64e-08 60 39 0 64 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 3.93e-08 60 35 0 70 3 TEF3 Elongation factor 3 Pneumocystis carinii
P16521 4.07e-29 125 25 9 395 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 3.68e-13 76 25 2 198 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.12e-08 61 31 0 79 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.67e-08 60 40 1 75 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 0.0005 47 39 0 56 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 7.21e-29 125 26 12 399 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 8.2e-15 81 27 3 195 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 5.22e-10 66 32 0 79 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 9.48e-09 62 38 1 76 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q75EV6 9.81e-29 124 26 10 397 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.57e-12 73 26 2 198 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.38e-09 63 34 0 70 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.08e-08 60 38 1 76 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
D0MYB4 1.13e-28 124 27 15 400 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 6.69e-15 81 27 5 201 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 5.08e-08 59 38 0 63 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 8.44e-08 58 38 1 75 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.57e-06 54 33 0 80 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
P12622 5.57e-28 116 33 3 230 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 2.25e-10 65 33 2 128 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.67e-05 50 35 0 64 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P25997 8.77e-27 119 24 9 424 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.14e-12 73 27 4 202 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.07e-09 63 30 0 79 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q73P93 2.78e-24 109 24 11 374 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 2.76e-09 63 24 6 199 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8TSC8 1.49e-22 105 24 17 552 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 8.63e-12 71 28 8 238 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 2.88e-07 57 24 5 213 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8ES39 6.84e-22 102 24 20 509 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8TQ05 2.54e-21 101 23 16 521 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 4.08e-07 56 28 8 205 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q1Q889 6.74e-20 92 29 3 192 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 2.59e-14 76 27 5 215 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6HI76 6.96e-20 96 24 18 546 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6D4A8 7.38e-20 92 28 5 210 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 2.55e-18 88 31 8 219 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8PSR0 7.53e-20 96 27 14 376 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q81PZ8 9.6e-20 96 24 18 546 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q28VN1 4.08e-19 90 29 4 194 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 6.38e-12 69 26 8 222 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q32HA3 4.95e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 9.83e-13 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 5.19e-19 90 28 7 226 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 1.27e-12 71 26 6 214 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 5.19e-19 90 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 1.27e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q81CT8 5.39e-19 94 23 17 570 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 4.25e-07 56 26 7 223 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
O68106 6.81e-19 90 32 7 212 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O68106 1.15e-06 53 26 9 221 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54537 7.73e-19 89 27 6 251 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 3.1e-09 61 23 7 216 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8PVG9 8.16e-19 93 24 17 529 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PVG9 1.71e-09 63 26 7 214 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PVG9 3.02e-06 53 25 5 218 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q897I2 8.81e-19 92 24 14 384 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 1.08e-08 61 27 7 202 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q9CP24 1.16e-18 89 32 5 209 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q9CP24 2.01e-07 55 27 7 223 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q74I62 1.54e-18 92 24 24 538 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 4.95e-06 53 24 8 215 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8XK20 1.56e-18 92 23 18 525 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.13e-10 67 26 6 216 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8RD07 1.74e-18 88 29 7 230 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 4.36e-13 72 28 7 210 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1R155 1.76e-18 88 31 4 192 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 6.66e-09 60 24 5 214 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q87G35 1.78e-18 92 24 18 556 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 1.92e-06 54 27 7 179 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q83KR7 1.94e-18 88 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 1.34e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 1.94e-18 88 28 7 226 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 1.34e-12 71 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q2GFZ6 2.03e-18 88 29 4 203 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q2GFZ6 4.93e-08 57 24 5 219 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5LUR8 2.04e-18 88 30 5 198 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 2.27e-13 73 27 6 219 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q2K3Y7 2.58e-18 91 21 15 541 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8D3Z9 2.64e-18 91 24 23 557 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 9.25e-06 52 26 7 175 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q7N545 3.44e-18 87 26 7 226 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 3.11e-12 70 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q4FQ27 6.57e-18 86 28 3 192 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 5.76e-13 72 26 5 215 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1B9K8 7.83e-18 86 26 4 204 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 5.71e-11 66 27 8 217 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q6FFL0 7.86e-18 86 28 3 181 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 5.55e-11 66 30 8 210 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q737I0 8e-18 90 21 15 534 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
A1JRI2 9.13e-18 86 28 5 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 1.06e-17 86 27 5 209 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q74DN5 1.11e-17 86 29 5 224 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 3.32e-14 75 31 7 209 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q6LTB1 1.12e-17 86 29 5 202 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 9.64e-15 77 27 7 226 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q9HT73 1.26e-17 86 26 4 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 1.41e-06 53 21 4 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.26e-17 86 26 4 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 1.41e-06 53 21 4 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
A0KPH6 2.16e-17 85 28 5 192 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 4.11e-10 63 26 7 219 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
