Homologs in group_755

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
EHELCC_03110 EHELCC_03110 100.0 Morganella morganii S2 uup ABC-F family ATPase
NLDBIP_00350 NLDBIP_00350 100.0 Morganella morganii S4 uup ABC-F family ATPase
LHKJJB_01685 LHKJJB_01685 100.0 Morganella morganii S3 uup ABC-F family ATPase
HKOGLL_01725 HKOGLL_01725 100.0 Morganella morganii S5 uup ABC-F family ATPase
F4V73_RS05095 F4V73_RS05095 92.6 Morganella psychrotolerans - ABC-F family ATPase
PMI_RS06070 PMI_RS06070 91.0 Proteus mirabilis HI4320 - ABC-F family ATPase

Distribution of the homologs in the orthogroup group_755

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_755

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A9U3 0.0 941 85 1 523 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 0.0 941 85 1 523 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 0.0 941 85 1 523 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
O31716 1.14e-176 511 47 4 527 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O05519 8.83e-105 330 35 5 524 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 4.21e-31 130 31 4 256 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 3.02e-17 88 27 5 235 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
P63389 4.66e-92 297 33 9 518 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 4.07e-19 94 25 4 276 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 4.66e-92 297 33 9 518 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 4.07e-19 94 25 4 276 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 5.07e-92 297 33 9 518 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 8.14e-19 93 25 4 276 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P44808 2.63e-88 287 33 7 533 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O34512 7.7e-87 280 33 6 502 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 4.72e-27 117 29 5 248 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
Q8K268 3.73e-83 275 32 8 524 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 1.97e-14 79 24 8 309 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q66H39 1.58e-82 274 32 8 524 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 2.65e-14 79 23 8 309 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q9LV93 2.79e-82 273 33 9 523 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 2.25e-20 98 28 7 266 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9LV93 5.41e-15 81 25 5 242 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q9FIB4 5.49e-82 271 33 10 535 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 2.07e-20 98 28 6 259 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FIB4 6.36e-14 78 24 5 234 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9NUQ8 1.1e-81 271 31 8 524 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 9.42e-14 77 25 8 306 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9FJH6 1.96e-81 268 31 7 527 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q9FJH6 1.62e-15 83 26 7 294 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q5R9Z5 2.08e-81 271 31 7 524 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 4.92e-13 75 23 9 309 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
O59672 2.06e-80 269 31 6 538 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 2.46e-13 76 28 1 141 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8H0V6 1.6e-78 263 29 10 542 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 8.91e-15 80 32 0 120 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
P40024 3.26e-77 257 31 10 528 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 9.28e-19 93 25 7 281 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O42943 4.92e-77 257 30 7 535 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 1.88e-17 89 28 6 228 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P43535 3.54e-75 255 30 8 529 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9M1H3 2.86e-74 252 30 12 553 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q8T6B7 3.91e-73 246 28 7 528 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q99LE6 1.1e-72 246 29 7 533 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q99LE6 5.94e-16 84 26 7 244 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
P43672 1.44e-72 246 32 9 524 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 4.59e-25 112 29 4 233 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
Q9UG63 4.64e-72 244 29 7 533 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q9UG63 5.03e-16 84 26 7 244 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q2KJA2 1.4e-68 235 29 7 533 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q2KJA2 2.3e-15 82 27 7 236 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q8T6B4 2.2e-68 241 29 10 512 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 2.94e-19 95 27 6 230 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8SRV5 2.49e-65 224 34 13 452 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 1.87e-14 79 26 4 230 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 3.16e-13 75 28 5 183 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q57242 4.44e-65 226 31 8 506 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 1.02e-23 108 27 5 244 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A9W5 4.51e-65 224 30 11 522 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 9.27e-21 99 28 4 231 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 7.03e-18 90 30 6 239 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 4.51e-65 224 30 11 522 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 9.27e-21 99 28 4 231 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 7.03e-18 90 30 6 239 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 4.51e-65 224 30 11 522 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 9.27e-21 99 28 4 231 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 7.03e-18 90 30 6 239 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
A0A0H2VFI8 5.79e-65 223 30 11 522 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 8.63e-21 99 28 4 231 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 8.11e-18 90 30 6 239 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45127 4.19e-64 221 30 12 526 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 1.25e-19 95 28 4 231 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 9.29e-18 90 28 7 253 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q767L0 1.01e-63 225 29 10 531 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 7.32e-12 71 27 7 229 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q6MG08 1.51e-63 225 29 11 536 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 9.6e-12 71 27 7 229 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
O06476 4.75e-63 220 29 10 527 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
O06476 1.1e-22 105 28 4 246 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q8NE71 1.17e-62 223 29 10 530 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 2.34e-11 70 27 7 229 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 3.52e-62 221 29 10 530 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 2.3e-11 70 27 7 229 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
P9WQK3 2.1e-61 214 30 8 506 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 8.38e-13 74 28 4 212 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 1.36e-12 73 27 3 234 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 2.1e-61 214 30 8 506 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 8.38e-13 74 28 4 212 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 1.36e-12 73 27 3 234 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q6P542 4.02e-61 218 29 11 536 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 2.54e-11 70 27 7 229 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q9USH9 1.12e-54 200 25 9 526 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 4.38e-12 72 25 2 235 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8K9I3 2.02e-53 193 27 10 514 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9I3 1.68e-28 122 30 3 205 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P39115 6.62e-52 188 29 15 519 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 8.83e-20 96 31 4 196 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 1.24e-16 86 25 3 205 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P25256 2.45e-50 184 28 14 529 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 1.32e-10 67 34 0 91 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 1.24e-05 51 32 2 91 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P0DX93 3.2e-50 182 29 17 526 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 2.96e-19 94 31 4 182 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.27e-09 62 24 5 209 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P57445 6.7e-45 170 31 5 357 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 3.83e-21 100 27 3 192 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q45978 2.06e-38 152 27 11 513 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 1.82e-18 92 30 3 196 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 6.24e-13 75 29 5 234 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P23212 5.56e-36 143 26 20 524 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 3.57e-15 81 32 5 176 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
