Homologs in group_1262

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07360 FBDBKF_07360 63.7 Morganella morganii S1 helD DNA helicase IV
EHELCC_03610 EHELCC_03610 63.7 Morganella morganii S2 helD DNA helicase IV
NLDBIP_03610 NLDBIP_03610 63.7 Morganella morganii S4 helD DNA helicase IV
LHKJJB_09440 LHKJJB_09440 63.7 Morganella morganii S3 helD DNA helicase IV
HKOGLL_09535 HKOGLL_09535 63.7 Morganella morganii S5 helD DNA helicase IV
F4V73_RS01545 F4V73_RS01545 64.3 Morganella psychrotolerans helD DNA helicase IV

Distribution of the homologs in the orthogroup group_1262

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1262

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P15038 0.0 946 64 1 684 1 helD DNA helicase IV Escherichia coli (strain K12)
O31626 1.77e-22 106 27 9 364 1 yjcD Putative ATP-dependent DNA helicase YjcD Bacillus subtilis (strain 168)
Q9S3Q0 1.83e-21 103 27 9 344 3 pcrA ATP-dependent DNA helicase PcrA Leuconostoc citreum
P75438 3.4e-21 101 26 17 526 3 MPN_340 Probable DNA helicase MPN_340 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P45612 4.42e-20 98 25 10 374 3 uvrD Probable DNA helicase II homolog Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P45612 6.48e-05 50 35 3 96 3 uvrD Probable DNA helicase II homolog Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P64319 1.43e-19 97 26 11 348 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain N315)
P64318 1.43e-19 97 26 11 348 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q6GFF2 1.47e-19 97 26 11 348 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MRSA252)
Q8NVT1 1.5e-19 97 26 11 348 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MW2)
Q6G828 1.5e-19 97 26 11 348 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain MSSA476)
Q5HEL7 1.5e-19 97 26 11 348 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain COL)
Q53727 1.5e-19 97 26 11 348 1 pcrA ATP-dependent DNA helicase PcrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q5HN29 1.9e-19 96 25 8 347 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CRT9 2.15e-19 96 25 8 347 3 pcrA ATP-dependent DNA helicase PcrA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
D1KF50 6.46e-19 95 27 8 333 1 SRS2 ATP-dependent DNA helicase SRS2-like protein At4g25120 Arabidopsis thaliana
Q9CD72 9.14e-18 91 25 13 386 3 uvrD ATP-dependent DNA helicase UvrD1 Mycobacterium leprae (strain TN)
O51889 1.03e-17 90 25 11 363 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
O51889 0.000105 49 32 2 80 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P47486 1.47e-17 90 27 11 328 3 uvrD Probable DNA helicase II homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q05311 1.49e-17 90 27 8 338 3 uvrD DNA helicase II Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q1RIP8 1.73e-17 90 26 11 347 3 uvrD Probable DNA helicase II homolog Rickettsia bellii (strain RML369-C)
P57654 1.07e-16 87 29 13 367 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57654 0.000139 48 33 3 106 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9ZD95 1.27e-16 87 26 12 370 3 uvrD Probable DNA helicase II homolog Rickettsia prowazekii (strain Madrid E)
Q92HZ6 1.41e-16 87 26 12 348 3 uvrD Probable DNA helicase II homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q89A21 1.79e-16 87 27 10 341 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89A21 7.62e-05 49 33 3 104 3 rep ATP-dependent DNA helicase Rep Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q4ULN5 1.97e-16 87 25 10 345 3 uvrD Probable DNA helicase II homolog Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P75437 5.72e-16 85 25 9 358 3 uvrD Probable DNA helicase II homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75437 0.000184 48 35 3 89 3 uvrD Probable DNA helicase II homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P12954 6.69e-16 85 26 8 277 1 SRS2 ATP-dependent DNA helicase SRS2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q68WT1 9.16e-16 84 26 11 346 3 uvrD DNA helicase II Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P9WMQ1 1.33e-15 84 25 10 347 1 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMQ0 1.33e-15 84 25 10 347 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5A4 1.33e-15 84 25 10 347 3 uvrD1 ATP-dependent DNA helicase UvrD1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O34580 1.68e-15 84 25 9 341 1 pcrA ATP-dependent DNA helicase PcrA Bacillus subtilis (strain 168)
Q10213 4.57e-14 79 27 9 340 1 srs2 ATP-dependent DNA helicase srs2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P44804 1.23e-13 78 24 8 361 3 rep ATP-dependent DNA helicase Rep Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44804 2.99e-05 51 30 3 114 3 rep ATP-dependent DNA helicase Rep Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9L6S1 3.02e-13 76 26 6 342 3 rep ATP-dependent DNA helicase Rep Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9L6S1 7.19e-05 49 32 4 109 3 rep ATP-dependent DNA helicase Rep Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P09980 1.66e-12 74 25 5 341 1 rep ATP-dependent DNA helicase Rep Escherichia coli (strain K12)
P09980 8.68e-05 49 32 4 109 1 rep ATP-dependent DNA helicase Rep Escherichia coli (strain K12)
P03018 4.71e-09 63 42 1 85 1 uvrD DNA helicase II Escherichia coli (strain K12)
P03018 4.21e-07 57 30 3 138 1 uvrD DNA helicase II Escherichia coli (strain K12)
A7Z368 7.06e-09 63 30 8 188 3 addA ATP-dependent helicase/nuclease subunit A Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q65LJ9 1.12e-08 62 30 3 140 3 addA ATP-dependent helicase/nuclease subunit A Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P56255 1.13e-08 62 36 1 95 1 pcrA ATP-dependent DNA helicase PcrA Geobacillus stearothermophilus
P56255 1.73e-06 55 25 2 143 1 pcrA ATP-dependent DNA helicase PcrA Geobacillus stearothermophilus