O27739 2.56e-17 86 30 7 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27739 1.3e-11 69 31 9 226 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8PY26 2.56e-17 85 30 8 229 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PY26 5.81e-08 57 26 10 239 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1CJG3 2.62e-17 85 27 4 206 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.31e-15 80 27 6 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 2.62e-17 85 27 4 206 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.31e-15 80 27 6 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 2.62e-17 85 27 4 206 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.31e-15 80 27 6 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q66AT7 3.19e-17 84 27 4 206 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 1.42e-15 80 27 6 215 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZNV7 3.52e-17 84 25 6 224 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 4.39e-13 72 25 6 215 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5W6 3.69e-17 84 25 6 224 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 3.19e-13 73 24 5 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q5PIA5 4.26e-17 84 25 6 224 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 4.07e-13 72 24 5 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 4.26e-17 84 25 6 224 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 4.07e-13 72 24 5 215 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q2FRT7 4.35e-17 87 29 10 236 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FRT7 8.79e-09 61 29 9 207 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q9I6L0 6.07e-17 85 30 9 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 3.25e-10 65 24 9 302 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O34362 6.13e-17 87 24 24 543 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
O34362 2.07e-09 63 29 7 179 1 ykoD Putative HMP/thiamine import ATP-binding protein YkoD Bacillus subtilis (strain 168)
P44692 6.56e-17 84 28 5 235 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44692 1.72e-09 62 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MMN0 7.12e-17 84 27 5 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 4.12e-12 70 28 6 213 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 7.12e-17 84 27 5 197 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 4.12e-12 70 28 6 213 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q6HG98 7.4e-17 87 24 20 543 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 4.44e-06 53 24 7 210 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q21PQ7 9.2e-17 83 26 5 207 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21PQ7 1.2e-11 68 25 9 235 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VTB6 1.07e-16 83 26 6 219 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 2.59e-07 55 23 6 221 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q87UN0 1.09e-16 83 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HBR8 1.16e-16 83 27 3 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5HBR8 1.03e-09 62 25 5 217 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.16e-16 83 27 3 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q5FHB0 1.03e-09 62 25 5 217 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
P31060 1.29e-16 86 22 18 525 2 modF ABC transporter ATP-binding protein ModF Escherichia coli (strain K12)
Q3IWB5 1.45e-16 82 29 4 194 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 4.82e-12 69 26 6 219 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q4KKK4 1.45e-16 83 27 5 208 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 1.61e-10 65 24 4 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1IGY7 1.46e-16 83 24 6 209 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 1.61e-09 62 21 3 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q3A558 1.48e-16 82 30 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3A558 7.76e-12 68 25 8 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5E6M2 1.5e-16 83 28 3 174 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 2.94e-11 67 23 7 265 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q48PV0 1.7e-16 83 26 3 177 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q831K6 1.75e-16 84 27 6 272 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q831K6 2.07e-09 62 23 6 211 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q14Q07 1.82e-16 84 30 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 4.48e-08 58 27 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q87RE5 1.83e-16 82 28 4 180 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 5.62e-12 69 27 11 260 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2K6Q4 1.93e-16 84 30 5 194 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q31I51 1.97e-16 82 25 4 201 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 9.33e-12 68 25 6 221 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4ZZS2 2.01e-16 82 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
A5U7B7 2.09e-16 82 30 8 236 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A5U7B7 4.17e-13 72 26 7 215 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q65VG9 2.17e-16 84 27 11 299 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O05779 2.3e-16 82 30 8 236 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O05779 4.76e-13 72 26 7 215 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q81N53 2.63e-16 85 24 18 528 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 7.49e-07 55 24 7 210 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q88ZZ2 3.04e-16 85 23 25 542 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q93D97 3.4e-16 85 24 21 527 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93D97 5.32e-06 52 26 10 234 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9EYM2 3.95e-16 81 33 8 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 1.67e-09 61 25 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q7NTN6 3.97e-16 84 24 19 519 3 rbsA Ribose import ATP-binding protein RbsA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q0I4A9 4.1e-16 82 29 4 198 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q0I4A9 1.94e-09 62 26 6 213 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q5PB72 4.51e-16 81 28 7 230 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q3KKA1 4.58e-16 81 26 5 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.35e-10 65 24 4 214 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q1GL85 4.88e-16 81 28 3 185 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q65UG3 4.95e-16 81 29 6 215 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UG3 1.6e-09 62 28 7 214 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8DQY5 5.18e-16 84 22 21 523 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 2.09e-07 57 23 6 214 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q9Z8J5 5.21e-16 81 30 10 223 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q9Z8J5 7.85e-09 60 23 9 249 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q9A502 5.34e-16 82 28 7 232 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A502 5.7e-09 61 26 9 210 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q88AS5 5.63e-16 82 30 8 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88AS5 2.19e-09 62 24 6 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q97SA3 5.76e-16 84 23 22 526 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 2.62e-07 57 24 6 213 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q3YSK9 6.48e-16 80 27 3 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q3YSK9 1.79e-09 62 25 8 217 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q97JB8 6.67e-16 81 29 6 233 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 3.36e-09 61 26 7 230 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q89AJ0 6.76e-16 80 25 4 192 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 1.59e-14 76 26 6 211 