D0MYB4 1.78e-32 135 27 13 419 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 3.09e-13 76 26 7 219 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.85e-08 61 41 0 63 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 6.68e-06 52 30 1 94 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O14134 5.4e-32 134 25 14 458 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 2.07e-11 70 29 5 191 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.72e-09 64 30 1 122 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 6.99e-07 55 30 1 91 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93796 1.28e-31 133 26 11 418 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.29e-12 74 25 2 201 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.54e-08 61 30 0 79 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 0.000117 48 30 2 107 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P16521 2.46e-31 132 25 7 414 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 7.51e-11 68 23 2 201 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.49e-07 58 31 0 70 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q75EV6 4.61e-31 131 27 10 418 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 1.94e-10 67 26 4 203 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.19e-08 60 31 0 70 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 7.1e-05 49 30 2 113 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P53978 1.54e-30 130 25 10 418 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.72e-12 73 26 3 201 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.29e-08 61 30 0 79 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 0.000125 48 30 2 113 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45167 4.96e-30 125 32 6 325 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 1.91e-08 60 27 8 262 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 5.85e-06 52 40 0 57 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P25997 5.82e-30 128 25 9 417 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 8.71e-11 68 26 2 201 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.71e-08 61 32 0 70 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 0.00024 47 30 2 93 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P29551 1.77e-29 127 27 11 387 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 7.82e-12 72 27 5 200 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 3.93e-08 60 37 0 64 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 8.75e-08 58 34 0 70 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q08972 3.95e-29 125 26 14 418 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.45e-12 74 27 5 204 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 6.15e-08 59 39 0 64 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.5e-05 51 30 1 90 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P12622 1.41e-28 118 33 3 233 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 3.11e-10 64 33 2 128 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 0.000532 45 36 0 57 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
O94489 5.8e-26 116 28 5 270 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.46e-10 67 25 4 201 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 3.14e-08 60 34 0 70 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 3.17e-06 53 35 0 64 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 0.000661 46 31 1 76 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8TSC8 2.39e-21 101 23 15 545 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 3.02e-11 69 29 8 221 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TSC8 3.58e-07 56 25 6 215 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q73P93 2.85e-21 100 23 11 374 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 4.72e-08 59 23 4 200 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8PVG9 6.01e-21 100 24 15 523 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PVG9 1.08e-09 64 28 7 214 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PVG9 5.28e-07 56 25 4 215 3 MM_1996 Putative ABC transporter ATP-binding protein MM_1996 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8D3Z9 7.9e-21 99 26 21 542 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8D3Z9 2.81e-05 50 23 7 208 3 VV2_1533 Putative ABC transporter ATP-binding protein VV2_1533 Vibrio vulnificus (strain CMCP6)
Q8PSR0 3.73e-20 97 25 21 527 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PSR0 6.62e-07 55 28 9 233 3 MM_3016 Putative ABC transporter ATP-binding protein MM_3016 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q81CT8 4.55e-20 97 25 19 512 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7MFH3 4.62e-20 97 25 21 533 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q7MFH3 3.46e-05 50 23 5 176 3 VVA0347 Putative ABC transporter ATP-binding protein VVA0347 Vibrio vulnificus (strain YJ016)
Q87G35 9.26e-20 96 25 19 531 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87G35 1.25e-05 51 24 7 207 3 VPA1482 Putative ABC transporter ATP-binding protein VPA1482 Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q81PZ8 1.39e-19 95 25 19 543 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 8.75e-05 48 24 7 218 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q6HI76 1.51e-19 95 25 19 543 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q1Q889 1.77e-19 91 30 3 192 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 5.57e-12 69 28 7 215 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1B9K8 3.54e-19 90 28 4 204 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 1.53e-09 62 29 7 205 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q74I62 6.55e-19 93 23 20 526 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8TQ05 6.92e-19 93 23 16 522 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TQ05 2.33e-08 60 28 9 207 3 MA_1747 Putative ABC transporter ATP-binding protein MA_1747 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q737I0 1.18e-18 92 22 16 531 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q737I0 1.74e-06 54 24 8 245 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5LUR8 1.22e-18 89 31 6 212 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 5.41e-12 69 29 7 206 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8RD07 1.23e-18 88 29 7 229 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 3.27e-14 75 29 6 200 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q32HA3 1.34e-18 89 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 3.94e-11 67 27 7 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 1.5e-18 88 29 6 209 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 5.52e-11 66 26 6 214 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 1.5e-18 88 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q28VN1 1.59e-18 88 29 4 192 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 2.25e-11 67 25 4 215 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q6D4A8 1.6e-18 88 26 5 208 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 1.6e-15 79 27 7 212 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8ES39 1.71e-18 92 24 21 506 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 3.31e-06 53 25 8 224 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q83KR7 4.79e-18 87 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 4.79e-18 87 29 6 209 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 5.52e-11 66 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q897I2 5.3e-18 90 25 14 376 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
Q897I2 5.04e-08 58 23 5 202 3 CTC_00753 Putative ABC transporter ATP-binding protein CTC_00753 Clostridium tetani (strain Massachusetts / E88)
O68106 5.68e-18 87 31 7 212 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8XK20 7.76e-18 90 23 19 536 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
A0KPH6 8.79e-18 86 29 5 192 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 7.69e-05 48 32 3 91 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q97SA3 1.13e-17 89 24 26 526 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2GFZ6 1.18e-17 85 29 4 203 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q2GFZ6 1.76e-07 55 24 5 212 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q8DQY5 1.24e-17 89 24 25 523 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q1R155 1.65e-17 85 32 5 198 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 2.76e-09 61 25 6 214 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q6FFL0 1.67e-17 85 27 4 203 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 5.33e-10 63 28 7 200 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9CP24 2.1e-17 85 30 5 209 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q9CP24 6.32e-06 51 28 9 219 3 znuC Zinc import ATP-binding protein ZnuC Pasteurella multocida (strain Pm70)
Q4KKK4 2.21e-17 85 28 6 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 2.69e-11 67 24 3 211 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
O27739 2.78e-17 86 32 7 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27739 1.2e-11 69 30 8 224 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q93D97 3.1e-17 88 24 23 537 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q4FQ27 3.55e-17 84 28 3 192 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 9.89e-11 65 26 5 215 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q87UN0 3.99e-17 84 27 5 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48PV0 4.17e-17 84 26 4 192 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8ZNV7 4.83e-17 84 27 6 220 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 3.84e-11 67 26 6 214 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PIA5 5.73e-17 84 27 6 220 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 3.53e-11 67 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 5.73e-17 84 27 6 220 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 3.53e-11 67 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
A7FMJ7 6.66e-17 87 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A7FMJ7 6.93e-07 55 25 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JLQ0 7.89e-17 87 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B1JLQ0 8.03e-07 55 25 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q7N545 8.45e-17 83 27 5 198 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 1.12e-10 65 27 6 211 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q14Q07 8.76e-17 85 30 6 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 2.28e-06 53 26 8 210 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q66EY9 9.02e-17 86 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66EY9 7.96e-07 55 25 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K3G1 9.02e-17 86 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B2K3G1 7.96e-07 55 25 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pseudotuberculosis serotype IB (strain PB1/+)
P54537 1e-16 83 27 6 241 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
P54537 1.09e-11 68 30 9 212 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q3KKA1 1.48e-16 83 28 4 177 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.18e-10 65 23 3 211 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q9HT73 1.49e-16 83 26 5 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 5.7e-07 54 24 7 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.49e-16 83 26 5 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 5.7e-07 54 24 7 222 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9I6L0 1.8e-16 84 31 9 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I6L0 2.41e-08 59 23 9 297 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4TQL5 2.84e-16 85 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
A4TQL5 1.74e-06 54 24 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis (strain Pestoides F)
Q1CN15 2.84e-16 85 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CN15 1.74e-06 54 24 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Nepal516)
A9R074 2.84e-16 85 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
A9R074 1.74e-06 54 24 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Angola)
Q0WJP9 2.84e-16 85 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q0WJP9 1.74e-06 54 24 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis
Q1C138 2.84e-16 85 22 17 531 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C138 1.74e-06 54 24 4 197 3 lsrA Autoinducer 2 import ATP-binding protein LsrA Yersinia pestis bv. Antiqua (strain Antiqua)
Q1IGY7 3.43e-16 82 25 6 209 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 2.64e-10 64 23 3 211 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
P94411 3.68e-16 81 27 6 206 3 yclH Uncharacterized ABC transporter ATP-binding protein YclH Bacillus subtilis (strain 168)
P94411 2.87e-06 52 23 8 197 3 yclH Uncharacterized ABC transporter ATP-binding protein YclH Bacillus subtilis (strain 168)
P44692 4.1e-16 82 29 4 220 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44692 6.35e-08 57 25 6 209 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8Z5W6 4.27e-16 81 26 6 220 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 1.03e-11 68 26 6 214 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q74DN5 5.86e-16 81 29 5 207 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 5.2e-14 75 31 6 207 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A1JRI2 6.53e-16 80 28 4 176 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 9.37e-15 77 27 5 211 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2FRT7 7.83e-16 83 30 9 215 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FRT7 1.27e-09 63 29 8 206 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q831K6 8.26e-16 82 26 4 259 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q831K6 7.63e-08 58 23 8 244 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q66AT7 8.41e-16 80 28 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 1.53e-13 73 25 5 209 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CJG3 8.57e-16 80 28 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.38e-13 74 25 5 209 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 8.57e-16 80 28 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.38e-13 74 25 5 209 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 8.57e-16 80 28 3 173 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.38e-13 74 25 5 209 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q8RI39 1.05e-15 82 26 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4ZZS2 1.28e-15 80 27 4 177 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q1GL85 1.52e-15 79 26 4 203 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q21PQ7 1.63e-15 80 26 6 218 3 znuC Zinc import ATP-binding protein ZnuC Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q98G43 1.7e-15 81 27 5 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q13LD8 1.71e-15 82 29 7 222 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q88RL1 1.72e-15 79 26 4 181 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL1 1.29e-10 65 23 3 211 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q5HBR8 1.92e-15 79 27 3 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5HBR8 6.56e-10 63 26 5 212 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 1.92e-15 79 27 3 194 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q5FHB0 6.56e-10 63 26 5 212 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q88ZZ2 2.5e-15 82 23 23 537 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 6.83e-10 65 26 5 210 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 8.22e-06 52 26 9 211 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q3A558 2.59e-15 78 29 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3A558 9.72e-10 62 24 8 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q5QU46 2.77e-15 78 31 10 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 1.7e-11 67 27 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q97KZ3 3.03e-15 79 28 6 213 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KZ3 8.2e-14 74 28 5 201 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3YSK9 3.32e-15 78 26 3 202 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q3YSK9 1.13e-09 62 26 5 215 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q88AS5 3.62e-15 80 30 8 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q65VG9 3.66e-15 80 26 11 299 3 metN Methionine import ATP-binding protein MetN Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q89AJ0 3.67e-15 78 25 4 192 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 3.89e-11 66 25 6 207 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8DFC3 3.76e-15 80 28 8 231 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q8DFC3 2.03e-07 56 25 9 205 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain CMCP6)
Q7MN25 3.94e-15 80 28 8 231 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q7MN25 1.87e-07 56 25 9 205 3 metN Methionine import ATP-binding protein MetN Vibrio vulnificus (strain YJ016)
Q83CV2 4.39e-15 78 29 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83CV2 2.38e-13 73 26 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5PB72 4.78e-15 78 29 9 233 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma marginale (strain St. Maries)
Q0VTB6 4.88e-15 78 26 6 210 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
O05779 5.07e-15 77 30 7 221 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O05779 2.01e-12 70 26 8 215 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q6D201 5.31e-15 79 30 10 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D201 3.9e-09 62 24 7 269 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A5U7B7 5.42e-15 77 30 7 221 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A5U7B7 1.82e-12 70 26 8 215 1 ftsE Cell division ATP-binding protein FtsE Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q926D8 5.66e-15 78 27 9 238 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q926D8 7.76e-10 63 24 6 225 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q87RE5 6.24e-15 78 27 5 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 1.67e-10 65 27 9 240 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3IWB5 6.55e-15 77 29 3 177 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 1.27e-10 65 27 6 204 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q87RS1 6.71e-15 79 27 6 218 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RS1 2.67e-07 56 24 8 215 1 metN Methionine import ATP-binding protein MetN Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6GIH9 6.83e-15 79 28 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MRSA252)
Q146E7 7.31e-15 78 26 9 238 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q8D385 7.68e-15 77 25 7 238 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8D385 2.14e-07 55 26 10 253 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q4L4R9 8.43e-15 79 28 7 221 3 metN Methionine import ATP-binding protein MetN Staphylococcus haemolyticus (strain JCSC1435)