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q2SPI3 8.59e-16 80 29 5 195 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 1.93e-08 58 24 5 215 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q92P76 8.96e-16 81 31 5 179 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q92P76 4.91e-07 55 28 6 204 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q8KF76 1.12e-15 80 32 8 216 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KF76 7.64e-10 62 28 7 212 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q734T1 1.19e-15 83 24 20 547 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4QMH4 1.23e-15 82 30 9 239 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q4QMH4 1.59e-06 53 25 10 234 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q8DY60 1.46e-15 83 24 20 537 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8DY60 9.88e-07 55 27 12 232 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3B276 1.55e-15 79 30 8 232 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q3B276 7.88e-10 62 28 6 214 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q97KZ3 1.66e-15 79 29 6 213 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KZ3 1e-13 74 28 8 219 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
O32188 1.67e-15 80 25 7 221 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
O32188 8.42e-07 54 24 8 239 1 yusV Probable siderophore transport system ATP-binding protein YusV Bacillus subtilis (strain 168)
Q57399 1.92e-15 79 28 7 200 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q13LD8 2.21e-15 81 29 7 216 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q160Y9 2.45e-15 79 27 4 195 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 8.24e-09 60 23 6 215 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q88RL1 2.51e-15 79 25 4 177 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 4.3e-10 63 22 3 215 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q832Y6 2.55e-15 80 27 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q146E7 2.59e-15 79 27 7 212 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q4QND5 2.61e-15 79 30 6 222 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q4QND5 1.45e-08 59 24 5 214 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q3AKM8 2.94e-15 79 28 7 217 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q3AKM8 4.08e-05 48 23 8 228 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q8TI15 2.94e-15 79 29 8 230 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8RI39 3e-15 80 25 6 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8RI39 6.13e-09 61 23 7 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q3Z300 3.01e-15 78 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 1.07e-08 59 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 3.01e-15 78 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 1.07e-08 59 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 3.01e-15 78 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 1.07e-08 59 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 3.01e-15 78 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 1.07e-08 59 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A0LCH8 3.11e-15 79 29 5 194 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 8.86e-10 63 25 5 219 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P75957 3.19e-15 78 27 4 215 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 1.06e-08 59 25 8 223 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P10346 3.26e-15 78 27 6 235 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P10346 9.14e-07 53 25 9 212 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q4L4R9 3.42e-15 80 30 8 219 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q9G4F5 3.51e-15 80 30 10 212 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q9G4F5 3.45e-08 59 23 7 221 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
A1U776 4.13e-15 79 28 5 211 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5V6B8 4.26e-15 79 29 7 198 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V6B8 2.58e-11 67 27 4 195 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q839D5 4.73e-15 79 31 9 229 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q839D5 8.67e-08 57 24 6 231 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8E3S6 5.46e-15 81 24 20 537 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8E3S6 3.08e-06 53 25 11 231 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q1MEG2 5.57e-15 79 29 5 194 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q83CV2 5.86e-15 77 27 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83CV2 5.32e-14 75 28 7 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q9WXX8 6.14e-15 77 32 7 186 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 1.75e-12 70 28 7 227 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7MN25 6.18e-15 79 28 8 234 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q7MN25 9.13e-08 57 25 7 216 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
A1JIE0 6.35e-15 79 29 7 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JIE0 1.53e-06 53 23 8 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8DFC3 7.02e-15 79 28 8 234 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q8DFC3 1.05e-07 57 25 7 216 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q72D73 7.33e-15 78 31 8 223 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 8.36e-13 72 27 6 209 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O84071 7.5e-15 78 27 10 236 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q832R5 8.16e-15 80 22 21 544 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q9CN78 8.37e-15 77 28 5 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q9CN78 6.86e-12 68 25 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q48PU6 8.7e-15 79 29 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PU6 5.78e-08 58 24 8 215 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8T674 8.72e-15 80 26 5 225 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
Q1QCN2 8.86e-15 77 29 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 2.93e-14 75 28 6 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q92VJ2 9.19e-15 79 28 9 230 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 5.62e-14 77 26 7 221 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q49W48 9.49e-15 79 28 8 236 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
O51587 1.01e-14 79 28 9 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O51587 8.32e-08 57 25 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q0SML1 1.01e-14 79 27 8 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0SML1 1.23e-08 60 26 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q88CL2 1.04e-14 79 29 7 208 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88CL2 7.2e-09 61 25 7 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8X8E3 1.12e-14 77 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8X8E3 4.87e-08 57 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q9WY65 1.12e-14 77 29 7 227 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7WID6 1.19e-14 79 26 6 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WID6 1.13e-05 51 23 7 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7VYN2 1.22e-14 79 26 6 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VYN2 1.16e-05 51 23 7 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q660M8 1.23e-14 79 28 9 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q660M8 8.17e-08 57 25 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q6GIH9 1.24e-14 79 27 6 221 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