Q9EYM2 9.15e-15 77 30 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9EYM2 1.04e-07 56 25 6 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6LTB1 9.23e-15 77 28 5 191 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 4e-14 75 28 6 220 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q49W48 9.24e-15 79 28 7 217 3 metN Methionine import ATP-binding protein MetN Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5E6M2 1.04e-14 77 27 3 174 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 1.77e-09 62 23 7 255 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4QND5 1.05e-14 77 30 5 207 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q4QND5 5.21e-07 54 23 5 209 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus influenzae (strain 86-028NP)
Q2YWP2 1.12e-14 79 28 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q160Y9 1.21e-14 77 26 5 213 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 2.03e-08 58 23 5 211 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q2K6Q4 1.28e-14 78 30 6 205 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K6Q4 1.31e-07 57 27 5 208 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q7A6M2 1.6e-14 78 27 6 219 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain N315)
Q99VG8 1.6e-14 78 27 6 219 1 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q92VJ2 1.69e-14 78 28 9 229 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q92VJ2 1.08e-11 70 25 7 216 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q65UG3 1.74e-14 77 28 6 215 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65UG3 3.37e-08 58 28 7 209 3 znuC Zinc import ATP-binding protein ZnuC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8NXH5 1.77e-14 78 28 7 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MW2)
Q6GB18 1.77e-14 78 28 7 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain MSSA476)
Q5HHK4 1.77e-14 78 28 7 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain COL)
Q2FZZ2 1.77e-14 78 28 7 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FII2 1.77e-14 78 28 7 217 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus aureus (strain USA300)
Q18C09 1.8e-14 78 25 9 255 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 5.16e-07 55 23 6 230 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q9CK97 1.89e-14 78 28 9 236 3 metN Methionine import ATP-binding protein MetN Pasteurella multocida (strain Pm70)
Q8PY26 1.94e-14 77 28 8 234 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8PY26 1.36e-07 56 25 10 239 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P63354 2.2e-14 78 29 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella suis biovar 1 (strain 1330)
P63353 2.2e-14 78 29 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2SPI3 2.38e-14 76 29 5 195 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 4.32e-07 55 23 4 211 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q73GK9 2.59e-14 76 25 4 215 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia pipientis wMel
Q31I51 2.66e-14 76 24 4 201 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.97e-09 62 23 4 209 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q8Y7R4 2.74e-14 76 32 8 222 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y7R4 2.34e-05 49 25 6 212 3 lmo1207 Putative ABC transporter ATP-binding protein lmo1207 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2GJA5 2.89e-14 75 25 6 227 3 znuC Zinc import ATP-binding protein ZnuC Anaplasma phagocytophilum (strain HZ)
Q66FU4 2.95e-14 77 27 6 208 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q720M2 3.18e-14 76 32 8 222 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q720M2 3.18e-05 49 25 6 212 3 LMOf2365_1216 Putative ABC transporter ATP-binding protein LMOf2365_1216 Listeria monocytogenes serotype 4b (strain F2365)
Q97KD5 3.44e-14 77 25 9 288 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KD5 7.24e-11 67 27 4 207 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q92P76 3.6e-14 76 32 5 171 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q92P76 1.52e-06 53 27 7 213 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
A0LCH8 3.82e-14 75 28 5 204 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q0P9C4 4.07e-14 78 31 7 188 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9WXX8 4.16e-14 75 30 7 230 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 1.46e-10 65 27 8 224 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q58283 4.67e-14 76 27 6 235 3 MJ0873 Uncharacterized ABC transporter ATP-binding protein MJ0873 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q0K2U3 4.86e-14 75 30 7 210 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q0K2U3 6.47e-07 54 27 8 212 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1CNC6 5.15e-14 77 27 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 5.15e-14 77 27 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 5.15e-14 77 27 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q55740 5.16e-14 75 28 5 233 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 1.4e-09 62 28 9 249 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8PKT0 5.63e-14 75 29 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
Q8PKT0 1.16e-11 68 28 10 239 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas axonopodis pv. citri (strain 306)
Q9XDA6 5.94e-14 75 26 9 241 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9XDA6 5.29e-11 66 25 7 225 3 zurA Zinc uptake system ATP-binding protein ZurA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
A1JIE0 5.98e-14 77 27 5 206 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JIE0 1.71e-06 53 23 8 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8T674 6.66e-14 78 29 3 167 3 abcG20 ABC transporter G family member 20 Dictyostelium discoideum
P73265 6.73e-14 75 28 7 208 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73265 4.47e-07 55 22 4 205 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q48PU6 6.75e-14 76 28 7 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PU6 2.03e-07 56 25 8 215 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9G4F5 7.05e-14 76 29 9 211 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q92CK1 7.53e-14 75 31 8 222 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92CK1 0.000395 45 24 7 215 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q0I4A9 7.59e-14 75 28 4 194 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q0I4A9 2.99e-07 55 27 7 209 3 znuC Zinc import ATP-binding protein ZnuC Histophilus somni (strain 129Pt)
Q88CL2 8.24e-14 76 29 9 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8YDJ8 8.43e-14 75 29 7 220 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9Z8J5 8.67e-14 75 30 11 223 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q1IGZ0 9.56e-14 75 29 6 220 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q1IGZ0 7.56e-09 61 25 9 226 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q0SML1 9.81e-14 76 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q0A9E2 9.88e-14 74 27 3 184 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
O84071 1.02e-13 74 27 10 236 3 CT_068 Probable metal transport system ATP-binding protein CT_068 Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3Z300 1.03e-13 74 30 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.03e-13 74 30 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.03e-13 74 30 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.03e-13 74 30 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q4QMH4 1.06e-13 75 28 8 231 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain 86-028NP)
Q4FU75 1.13e-13 77 31 9 208 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q93SH7 1.17e-13 74 28 8 220 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 4.68e-06 52 27 8 220 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7VNG4 1.19e-13 76 27 6 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MMN0 1.22e-13 74 24 5 211 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 1.1e-10 65 27 5 209 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 1.22e-13 74 24 5 211 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 1.1e-10 65 27 5 209 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q5HQQ9 1.25e-13 75 26 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P75957 1.25e-13 73 30 6 200 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q97JB8 1.26e-13 74 28 6 209 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97JB8 9.18e-09 60 24 7 230 3 CA_C1368 Putative ABC transporter ATP-binding protein CA_C1368 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q832R5 1.27e-13 77 23 21 536 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q89UD2 1.37e-13 75 27 8 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 1.13e-10 66 25 6 243 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q471U2 1.4e-13 74 29 7 231 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q471U2 1.28e-05 50 26 5 188 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6D664 1.44e-13 73 28 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D664 1.1e-10 65 28 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7VI92 1.45e-13 75 27 7 234 3 metN Methionine import ATP-binding protein MetN Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q832Y6 1.48e-13 75 26 6 223 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q576K0 1.5e-13 74 29 7 220 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 1.5e-13 74 29 7 220 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q5E284 1.53e-13 73 29 5 209 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E284 0.00089 44 28 7 212 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8KF76 1.56e-13 73 28 7 232 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8KF76 6.18e-08 57 26 6 201 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q07QX6 1.59e-13 76 29 7 237 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
Q07QX6 5.17e-08 59 26 12 266 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisA53)
O51587 1.59e-13 75 29 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A1U776 1.59e-13 73 27 6 211 3 znuC Zinc import ATP-binding protein ZnuC Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q65F80 1.63e-13 75 27 8 219 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q3BTD3 1.71e-13 73 28 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3BTD3 4.39e-12 69 28 12 256 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q1CFH7 1.76e-13 75 29 7 218 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CFH7 0.000826 45 22 7 220 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZH38 1.76e-13 75 29 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q8ZH38 0.000826 45 22 7 220 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis
Q1CAK4 1.76e-13 75 29 7 218 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q1CAK4 0.000826 45 22 7 220 3 metN1 Methionine import ATP-binding protein MetN 1 Yersinia pestis bv. Antiqua (strain Antiqua)
Q6F813 1.77e-13 76 27 9 269 3 macB Macrolide export ATP-binding/permease protein MacB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6F813 2.89e-12 72 29 9 219 3 macB Macrolide export ATP-binding/permease protein MacB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q9K876 1.86e-13 75 27 8 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9K876 2.59e-08 59 24 7 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8TI15 1.87e-13 74 27 7 230 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TI15 3.78e-05 49 24 9 235 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q5E715 1.88e-13 75 28 8 225 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E715 4.95e-06 52 26 8 196 3 metN Methionine import ATP-binding protein MetN Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6MU19 1.96e-13 75 29 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 2.02e-10 65 25 7 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q5PCG9 1.99e-13 75 27 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PCG9 1.09e-08 60 24 5 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q895C4 2.01e-13 74 24 11 296 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q895C4 2.31e-12 71 26 7 234 3 metN Methionine import ATP-binding protein MetN Clostridium tetani (strain Massachusetts / E88)
Q660M8 2.06e-13 75 28 8 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q47C66 2.12e-13 73 27 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q10418 2.23e-13 76 25 8 235 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q10418 8.14e-11 68 26 8 212 3 mesD Mesentericin-Y105 transport/processing ATP-binding protein MesD Leuconostoc mesenteroides
Q1QDA8 2.27e-13 76 31 9 208 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6F0V4 2.33e-13 75 27 7 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
P0A2U7 2.36e-13 73 26 7 212 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2U6 2.36e-13 73 26 7 212 3 adcC Zinc transport system ATP-binding protein AdcC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q8ENU2 2.45e-13 74 27 7 222 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ENU2 1.5e-05 50 23 7 224 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6D5H7 2.45e-13 74 27 7 222 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D5H7 7.42e-11 67 26 9 222 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2SSS4 2.46e-13 75 29 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 1.4e-10 66 25 7 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6HG98 2.48e-13 76 24 20 523 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HG98 3.05e-08 60 29 8 210 3 BT9727_3105 Putative ABC transporter ATP-binding protein BT9727_3105 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q8CTB2 2.54e-13 74 26 6 218 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4KKK8 2.55e-13 74 29 7 220 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK8 1.81e-06 53 24 7 215 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9CN78 2.7e-13 72 27 6 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q9CN78 3.43e-10 63 25 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q81V82 2.74e-13 73 28 9 237 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q81V82 1.49e-08 59 26 8 226 1 fpuD Petrobactin import ATP-binding protein FpuD Bacillus anthracis
Q1LLP5 2.75e-13 75 26 6 225 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q2S3A3 2.85e-13 73 28 9 236 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q2S3A3 3.25e-08 58 27 9 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q8TIW9 2.94e-13 73 25 5 217 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIW9 2.94e-11 67 29 6 208 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q609Q1 3.04e-13 74 27 11 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q609Q1 1.04e-10 67 24 11 334 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q24QI5 3.05e-13 74 29 7 215 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
Q24QI5 3.46e-05 49 21 7 229 3 metN Methionine import ATP-binding protein MetN Desulfitobacterium hafniense (strain Y51)
A1B9H9 3.09e-13 72 28 7 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
P44785 3.16e-13 74 27 8 231 3 metN Methionine import ATP-binding protein MetN Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87UH7 3.19e-13 73 25 8 236 3 tauB Taurine import ATP-binding protein TauB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q667L9 3.22e-13 74 29 7 218 3 metN2 Methionine import ATP-binding protein MetN 2 Yersinia pseudotuberculosis serotype I (strain IP32953)
Q03PY5 3.51e-13 73 30 10 226 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03PY5 7.53e-07 54 27 6 205 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q1QCN2 3.56e-13 72 28 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1QCN2 1.21e-11 67 26 6 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8XIZ5 3.74e-13 74 25 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q8XIZ5 1.3e-05 51 25 9 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 3.74e-13 74 25 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0TNZ3 1.3e-05 51 25 9 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P48334 3.78e-13 72 25 6 173 3 None Probable ABC transporter ATP-binding protein in ycf23-apcF intergenic region Cyanophora paradoxa
Q1MEG2 3.78e-13 73 29 6 205 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8X8E3 3.79e-13 72 30 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
P30750 3.87e-13 74 28 7 218 1 metN Methionine import ATP-binding protein MetN Escherichia coli (strain K12)
Q5L222 4.05e-13 74 25 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q5L222 2.02e-09 62 24 8 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q4ZZR8 4.14e-13 73 26 7 245 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZR8 1.38e-07 57 25 8 215 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q0SRL2 4.18e-13 74 25 7 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q0SRL2 1.99e-05 50 25 9 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q8D0W8 4.49e-13 74 26 7 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q8D0W8 4.2e-09 62 25 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
P0C0E2 4.53e-13 72 28 7 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E2 2.57e-12 70 29 7 195 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 4.53e-13 72 28 7 214 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
P0C0E3 2.57e-12 70 29 7 195 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q32JQ8 4.56e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Shigella dysenteriae serotype 1 (strain Sd197)
Q39T41 4.65e-13 72 25 5 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q39T41 1.03e-09 62 28 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q1BPZ6 4.9e-13 75 31 9 211 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia orbicola (strain AU 1054)
Q6ME20 5.04e-13 73 28 6 216 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
Q6ME20 3.03e-08 59 26 9 215 3 metN Methionine import ATP-binding protein MetN Protochlamydia amoebophila (strain UWE25)
A0B212 5.08e-13 75 31 9 211 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia cenocepacia (strain HI2424)
Q5MZ53 5.22e-13 72 30 6 209 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q5MZ53 1.54e-05 50 24 8 276 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 5.22e-13 72 30 6 209 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55108 1.54e-05 50 24 8 276 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q03ZQ0 5.42e-13 73 27 6 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q03ZQ0 8.03e-09 61 23 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q4W575 5.47e-13 73 25 7 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4W575 9.93e-08 57 23 5 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 5.47e-13 73 25 7 228 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JVH1 9.93e-08 57 23 5 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9HZL7 5.49e-13 72 27 5 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 2.87e-11 67 26 8 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q325U1 5.52e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Shigella boydii serotype 4 (strain Sb227)
Q0TLD2 5.57e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z5F8 5.62e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Shigella sonnei (strain Ss046)
Q1RFY9 5.62e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Escherichia coli (strain UTI89 / UPEC)