P47365 1.28e-14 80 21 23 553 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47365 7.09e-07 55 23 9 231 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q2GJA5 1.36e-14 77 25 7 238 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q97KD5 1.39e-14 78 25 9 293 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KD5 3.81e-10 65 25 4 207 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q92CK1 1.42e-14 77 31 9 233 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92CK1 4.82e-07 55 26 7 240 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q93DA2 1.59e-14 78 26 9 274 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q93DA2 0.000114 48 23 7 201 3 metN Methionine import ATP-binding protein MetN Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P44785 1.74e-14 78 29 7 220 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44785 4.11e-06 52 24 9 234 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5E284 1.78e-14 76 31 4 190 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E284 1.2e-05 50 27 8 221 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q1D382 1.79e-14 76 29 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Myxococcus xanthus (strain DK1622)
Q1D382 1.8e-09 61 26 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Myxococcus xanthus (strain DK1622)
O34946 1.81e-14 76 27 8 213 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 5.88e-09 60 22 7 221 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q8PKT0 1.89e-14 76 29 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
Q8PKT0 4.49e-12 69 27 7 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
P42246 1.94e-14 77 30 9 211 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 3.47e-08 58 26 7 203 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q18C09 2.05e-14 77 25 8 263 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 1.11e-07 57 25 6 209 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q32EX7 2.09e-14 76 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 5.93e-09 60 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q7UPK3 2.1e-14 76 29 9 221 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q73EL7 2.15e-14 78 27 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73EL7 2.48e-08 59 24 6 228 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q2YWP2 2.15e-14 78 28 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5ZWE4 2.27e-14 78 27 6 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZWE4 3.08e-09 62 24 8 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q6D201 2.29e-14 77 29 10 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 5.05e-11 67 26 6 220 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3K9F9 2.49e-14 75 29 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q5X627 2.58e-14 78 27 6 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q5X627 2.12e-09 63 24 8 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q254K9 2.63e-14 77 26 6 238 3 metN Methionine import ATP-binding protein MetN Chlamydia felis (strain Fe/C-56)
Q2SI12 2.79e-14 76 29 4 206 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q2SI12 6.42e-08 57 28 7 221 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q1MBG4 2.94e-14 79 20 14 541 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MBG4 0.000194 47 27 6 195 3 araG Arabinose import ATP-binding protein AraG Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q9K876 3.03e-14 77 26 7 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 2.61e-11 68 25 5 219 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9XDA6 3.34e-14 76 26 7 237 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 4.53e-13 72 24 9 243 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P48334 3.4e-14 75 25 6 173 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
P48334 9.43e-11 65 26 5 219 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q7NX01 3.41e-14 77 31 10 218 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 1.69e-11 69 27 6 220 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q31ZH4 3.44e-14 75 27 4 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q31ZH4 7.34e-09 60 25 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q7A6M2 3.69e-14 77 27 6 221 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 3.69e-14 77 27 6 221 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q1IGZ0 3.89e-14 77 29 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q1IGZ0 1.01e-07 57 23 9 235 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q926D8 3.95e-14 75 25 9 240 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 4.93e-13 72 26 7 237 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q4KKK8 4.03e-14 77 29 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK8 4.41e-07 55 22 7 237 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9KQB8 4.18e-14 75 26 5 194 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 5.76e-11 66 26 6 215 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1WXT0 4.25e-14 75 26 3 178 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 3.39e-09 61 25 7 216 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q81V82 4.3e-14 76 26 9 240 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q81V82 5.71e-09 60 25 9 236 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q1CFH7 4.31e-14 77 29 8 227 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CFH7 1.13e-05 51 24 7 218 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 4.31e-14 77 29 8 227 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q8ZH38 1.13e-05 51 24 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 4.31e-14 77 29 8 227 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CAK4 1.13e-05 51 24 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q57QD7 4.36e-14 75 28 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 2.14e-11 67 25 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
O34392 4.38e-14 75 27 5 200 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 5.53e-11 66 24 6 204 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q7VM95 4.39e-14 77 29 10 242 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8D385 4.45e-14 75 28 3 157 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8D385 1.22e-07 56 26 10 252 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q4KC87 4.5e-14 77 24 3 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q0A9E2 4.56e-14 75 25 3 185 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q576K0 4.64e-14 76 28 5 195 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 4.64e-14 76 28 5 195 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q6G5J0 4.76e-14 77 26 5 205 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q66FU4 4.78e-14 77 27 6 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8VNL9 4.85e-14 76 30 8 210 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q8VNL9 2.64e-07 55 29 9 211 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q8YDJ8 5e-14 76 28 5 195 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1CNC6 5e-14 77 27 6 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 5e-14 77 27 6 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 5e-14 77 27 6 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q58283 5.01e-14 76 26 6 232 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58283 2.55e-11 68 26 7 230 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q4ZZR8 5.17e-14 76 27 6 235 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZR8 3.56e-08 58 23 8 234 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q7W6G5 5.17e-14 77 26 6 213 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7W6G5 8.91e-05 48 23 7 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q10418 5.25e-14 78 28 8 241 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q10418 7.02e-10 65 24 8 222 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q3BTD3 5.3e-14 75 29 5 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BTD3 1.82e-12 70 26 9 249 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q6D664 5.3e-14 75 28 5 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D664 9.85e-12 68 27 8 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8NXH5 5.42e-14 77 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 5.42e-14 77 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 5.42e-14 77 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 5.42e-14 77 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 5.42e-14 77 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
P0A2U7 5.52e-14 75 27 7 211 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 5.52e-14 75 27 7 211 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5HQQ9 5.57e-14 76 26 7 237 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5QU46 5.62e-14 74 28 7 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 5.26e-12 68 27 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q82WT5 5.66e-14 77 26 7 229 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q21JQ9 6.12e-14 74 28 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21JQ9 5.92e-11 65 25 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q7VLS9 6.21e-14 75 27 7 231 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VLS9 5.34e-07 54 26 7 225 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q07QX6 6.29e-14 78 27 7 230 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q07QX6 4.18e-07 56 25 12 252 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q6D5H7 6.33e-14 76 27 6 221 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D5H7 1.83e-11 69 26 7 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q62K82 6.43e-14 76 29 10 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q62K82 7.62e-11 67 25 7 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q63TY1 6.61e-14 76 29 10 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q63TY1 5.76e-11 67 25 7 237 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q39T41 6.7e-14 74 25 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q39T41 2.84e-11 67 28 7 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q83RS0 6.87e-14 74 27 4 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q83RS0 1.45e-08 58 24 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q24QI5 6.87e-14 76 29 7 215 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q6HP89 7e-14 76 26 5 216 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HP89 2.99e-08 59 24 6 228 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P30750 7e-14 76 28 7 239 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
P30750 0.000317 46 23 7 219 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q667L9 7.13e-14 76 29 8 227 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q667L9 1.54e-05 50 24 7 218 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q81ZF5 7.13e-14 76 26 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q81ZF5 2.96e-08 59 24 6 228 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus anthracis
Q57554 7.15e-14 75 27 7 209 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57554 1.17e-09 62 24 8 229 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P61482 7.34e-14 74 27 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 1.57e-11 67 26 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 7.34e-14 74 27 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 1.57e-11 67 26 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 7.34e-14 74 27 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 1.57e-11 67 26 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A0LM36 8e-14 77 30 6 210 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A0LM36 3.66e-09 63 25 9 222 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8P2K6 8.06e-14 76 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8P2K6 4.46e-07 55 24 5 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q98G43 8.16e-14 76 27 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q89UD2 8.56e-14 76 28 6 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 2.88e-12 71 27 6 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q32JQ8 8.56e-14 76 27 7 239 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q9HT70 9.2e-14 76 29 8 232 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 9.2e-14 76 29 8 232 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q5WXF0 9.31e-14 76 27 6 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q8TIX0 9.86e-14 75 29 8 211 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIX0 8.86e-09 60 27 7 222 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6ME20 9.91e-14 75 29 6 216 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6ME20 1.62e-07 57 25 9 218 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
A0A0H2ZLL3 9.92e-14 74 25 7 220 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0A0H2ZLL3 5.62e-12 69 30 9 207 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q20Z38 1.02e-13 77 26 7 230 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q20Z38 5.03e-05 49 23 11 273 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q8XNY7 1.06e-13 75 30 9 232 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q87RS1 1.09e-13 75 25 5 227 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RS1 3.05e-07 56 25 8 213 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0TLD2 1.14e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q4FTM3 1.19e-13 73 29 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 1.97e-13 73 28 6 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
P96117 1.21e-13 74 26 7 207 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P96117 8.52e-12 69 27 7 220 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q3Z5F8 1.26e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 1.26e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 1.26e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 1.26e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q66FK0 1.27e-13 74 26 9 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66FK0 6.77e-07 54 24 9 227 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CE65 1.27e-13 74 26 9 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CE65 6.77e-07 54 24 9 227 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Nepal516)
Q56993 1.27e-13 74 26 9 231 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q56993 6.77e-07 54 24 9 227 1 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis
Q1C0Q8 1.27e-13 74 26 9 231 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C0Q8 6.77e-07 54 24 9 227 3 hmuV Hemin import ATP-binding protein HmuV Yersinia pestis bv. Antiqua (strain Antiqua)
Q8XIZ5 1.29e-13 75 27 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q8XIZ5 2.1e-07 56 26 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.29e-13 75 27 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ3 2.1e-07 56 26 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q2YXZ0 1.31e-13 73 28 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YXZ0 1.42e-05 50 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
P75186 1.31e-13 75 23 11 298 3 pstB Phosphate import ATP-binding protein PstB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8CTB2 1.32e-13 75 26 7 237 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
P63354 1.32e-13 75 27 7 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63354 2.7e-10 65 25 6 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 1.32e-13 75 27 7 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P63353 2.7e-10 65 25 6 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q1JII9 1.38e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JII9 2.64e-07 56 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q8U8D6 1.41e-13 74 28 4 211 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U8D6 1.24e-11 68 26 5 197 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q88RL5 1.47e-13 75 29 8 232 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL5 4.21e-07 55 25 9 227 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0SRL2 1.54e-13 75 27 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 8.06e-07 54 25 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6LX68 1.56e-13 74 30 7 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LX68 2.85e-06 52 26 8 218 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6MU19 1.57e-13 75 27 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 2.79e-10 65 26 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5XDS8 1.61e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XDS8 1.12e-07 57 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q1LLP5 1.67e-13 75 26 7 226 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9KLQ5 1.69e-13 75 27 7 218 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KLQ5 7.55e-08 58 23 6 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q1J8E4 1.75e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J8E4 1.7e-07 57 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