P63355 5.62e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63356 5.62e-13 73 28 7 218 3 metN Methionine import ATP-binding protein MetN Escherichia coli O157:H7
Q7VM95 5.88e-13 73 27 9 231 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VM95 6.87e-06 52 24 10 234 3 metN Methionine import ATP-binding protein MetN Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q81N53 6.19e-13 74 23 19 522 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q81N53 4.56e-09 62 29 8 210 3 BA_3364 Putative ABC transporter ATP-binding protein BA_3364/GBAA_3364/BAS3118 Bacillus anthracis
Q57399 6.25e-13 72 28 7 200 1 molC Molybdate import ATP-binding protein MolC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2SI12 6.52e-13 72 27 4 213 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q2SI12 1.03e-05 50 26 7 212 3 znuC2 Zinc import ATP-binding protein ZnuC 2 Hahella chejuensis (strain KCTC 2396)
Q8FUU5 6.58e-13 72 29 7 220 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q3ATY5 6.6e-13 72 28 9 235 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q3ATY5 6.38e-09 60 26 6 219 3 lolD1 Lipoprotein-releasing system ATP-binding protein LolD 1 Chlorobium chlorochromatii (strain CaD3)
Q5FA19 6.62e-13 73 25 7 228 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q5FA19 1.86e-09 63 25 5 220 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q1BT84 6.81e-13 72 26 6 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
Q1BT84 3.5e-10 64 27 6 206 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
A0KAV6 6.81e-13 72 26 6 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
A0KAV6 3.5e-10 64 27 6 206 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
Q57243 7.01e-13 72 30 4 169 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57243 3.33e-08 58 26 6 215 3 HI_1272 Uncharacterized ABC transporter ATP-binding protein HI_1272 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q46ZM0 7.7e-13 73 27 6 225 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q668K6 8.23e-13 73 26 7 234 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q668K6 3.98e-09 62 25 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6D1C4 8.55e-13 73 29 7 218 3 metN3 Methionine import ATP-binding protein MetN 3 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2SY12 8.7e-13 73 26 8 252 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SY12 1.03e-07 57 23 7 236 3 metN Methionine import ATP-binding protein MetN Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q82WT5 8.79e-13 73 26 7 223 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82WT5 1.89e-08 60 23 7 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q32EX7 9.11e-13 71 29 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q6NBT1 9.23e-13 73 26 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6NBT1 2.11e-10 65 25 6 228 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P10346 9.62e-13 71 27 6 224 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P10346 2.26e-08 58 25 9 222 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q9MUN1 9.66e-13 73 26 7 224 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9MUN1 1.99e-08 59 25 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q57QD7 9.91e-13 71 31 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 4.85e-09 60 25 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q8ZR89 1e-12 72 26 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZR89 5.53e-08 58 23 5 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9HT70 1.01e-12 72 29 8 220 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK6 1.01e-12 72 29 8 220 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q97UY8 1.02e-12 73 25 7 233 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q97UY8 8.69e-11 67 26 6 227 1 glcV Glucose import ATP-binding protein GlcV Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q1D382 1.05e-12 70 27 6 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Myxococcus xanthus (strain DK1622)
Q1D382 2.19e-08 58 25 6 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Myxococcus xanthus (strain DK1622)
Q63SP4 1.06e-12 71 29 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia pseudomallei (strain K96243)
Q62J04 1.06e-12 71 29 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia mallei (strain ATCC 23344)
P47365 1.09e-12 73 22 21 549 3 MG119 Putative carbohydrate transport ATP-binding protein MG119 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P42246 1.1e-12 72 28 9 204 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
P42246 4.49e-10 64 28 7 191 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q20Z38 1.18e-12 73 26 7 241 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q20Z38 2.34e-06 53 25 12 273 3 ndvA Beta-(1-->2)glucan export ATP-binding/permease protein NdvA Rhodopseudomonas palustris (strain BisB18)
Q7NX01 1.26e-12 72 28 9 228 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NX01 3.43e-09 62 24 6 233 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q88RL5 1.26e-12 72 28 8 232 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RL5 6.79e-07 55 24 8 227 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q31ZH4 1.27e-12 70 29 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q5NZT6 1.27e-12 70 29 6 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2SXD1 1.28e-12 71 29 8 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q7VZ31 1.3e-12 70 28 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8T0 1.3e-12 70 28 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK40 1.3e-12 70 28 5 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q8P8V9 1.3e-12 71 28 8 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8P8V9 2.74e-11 67 27 9 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UV71 1.3e-12 71 28 8 220 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q4UV71 2.74e-11 67 27 9 230 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas campestris pv. campestris (strain 8004)
Q8Z8R5 1.37e-12 72 26 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q8Z8R5 1.77e-07 57 23 5 210 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q13VD7 1.37e-12 72 26 5 224 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q13VD7 4.64e-08 58 23 7 234 3 metN1 Methionine import ATP-binding protein MetN 1 Paraburkholderia xenovorans (strain LB400)
Q45460 1.42e-12 72 27 7 228 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q45460 4.63e-08 58 26 5 207 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
P0A9S0 1.43e-12 70 28 6 213 3 ftsE Cell division ATP-binding protein FtsE Shigella flexneri
P0A9S0 1.04e-06 53 23 6 224 3 ftsE Cell division ATP-binding protein FtsE Shigella flexneri
P0A9R7 1.43e-12 70 28 6 213 1 ftsE Cell division ATP-binding protein FtsE Escherichia coli (strain K12)
P0A9R7 1.04e-06 53 23 6 224 1 ftsE Cell division ATP-binding protein FtsE Escherichia coli (strain K12)
P0A9R8 1.43e-12 70 28 6 213 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9R8 1.04e-06 53 23 6 224 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9R9 1.43e-12 70 28 6 213 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O157:H7
P0A9R9 1.04e-06 53 23 6 224 3 ftsE Cell division ATP-binding protein FtsE Escherichia coli O157:H7
Q83MC5 1.5e-12 72 28 7 218 3 metN Methionine import ATP-binding protein MetN Shigella flexneri
Q0T810 1.5e-12 72 28 7 218 3 metN Methionine import ATP-binding protein MetN Shigella flexneri serotype 5b (strain 8401)
Q92XW1 1.52e-12 72 28 8 225 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Rhizobium meliloti (strain 1021)
P61482 1.53e-12 70 30 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 3.34e-09 60 26 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.53e-12 70 30 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 3.34e-09 60 26 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.53e-12 70 30 7 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 3.34e-09 60 26 9 223 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q2K3Y7 1.54e-12 73 19 14 529 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K3Y7 7.53e-06 52 27 7 195 3 araG Arabinose import ATP-binding protein AraG Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8EPK1 1.59e-12 72 25 4 226 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8EPK1 2.91e-06 53 24 6 226 3 metN1 Methionine import ATP-binding protein MetN 1 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8P2K6 1.61e-12 72 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q8P2K6 1.26e-05 51 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q21JQ9 1.62e-12 70 27 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21JQ9 6.82e-12 68 25 7 235 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q1JII9 1.64e-12 72 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JII9 5.7e-06 52 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q3K9F9 1.88e-12 70 26 5 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
O34392 1.91e-12 70 27 5 200 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
O34392 7.21e-10 62 23 6 204 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q8DY54 1.99e-12 72 26 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 1.99e-12 72 26 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q97KS6 2.16e-12 72 27 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 0.001 45 22 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q83RS0 2.36e-12 70 29 6 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q18AM3 2.38e-12 72 25 7 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
P96117 2.41e-12 70 25 7 207 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
P96117 1e-10 65 28 8 216 3 troB Zinc transport system ATP-binding protein TroB Treponema pallidum (strain Nichols)
Q729H7 2.5e-12 70 27 6 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q729H7 7.91e-06 50 24 9 231 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q7N986 2.54e-12 72 26 8 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8XNY7 2.58e-12 70 28 6 208 3 CPE0195 Putative ABC transporter ATP-binding protein CPE0195 Clostridium perfringens (strain 13 / Type A)
Q89LP2 2.66e-12 71 29 8 217 3 metN Methionine import ATP-binding protein MetN Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5V6B8 2.69e-12 70 27 8 218 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q5V6B8 7.23e-10 63 28 9 222 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q3KJS6 2.72e-12 72 26 6 223 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q3KJS6 1.93e-09 63 23 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain Pf0-1)
Q87PH3 2.74e-12 72 27 7 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q6FAN3 2.76e-12 71 26 6 219 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FAN3 1.85e-07 57 23 7 214 3 metN1 Methionine import ATP-binding protein MetN 1 Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q5XDS8 2.82e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5XDS8 2.33e-06 53 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q9KRT4 2.83e-12 72 24 5 207 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q734T1 2.84e-12 72 24 22 525 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q734T1 2.21e-06 53 29 9 211 3 BCE_3323 Putative ABC transporter ATP-binding protein BCE_3323 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q58762 2.85e-12 70 28 5 200 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7WGW1 2.87e-12 71 28 8 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1WXT0 2.92e-12 70 24 4 209 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 1.22e-08 59 24 7 226 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q4KK46 2.95e-12 72 27 6 225 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KK46 3.7e-09 62 22 7 212 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7W9U5 2.98e-12 71 28 8 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
P57383 3.03e-12 69 25 7 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57383 2.47e-09 61 27 8 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5GRS1 3.08e-12 70 26 2 158 3 znuC Zinc import ATP-binding protein ZnuC Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q1J8E4 3.17e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1J8E4 3.76e-06 52 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M4 (strain MGAS10750)
A0L0V9 3.26e-12 72 27 9 265 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella sp. (strain ANA-3)
A0L0V9 2.03e-06 54 27 6 196 3 macB Macrolide export ATP-binding/permease protein MacB Shewanella sp. (strain ANA-3)
Q57554 3.42e-12 70 28 6 182 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q57554 6.89e-10 63 25 9 222 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q399M3 3.46e-12 72 30 9 211 3 macB Macrolide export ATP-binding/permease protein MacB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8UH62 3.52e-12 71 25 6 226 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7WID6 3.7e-12 71 24 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7WID6 0.000101 48 24 9 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7NWX3 3.77e-12 71 26 7 223 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NWX3 4.09e-07 55 25 7 210 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q48V78 3.8e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q48V78 9.96e-06 51 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q9A1E3 3.8e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q9A1E3 9.96e-06 51 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M1
Q5WJP0 3.85e-12 71 25 5 235 3 metN2 Methionine import ATP-binding protein MetN 2 Shouchella clausii (strain KSM-K16)
Q7VLS9 3.85e-12 70 30 5 175 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7VLS9 1.14e-06 53 28 9 221 3 znuC Zinc import ATP-binding protein ZnuC Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7NUJ3 3.87e-12 72 31 7 200 3 macB Macrolide export ATP-binding/permease protein MacB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7NUJ3 1.09e-09 64 25 6 224 3 macB Macrolide export ATP-binding/permease protein MacB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q2NU23 3.93e-12 69 29 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q2NU23 4.19e-11 66 26 7 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Sodalis glossinidius (strain morsitans)
Q7VYN2 3.98e-12 71 24 6 215 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7VYN2 0.000101 48 24 9 214 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0C2H2 4.05e-12 72 26 5 206 3 macB Macrolide export ATP-binding/permease protein MacB Escherichia coli
P0C2H3 4.05e-12 72 26 5 206 3 macB2 Macrolide export ATP-binding/permease protein MacB 2 Escherichia coli O1:K1 / APEC
Q9WY65 4.26e-12 70 30 9 226 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1JNE0 4.32e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JNE0 2.52e-06 53 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDG6 4.32e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q1JDG6 2.52e-06 53 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M12 (strain MGAS2096)
P0CZ31 4.36e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ31 9.87e-06 51 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ30 4.36e-12 71 26 5 220 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P0CZ30 9.87e-06 51 25 6 200 3 metN Methionine import ATP-binding protein MetN Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q65V02 4.38e-12 68 25 8 213 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4FTM3 4.4e-12 69 28 6 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FTM3 8.2e-12 68 27 7 218 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8ELA5 4.42e-12 70 26 9 244 3 metN4 Methionine import ATP-binding protein MetN 4 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q39CJ6 4.97e-12 69 26 6 213 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39CJ6 1.13e-09 62 26 5 205 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8KLG1 5.03e-12 70 27 8 216 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8KLG1 2.86e-09 62 25 7 232 3 nodI Nod factor export ATP-binding protein I Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q57T09 5.04e-12 70 26 6 228 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella choleraesuis (strain SC-B67)
Q5WDP1 5.18e-12 70 28 8 225 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q47YG8 5.3e-12 69 28 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q47YG8 7.71e-10 63 26 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q0I5E9 5.35e-12 70 26 6 218 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
Q0I5E9 1.38e-05 50 23 8 217 3 metN Methionine import ATP-binding protein MetN Histophilus somni (strain 129Pt)
A1TXH7 5.45e-12 70 26 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A1TXH7 4.85e-06 52 24 7 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q5H0G3 5.76e-12 69 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q5H0G3 1.76e-11 67 29 14 257 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3E1 5.76e-12 69 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2P3E1 1.76e-11 67 29 14 257 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q839D5 5.81e-12 69 29 9 226 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q839D5 1.09e-06 53 24 6 220 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q1IGN4 5.82e-12 70 27 6 222 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q1IGN4 4.77e-09 62 25 8 210 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas entomophila (strain L48)
Q5WVL8 5.95e-12 70 27 7 220 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q5WVL8 3.6e-10 65 25 9 298 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q5WKL3 6.01e-12 70 26 6 218 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
Q5WKL3 4.06e-06 52 25 8 235 3 metN1 Methionine import ATP-binding protein MetN 1 Shouchella clausii (strain KSM-K16)
O07016 6.1e-12 70 26 6 209 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
O07016 4.78e-06 52 24 3 207 3 yvfR Uncharacterized ABC transporter ATP-binding protein YvfR Bacillus subtilis (strain 168)
Q5ZUG5 6.22e-12 70 27 7 220 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZUG5 4.12e-10 65 25 9 298 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
P77622 6.31e-12 70 25 6 183 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P77622 4.68e-08 58 26 8 241 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q7MKU3 6.57e-12 70 28 7 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 6.57e-12 70 28 7 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q2L0H5 6.62e-12 70 25 6 216 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q21QL9 7.15e-12 68 26 6 193 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7N3A6 7.22e-12 68 28 6 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N3A6 1.07e-07 56 26 7 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q30V33 7.34e-12 70 27 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q8E3S0 7.47e-12 70 26 6 219 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q1GHY4 7.48e-12 68 30 6 161 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Ruegeria sp. (strain TM1040)