P0C0E2 1.78e-13 73 28 8 241 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 6.6e-11 65 27 5 196 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 1.78e-13 73 28 8 241 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 6.6e-11 65 27 5 196 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q5JEB0 1.79e-13 75 28 5 204 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8FUU5 1.83e-13 74 28 5 195 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q4PH16 1.87e-13 77 25 8 243 3 ATM1 Iron-sulfur clusters transporter ATM1, mitochondrial Ustilago maydis (strain 521 / FGSC 9021)
Q2SSS4 1.87e-13 75 27 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 1.98e-10 66 26 7 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P73265 1.89e-13 73 27 5 197 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73265 9.91e-08 57 25 6 208 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q13VD7 1.89e-13 75 27 6 237 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q13VD7 2.1e-09 62 25 8 234 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q8U4L3 1.94e-13 73 28 9 225 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 5.7e-08 57 26 8 215 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q48V78 1.95e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48V78 4.34e-07 55 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 1.95e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q9A1E3 4.34e-07 55 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q1JNE0 1.99e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JNE0 7.51e-08 58 26 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 1.99e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JDG6 7.51e-08 58 26 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0CZ31 2.06e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ31 2.81e-07 56 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 2.06e-13 75 26 4 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ30 2.81e-07 56 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q0K2U3 2.17e-13 73 27 7 230 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K2U3 1.72e-05 50 26 6 196 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q325U1 2.21e-13 75 27 7 239 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q8D0W8 2.23e-13 75 25 7 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8D0W8 1.24e-11 69 27 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q7N986 2.25e-13 75 27 8 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7W9U5 2.32e-13 75 29 9 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P57403 2.34e-13 73 29 4 197 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5PCG9 2.45e-13 74 26 8 226 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 4.03e-10 65 25 5 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Y7R4 2.46e-13 73 30 9 235 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y7R4 4.18e-08 58 26 6 237 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q97KS6 2.5e-13 75 25 8 222 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 0.000471 46 21 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7WGW1 2.56e-13 75 29 9 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57243 2.56e-13 73 28 7 215 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57243 2.15e-09 62 25 6 225 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9HZL7 2.61e-13 72 26 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.59e-11 67 25 8 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6F0V4 2.62e-13 74 26 8 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q0SWH9 2.78e-13 73 29 9 231 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q0SWH9 1.19e-05 50 24 6 218 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q6GH28 2.84e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q6GH28 1.03e-05 50 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q720M2 2.88e-13 73 30 9 235 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q720M2 4.46e-08 58 26 6 237 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q8NWT6 2.89e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q8NWT6 1.72e-05 49 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 2.89e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q6G9I1 1.72e-05 49 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q895C4 3.23e-13 74 24 11 296 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q895C4 3.23e-12 71 26 8 234 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q16BJ3 3.35e-13 73 28 7 210 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q16BJ3 1.78e-08 59 25 6 221 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q74AT2 3.36e-13 72 28 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74AT2 1.94e-09 61 26 9 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q4W575 3.37e-13 74 27 7 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 8.57e-09 60 23 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 3.37e-13 74 27 7 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 8.57e-09 60 23 5 226 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q890R3 3.38e-13 73 28 6 227 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium tetani (strain Massachusetts / E88)
Q890R3 1.1e-05 50 24 7 209 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium tetani (strain Massachusetts / E88)
Q0TUN8 3.5e-13 73 29 9 231 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q2L0H5 3.52e-13 74 25 6 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q3KJS6 3.53e-13 74 27 5 221 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q3KJS6 6.47e-10 64 24 7 202 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q83MC5 3.56e-13 74 27 7 239 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 3.56e-13 74 27 7 239 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q8P8V9 3.67e-13 72 29 9 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8P8V9 1.43e-11 68 26 7 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV71 3.67e-13 72 29 9 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q4UV71 1.43e-11 68 26 7 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q668K6 3.84e-13 74 25 7 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 1.19e-11 70 27 5 221 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
A0PY57 3.85e-13 74 24 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
A0PY57 1.69e-06 53 25 8 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
O07016 3.97e-13 73 27 6 209 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 4.78e-08 58 25 4 209 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O57896 4.07e-13 74 28 7 205 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O57896 2.3e-07 56 23 5 197 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q65F80 4.08e-13 74 29 10 217 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5HG41 4.34e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q5HG41 1.61e-05 50 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 4.34e-13 72 27 4 200 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FYQ8 1.61e-05 50 24 8 229 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 4.34e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q2FH58 1.61e-05 50 24 8 229 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q7A5Q9 4.38e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q7A5Q9 9.73e-06 50 25 10 233 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 4.38e-13 72 27 4 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99UA3 9.73e-06 50 25 10 233 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8TIW9 4.57e-13 73 26 5 217 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIW9 5.95e-12 69 30 7 210 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6G194 4.66e-13 73 26 5 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella quintana (strain Toulouse)
P94440 4.81e-13 73 26 5 235 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
P94440 1.4e-11 69 30 9 210 1 lnrL Linearmycin resistance ATP-binding protein LnrL Bacillus subtilis (strain 168)
Q6D1C4 4.85e-13 73 29 8 238 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q9A9P4 4.94e-13 72 27 8 244 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9A9P4 2.95e-09 61 24 8 227 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q609Q1 5.24e-13 73 26 9 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 2.33e-12 72 26 11 340 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q7VNG4 5.43e-13 73 27 6 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P70970 5.56e-13 72 29 4 193 3 ecfAB Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus subtilis (strain 168)
P70970 7.26e-09 60 28 7 208 3 ecfAB Energy-coupling factor transporter ATP-binding protein EcfA2 Bacillus subtilis (strain 168)
Q47C66 5.69e-13 72 27 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q04FM1 5.9e-13 73 28 8 235 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q04FM1 7.49e-11 66 27 6 200 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q6F813 5.91e-13 75 27 9 269 3 macB Macrolide export ATP-binding/permease protein MacB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F813 2.88e-10 66 29 9 220 3 macB Macrolide export ATP-binding/permease protein MacB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FAN3 6.11e-13 73 27 6 217 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8ZRM9 6.15e-13 73 27 7 239 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q81IZ6 6.24e-13 73 26 9 251 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81IZ6 9.05e-08 57 24 8 212 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8XHV3 6.29e-13 72 29 6 221 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain 13 / Type A)
Q8XHV3 1.19e-08 60 28 10 207 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain 13 / Type A)
Q0TMS8 6.29e-13 72 29 6 221 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TMS8 1.19e-08 60 28 10 207 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8Y0C6 6.37e-13 72 28 11 217 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y0C6 4.45e-12 69 28 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q57T09 6.37e-13 73 27 7 239 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q7N3A6 6.43e-13 72 28 8 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3A6 3.33e-09 60 27 8 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q471U2 6.56e-13 72 26 7 230 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q471U2 7.94e-05 48 25 3 164 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8CRI7 6.61e-13 72 27 5 204 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8CRI7 1.34e-07 56 24 6 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5FA19 6.79e-13 73 25 7 210 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 1.29e-10 66 24 5 226 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q81IN8 7e-13 73 26 5 216 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81IN8 5.12e-08 58 24 6 228 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2S3A3 7.02e-13 72 27 10 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q2S3A3 4.65e-10 63 27 10 244 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q3ATY5 7.08e-13 72 27 7 235 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q3ATY5 3.77e-09 60 27 6 217 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q63H29 7.16e-13 73 26 8 244 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q63H29 1.18e-07 57 24 8 212 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus cereus (strain ZK / E33L)
Q830W6 7.27e-13 73 28 7 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q830W6 1.16e-10 67 25 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
Q92XW1 7.28e-13 73 28 9 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q92XW1 1.58e-10 66 24 7 220 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
Q55740 7.48e-13 72 27 6 237 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 1.33e-08 59 28 10 250 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34338 7.52e-13 72 26 8 241 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
O34338 1.53e-12 71 25 8 231 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
A1URR2 7.78e-13 73 26 5 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q5L222 7.84e-13 73 25 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 2.29e-10 65 23 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q8EPK1 7.89e-13 73 26 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EPK1 7.89e-08 57 26 6 228 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q81VM2 7.91e-13 73 26 8 244 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q81VM2 1.29e-07 57 24 8 212 3 metN1 Methionine import ATP-binding protein MetN 1 Bacillus anthracis
Q5HM28 7.95e-13 72 27 5 204 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HM28 1.48e-07 56 24 6 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q18AM3 7.97e-13 73 26 9 236 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q4FU75 8.18e-13 74 30 9 208 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q88KY4 8.36e-13 71 26 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9V2C0 8.68e-13 73 25 6 205 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q9V2C0 4.71e-07 55 24 4 170 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q87FK7 8.95e-13 74 21 20 545 3 araG Arabinose import ATP-binding protein AraG Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q07PZ0 9.55e-13 72 26 8 250 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q07PZ0 2.94e-10 64 26 6 183 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Rhodopseudomonas palustris (strain BisA53)
Q58429 9.63e-13 72 24 5 239 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58429 7.14e-11 66 26 7 206 3 MJ1023 Uncharacterized ABC transporter ATP-binding protein MJ1023 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7VZE5 9.74e-13 73 29 9 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q46ZM0 1.01e-12 73 26 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q87UN4 1.01e-12 72 27 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN4 2.12e-08 59 24 8 215 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q217B2 1.02e-12 72 28 8 202 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q217B2 1.55e-06 53 27 9 231 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q2Y624 1.03e-12 71 29 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q5H0G3 1.09e-12 71 27 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H0G3 2.96e-11 67 26 9 242 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E1 1.09e-12 71 27 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P3E1 2.96e-11 67 26 9 242 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q138A9 1.12e-12 71 27 7 211 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q138A9 2.2e-07 55 25 8 244 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB5)
Q4ZTW1 1.14e-12 73 26 6 241 3 araG Arabinose import ATP-binding protein AraG Pseudomonas syringae pv. syringae (strain B728a)
Q2NTI7 1.14e-12 71 26 7 222 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q2NTI7 4.35e-09 60 26 7 223 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q57S53 1.15e-12 72 26 8 226 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q57S53 7.16e-11 67 25 6 232 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