Q74AT2 7.87e-12 68 28 5 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74AT2 2.45e-09 61 26 8 216 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q5NFU5 8.35e-12 70 26 7 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q5NFU5 1.53e-06 53 21 7 242 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q0BMC9 8.35e-12 70 26 7 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3Z2 8.35e-12 70 26 7 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. holarctica (strain LVS)
Q3AKM8 8.55e-12 68 28 8 217 3 phnC Phosphonates import ATP-binding protein PhnC Synechococcus sp. (strain CC9605)
Q8U8D6 8.74e-12 69 28 5 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8U8D6 3.32e-11 67 26 4 224 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1MQ44 8.92e-12 70 27 7 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q31GF5 9.25e-12 68 28 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31GF5 4.75e-10 63 25 5 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A0LM36 9.59e-12 71 28 6 210 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A0LM36 4.88e-08 59 24 7 219 3 macB Macrolide export ATP-binding/permease protein MacB Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q8GEH7 9.61e-12 69 26 7 230 3 metN Methionine import ATP-binding protein MetN Erwinia pyrifoliae (strain DSM 12162 / Ep1/96)
Q0TUN8 9.8e-12 69 28 6 208 1 ecfA3 Energy-coupling factor transporter ATP-binding protein EcfA3 Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q63S19 9.85e-12 70 27 8 243 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q63S19 6.02e-09 61 24 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 9.85e-12 70 27 8 243 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q3JPZ4 6.02e-09 61 24 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 9.85e-12 70 27 8 243 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q62M41 6.02e-09 61 24 8 236 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q8ZRM9 9.86e-12 70 26 5 219 3 metN1 Methionine import ATP-binding protein MetN 1 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q0SWH9 9.89e-12 69 28 6 208 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Clostridium perfringens (strain SM101 / Type A)
Q8DPC2 1.01e-11 70 29 7 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DPC2 5.84e-07 55 24 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 1.01e-11 70 29 7 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97Q42 5.84e-07 55 24 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 1.01e-11 70 29 7 195 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q04JW0 5.84e-07 55 24 8 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q93DX8 1.01e-11 68 27 9 226 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q93DX8 3.04e-08 58 25 6 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q07LU3 1.03e-11 68 25 6 205 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q07LU3 5.34e-08 57 29 8 234 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisA53)
Q13U53 1.07e-11 70 27 4 206 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q13U53 0.000227 47 25 5 196 3 araG Arabinose import ATP-binding protein AraG Paraburkholderia xenovorans (strain LB400)
Q82VK1 1.07e-11 71 25 8 243 3 macB Macrolide export ATP-binding/permease protein MacB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q82VK1 6.03e-08 59 27 6 207 3 macB Macrolide export ATP-binding/permease protein MacB Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q9KTJ5 1.08e-11 69 26 6 218 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KTJ5 1.73e-06 53 22 8 215 3 metN Methionine import ATP-binding protein MetN Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q65T42 1.09e-11 70 26 10 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65T42 6.65e-08 58 25 7 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1IGM2 1.09e-11 68 24 9 236 3 tauB Taurine import ATP-binding protein TauB Pseudomonas entomophila (strain L48)
Q8TIX0 1.12e-11 69 28 8 211 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8TIX0 2e-09 62 27 6 218 3 MA_4020 Putative ABC transporter ATP-binding protein MA_4020 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q9AT00 1.15e-11 69 31 7 189 1 TGD3 Protein TRIGALACTOSYLDIACYLGLYCEROL 3, chloroplastic Arabidopsis thaliana
Q9AT00 7.23e-08 58 27 6 181 1 TGD3 Protein TRIGALACTOSYLDIACYLGLYCEROL 3, chloroplastic Arabidopsis thaliana
Q2YAD6 1.15e-11 70 27 7 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q2YAD6 2.31e-08 59 26 4 179 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7VZE5 1.18e-11 69 28 8 212 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O57896 1.19e-11 69 27 7 205 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q14H97 1.23e-11 69 26 7 219 3 metN Methionine import ATP-binding protein MetN Francisella tularensis subsp. tularensis (strain FSC 198)
Q2NTI7 1.24e-11 68 26 5 185 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q2NTI7 6.67e-08 57 24 6 221 3 znuC Zinc import ATP-binding protein ZnuC Sodalis glossinidius (strain morsitans)
Q9CP06 1.25e-11 69 28 7 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q9CP06 9.49e-06 51 22 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q82B58 1.26e-11 70 21 9 400 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q82B58 1.68e-11 70 31 9 211 3 SAV_5847 Putative ABC transporter ATP-binding protein SAV_5847 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q31VE6 1.27e-11 68 25 4 208 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 3.39e-10 64 23 5 243 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q48PN3 1.28e-11 70 27 6 216 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PN3 2.52e-10 65 25 9 231 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q51719 1.4e-11 68 27 6 197 3 None Putative ABC transporter ATP-binding protein in cobA 5'region Propionibacterium freudenreichii subsp. shermanii
Q51719 1.1e-08 60 28 8 213 3 None Putative ABC transporter ATP-binding protein in cobA 5'region Propionibacterium freudenreichii subsp. shermanii
Q32I01 1.44e-11 67 26 6 207 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Shigella dysenteriae serotype 1 (strain Sd197)
A1SWH9 1.44e-11 69 25 4 205 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q3SQ65 1.48e-11 68 27 7 216 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3SQ65 1.43e-06 53 25 8 227 3 hmuV Hemin import ATP-binding protein HmuV Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q88RB3 1.49e-11 69 26 6 222 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88RB3 1.59e-08 60 24 8 209 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P75370 1.6e-11 67 28 9 220 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75370 2.4e-07 55 21 6 219 3 p29 Probable ABC transporter ATP-binding protein p29 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q2RWA3 1.61e-11 69 27 8 232 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RWA3 3.85e-05 49 25 8 232 3 metN Methionine import ATP-binding protein MetN Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)

  • Number of RefSeq hits:

General

Source Morganella morganii S1
Locus tag FBDBKF_02640
Feature type CDS
Gene uup
Product ABC-F family ATPase
Location 225421 - 227004 (strand: 1)
Length 1584 (nucleotides) / 527 (amino acids)
In genomic island -

Contig

Accession contig_2
Length 292399 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_755
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter
PF12848 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06158 ATP-binding cassette, subfamily F, member 3 - -

Protein Sequence

MQFGAKPLFENISVKFGGGNRYGLIGANGSGKSTFMKILGGDLAPSSGNVFLDPNERLGKLKQDQFAYEEFSVLDTVIMGHTELWEVKQERDRIYSLPDMSEEDGMRVADLEVQFAEMDGYTVESRAGELLLGVGIPLEQHNGPMSEIAPGWKLRVLLAQALFADPDILLLDEPTNNLDIDTIRWLEQTLNARNSTMIIISHDRHFLNMVCTHMADLDYGSLNVHPGNYDEYMFAATQARERLLADNAKKKAQISELQSFVSRFSANASKSRQATSRAKQIEKIQLTEIKASSRQNPFIRFEQDKKLFRNALEVENLSKGYDGNAPLFKNVNMMMEVGEKVAVLGMNGVGKSTFLKTLVGELTPDTGRYKWSENANIGYYAQDHATDFEVDMTVFDWMSLWMQPGDDEQSVRSVLGRLLFSQDDIKKSVQVLSGGEKGRMLFGKLMMTKPNILIMDEPTNHLDMESIESLNMALELYQGTLVFVSHDREFVSSLATRIIEITPEKVTDFTGSYDEYLRSRGIESENN

Flanking regions ( +/- flanking 50bp)

TCTCCTTTAACTTATGAGTATTCGTCTTGTTAATCAGCAACAATATTACGATGCAGTTCGGCGCCAAGCCGCTGTTTGAAAATATCTCTGTCAAATTCGGCGGCGGTAACCGCTATGGCCTGATCGGCGCAAACGGCAGCGGTAAATCCACGTTTATGAAAATTCTCGGCGGTGATCTGGCGCCAAGCAGCGGCAACGTGTTTCTCGACCCGAACGAGCGTCTGGGTAAACTGAAACAGGATCAGTTCGCCTATGAAGAATTTTCTGTGCTCGACACAGTCATTATGGGTCACACCGAACTGTGGGAAGTCAAACAGGAGCGTGACCGCATCTACAGCCTGCCGGACATGAGCGAAGAAGACGGTATGCGCGTGGCGGATCTCGAAGTGCAGTTTGCTGAAATGGACGGCTACACCGTGGAATCCCGCGCCGGTGAATTACTGCTGGGTGTGGGGATCCCGCTGGAACAGCATAACGGCCCGATGAGTGAAATCGCACCCGGCTGGAAACTGCGTGTGCTGCTGGCACAGGCGTTGTTTGCGGACCCGGATATTCTGCTGCTCGACGAACCGACCAACAACCTGGATATCGACACCATCCGCTGGCTGGAGCAGACGCTGAATGCGCGCAACAGCACCATGATCATCATTTCCCATGACCGCCACTTCCTGAATATGGTGTGCACGCACATGGCCGATCTGGACTACGGCAGCCTGAATGTGCATCCGGGTAACTATGATGAATATATGTTTGCCGCCACTCAGGCGCGTGAGCGTCTGTTAGCGGATAACGCGAAGAAGAAAGCACAAATCAGTGAGTTGCAGTCATTTGTCAGCCGTTTCAGCGCAAATGCCTCCAAGTCCCGTCAGGCGACTTCCCGCGCCAAACAGATTGAAAAAATTCAGCTGACCGAAATTAAAGCGTCCAGCCGTCAGAACCCGTTTATCCGCTTTGAGCAGGATAAGAAATTATTCCGTAATGCGCTGGAAGTGGAAAACCTGTCCAAAGGTTATGACGGTAACGCCCCGCTGTTCAAAAACGTCAATATGATGATGGAAGTGGGTGAAAAAGTCGCGGTTCTGGGTATGAACGGTGTGGGTAAATCCACCTTCCTGAAAACTCTGGTCGGTGAGCTGACACCGGATACCGGTCGTTATAAGTGGTCTGAAAACGCCAATATCGGTTACTACGCGCAGGATCACGCCACCGATTTTGAAGTTGATATGACGGTTTTCGACTGGATGAGCCTGTGGATGCAGCCGGGTGATGATGAGCAGTCCGTCCGCAGTGTATTGGGCCGCCTGCTGTTCTCCCAGGATGACATTAAAAAATCCGTACAGGTGTTATCCGGGGGTGAAAAAGGCCGGATGTTATTTGGTAAGTTAATGATGACTAAACCAAACATTCTGATTATGGATGAACCGACCAACCACCTCGATATGGAATCTATTGAATCCCTGAATATGGCGCTGGAGTTATATCAGGGAACATTAGTGTTTGTTTCCCATGACCGCGAGTTCGTCAGTTCCCTGGCGACCCGCATCATCGAAATTACACCGGAGAAAGTCACTGACTTTACCGGCAGTTACGATGAGTACCTGCGCAGCCGCGGTATTGAATCAGAAAACAACTGATCCCCGTTCTGCCAATAAGAAAAGCCCCGTTTCAGAGCCATGAAACGGGG