Q03A07 1.16e-12 72 27 6 220 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q03A07 7.47e-07 55 26 6 192 3 metN Methionine import ATP-binding protein MetN Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8ZR89 1.2e-12 72 26 8 226 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 1.13e-10 66 25 6 232 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2LVM2 1.24e-12 70 29 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophus aciditrophicus (strain SB)
Q2LVM2 2.64e-09 60 25 7 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophus aciditrophicus (strain SB)
Q73GK9 1.28e-12 71 23 4 218 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q0I3C2 1.29e-12 70 28 6 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0I3C2 2.5e-11 67 26 8 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q58762 1.31e-12 72 27 5 200 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P37774 1.36e-12 71 25 8 217 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 5.74e-09 60 25 9 251 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q03PY5 1.37e-12 71 31 9 216 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PY5 4.74e-08 58 26 7 217 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
O34900 1.39e-12 71 28 7 226 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
O34900 1.39e-11 68 26 8 256 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q12ES3 1.4e-12 70 27 7 234 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q12ES3 2.77e-11 67 24 4 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q9V1Q4 1.4e-12 71 31 12 248 3 PYRAB03730 Putative ABC transporter ATP-binding protein PYRAB03730 Pyrococcus abyssi (strain GE5 / Orsay)
A3DJK5 1.41e-12 71 28 6 198 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A3DJK5 2.89e-08 58 28 6 204 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q4QK57 1.43e-12 72 28 6 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q4L884 1.43e-12 71 27 6 204 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q4L884 5.62e-09 60 28 6 203 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Staphylococcus haemolyticus (strain JCSC1435)
Q8Z8R5 1.45e-12 72 25 7 226 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 2.64e-10 65 25 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q6N1Y7 1.47e-12 73 27 7 229 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N1Y7 1.24e-06 55 25 13 273 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P45171 1.48e-12 72 28 6 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9MUN1 1.49e-12 72 26 6 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 2.92e-10 65 24 5 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
A1SWH9 1.53e-12 72 24 5 225 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q2SJY7 1.56e-12 72 28 7 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q2SJY7 0.00019 47 21 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q8DPC2 1.59e-12 72 26 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DPC2 1.05e-07 57 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.59e-12 72 26 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97Q42 1.05e-07 57 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.59e-12 72 26 7 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04JW0 1.05e-07 57 25 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A0B212 1.64e-12 73 28 7 208 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia cenocepacia (strain HI2424)
Q1QDA8 1.67e-12 73 30 9 208 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q2NU23 1.71e-12 70 27 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 6.57e-12 68 26 6 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q1BPZ6 1.72e-12 73 28 7 208 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia orbicola (strain AU 1054)
Q7VI92 1.72e-12 72 26 6 238 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A1B9H9 1.74e-12 70 26 7 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
O21280 1.75e-12 70 30 4 163 3 CCMA Cytochrome c biogenesis ATP-binding export protein CcmA Reclinomonas americana
O21280 6.4e-06 50 23 4 191 3 CCMA Cytochrome c biogenesis ATP-binding export protein CcmA Reclinomonas americana
Q98K23 1.81e-12 72 27 9 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q98K23 1.51e-07 57 25 8 213 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q5GRS1 1.81e-12 70 26 4 197 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q2YAD6 1.84e-12 72 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 3.04e-10 65 23 8 303 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q87UH7 1.86e-12 70 25 7 208 3 tauB Taurine import ATP-binding protein TauB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5L3Q9 1.87e-12 71 28 6 212 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Geobacillus kaustophilus (strain HTA426)
Q5L3Q9 3.57e-06 52 24 7 205 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Geobacillus kaustophilus (strain HTA426)
O66646 2.03e-12 70 30 8 224 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O66646 1.79e-09 61 27 7 219 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Aquifex aeolicus (strain VF5)
O32151 2.03e-12 72 26 8 225 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
P45247 2.11e-12 70 28 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45247 2.27e-11 67 29 5 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 2.11e-12 70 28 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q4QKQ9 2.27e-11 67 29 5 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06070
Feature type CDS
Gene -
Product ABC-F family ATPase
Location 1330564 - 1332162 (strand: -1)
Length 1599 (nucleotides) / 532 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_755
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06158 ATP-binding cassette, subfamily F, member 3 - -

Protein Sequence

MLISNNITMQFGSKPLFENISVKFGGGNRYGLIGANGSGKSTFMKILGGDLAPTSGNVFLDPNERLGKLKQDQFAYEEFTVLDTVIMGHAELWEIKQERERIYSLPEMSEEDGLRVADLEVKFGEMDGYTVESRAGELLLNVGIPLEQHNGPMSEVAPGWKLRVLLAQALFADPDILLLDEPTNNLDIDTIRWLEQTLNERNSTMIIISHDRHFLNMVCTHMADLDYGGLTVHPGNYDEYMLAATQARERLLADNAKKKAQISELQSFVSRFSANASKSRQATSRAKQIEKIQLTEVKASSRQNPFIRFEQEKKLFRNALEVENIAKGYEANAPLFKDVNMMLEVGEKVAILGTNGVGKSTMIKTLVGELTPDNGRVKWSENATIGYYAQDHATDFEVDMTVFDWMSLWMKPEDDEQSVRSVLGRLLFSQDDIKKSVKVLSGGEKGRMLFGKLMMQKPNVLIMDEPTNHLDMESIESLNMALELYQGTLIFVSHDREFVSSLANRIIEITPEKVTNFQGTYDEFLAKKGIDG

Flanking regions ( +/- flanking 50bp)

CATAATGCCGCCCCATTATCTTTATCATTCACTAATCATGAGTATTCGTCTTGTTAATAAGTAATAATATCACTATGCAGTTTGGTTCGAAGCCACTGTTTGAAAACATTTCTGTTAAGTTTGGTGGCGGTAATCGCTATGGTTTAATCGGTGCTAACGGCAGCGGTAAATCCACCTTTATGAAAATTCTCGGTGGTGATCTCGCGCCTACTAGCGGTAACGTATTCCTTGATCCTAATGAGCGTTTGGGTAAGCTAAAACAAGATCAGTTTGCTTATGAAGAGTTTACCGTGCTTGATACGGTAATTATGGGGCACGCTGAGTTATGGGAAATTAAACAAGAGCGTGAACGTATTTATAGCTTACCGGAAATGAGCGAAGAAGATGGTTTACGTGTTGCCGATCTTGAAGTGAAATTCGGTGAAATGGACGGTTACACCGTTGAATCACGTGCCGGTGAATTATTATTAAACGTTGGTATTCCACTTGAGCAACATAATGGCCCAATGAGTGAAGTGGCGCCAGGATGGAAACTACGTGTGCTCCTTGCACAAGCCCTATTCGCTGATCCTGACATCTTATTACTTGATGAACCGACGAATAACTTAGATATTGATACGATCCGCTGGCTAGAACAAACATTAAATGAACGTAATAGCACTATGATCATCATTTCCCATGACCGCCATTTTTTAAATATGGTGTGTACTCATATGGCCGATCTTGATTATGGTGGACTAACAGTTCACCCAGGTAATTATGATGAGTATATGTTAGCGGCAACACAAGCGCGTGAACGTTTACTCGCTGATAATGCAAAGAAAAAAGCACAAATTAGTGAATTACAATCCTTTGTTAGCCGCTTTAGTGCTAATGCATCAAAATCTCGTCAAGCTACTTCGCGTGCAAAACAAATTGAAAAAATTCAATTAACCGAAGTCAAAGCTTCTAGCCGACAAAATCCCTTTATTCGTTTTGAGCAAGAGAAGAAATTATTCCGTAATGCCTTAGAAGTAGAGAATATTGCTAAAGGTTATGAAGCAAATGCGCCTTTATTTAAAGACGTAAATATGATGCTGGAAGTGGGCGAAAAAGTGGCGATTTTAGGCACCAATGGTGTGGGTAAATCAACCATGATCAAAACATTAGTGGGTGAATTAACGCCTGATAATGGACGCGTTAAATGGTCTGAAAATGCCACTATAGGTTATTATGCACAAGATCATGCCACTGATTTTGAAGTTGATATGACCGTTTTCGATTGGATGAGTTTATGGATGAAGCCAGAAGATGATGAACAGTCGGTGCGTAGTGTATTGGGTCGCCTTCTTTTCTCACAAGATGATATTAAAAAATCAGTCAAAGTATTATCTGGTGGTGAAAAAGGCAGAATGCTGTTTGGTAAATTAATGATGCAAAAACCAAACGTTCTGATTATGGATGAACCTACCAACCACTTAGATATGGAATCTATTGAGTCACTGAATATGGCGTTAGAACTCTATCAAGGGACGTTAATTTTTGTTTCTCACGATCGTGAATTTGTCAGCTCATTGGCTAACCGAATTATTGAAATTACGCCTGAAAAAGTGACTAATTTCCAAGGCACTTATGATGAGTTCTTGGCTAAGAAAGGGATTGATGGTTAGTACCCCACTTATTTATTAATATAAAAAATAAAAGGCTTGGTGTTATTTTA