Q2YWW4 8.81e-08 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q02322 1.02e-07 58 33 4 132 1 uvrD DNA helicase II Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q02322 1.01e-05 52 38 1 89 1 uvrD DNA helicase II Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A8Z073 1.02e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIA8 1.02e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain USA300)
A6QFH8 1.04e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Newman)
Q5HHB7 1.04e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain COL)
Q2FZT5 1.04e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GAV9 1.04e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MSSA476)
Q8NXE9 1.07e-07 59 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MW2)
P23478 1.33e-07 58 29 4 159 1 addA ATP-dependent helicase/nuclease subunit A Bacillus subtilis (strain 168)
Q6GIC1 1.34e-07 58 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
Q6GIC1 0.000885 46 26 4 164 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain MRSA252)
Q03NA7 1.9e-07 58 29 5 144 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q03NA7 0.000512 47 40 1 70 3 addA ATP-dependent helicase/nuclease subunit A Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q7A6H4 2.21e-07 58 28 6 171 1 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain N315)
Q99VC3 2.21e-07 58 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRE5 2.21e-07 58 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH9)
A6U074 2.21e-07 58 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain JH1)
A7X0I2 2.21e-07 58 28 6 171 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q24WW8 2.57e-07 58 28 4 139 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain Y51)
B8FXD7 2.7e-07 58 28 4 139 3 addA ATP-dependent helicase/nuclease subunit A Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q929A9 4.17e-07 57 29 4 148 3 addA ATP-dependent helicase/nuclease subunit A Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DF44 7.21e-07 56 28 4 148 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4a (strain HCC23)
Q8K9A9 2e-06 55 35 2 87 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q836J8 2.43e-06 54 26 4 163 3 addA ATP-dependent helicase/nuclease subunit A Enterococcus faecalis (strain ATCC 700802 / V583)
Q836J8 1.07e-05 52 41 2 75 3 addA ATP-dependent helicase/nuclease subunit A Enterococcus faecalis (strain ATCC 700802 / V583)
B9DRV0 2.81e-06 54 30 4 129 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q3AA35 2.86e-06 54 27 4 181 3 addA ATP-dependent helicase/nuclease subunit A Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8Y511 2.87e-06 54 28 5 148 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q4L4Y3 3.37e-06 54 26 4 121 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
Q4L4Y3 0.000669 47 40 1 59 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus haemolyticus (strain JCSC1435)
Q71X99 3.43e-06 54 28 4 148 3 addA ATP-dependent helicase/nuclease subunit A Listeria monocytogenes serotype 4b (strain F2365)
Q74JA6 4.12e-06 54 26 5 160 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B5E4P5 5.19e-06 53 24 6 189 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 19F (strain G54)
A0AL18 5.53e-06 53 27 4 148 3 addA ATP-dependent helicase/nuclease subunit A Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q5L263 7.21e-06 53 27 4 140 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
Q5L263 0.000749 46 37 4 100 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus kaustophilus (strain HTA426)
Q043G6 8.01e-06 53 25 3 141 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P57529 8.17e-06 53 30 2 118 3 recB RecBCD enzyme subunit RecB Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B2A610 8.17e-06 53 28 4 137 3 addA ATP-dependent helicase/nuclease subunit A Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
A5D1P3 1.07e-05 52 29 6 164 3 addA ATP-dependent helicase/nuclease subunit A Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B2IPX3 1.16e-05 52 23 6 191 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain CGSP14)
B8ZQ32 1.19e-05 52 23 6 191 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1IBR6 1.2e-05 52 23 6 191 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain Hungary19A-6)
Q97GV3 1.31e-05 52 25 5 142 3 addA ATP-dependent helicase/nuclease subunit A Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8DT76 1.36e-05 52 29 4 130 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A8FBR1 1.54e-05 52 27 5 140 3 addA ATP-dependent helicase/nuclease subunit A Bacillus pumilus (strain SAFR-032)
A5N628 1.81e-05 52 24 4 166 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
A5N628 0.000121 49 39 2 73 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DZK4 1.89e-05 52 24 4 166 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
B9DZK4 0.000122 49 39 2 73 3 addA ATP-dependent helicase/nuclease subunit A Clostridium kluyveri (strain NBRC 12016)
Q04AN7 2.05e-05 52 38 0 84 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
B1HN90 2.06e-05 52 28 5 159 3 addA ATP-dependent helicase/nuclease subunit A Lysinibacillus sphaericus (strain C3-41)
B1I493 2.14e-05 51 28 4 129 3 addA ATP-dependent helicase/nuclease subunit A Desulforudis audaxviator (strain MP104C)
Q1GAA9 2.16e-05 51 38 0 84 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A0PY67 2.61e-05 51 24 4 172 3 addA ATP-dependent helicase/nuclease subunit A Clostridium novyi (strain NT)
B4U2H1 2.78e-05 51 27 5 155 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0MGY6 3.08e-05 51 27 5 155 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus equi subsp. zooepidemicus (strain H70)
Q8DPR6 3.78e-05 50 22 3 152 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QP9 3.78e-05 50 22 3 152 3 rexA Exonuclease/helicase subunit RexA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04KF8 3.78e-05 50 22 3 152 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q1WRS0 4.04e-05 50 27 6 170 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
Q1WRS0 0.000762 46 31 2 107 3 addA ATP-dependent helicase/nuclease subunit A Ligilactobacillus salivarius (strain UCC118)
A4IKW7 4.17e-05 50 24 5 175 3 addA ATP-dependent helicase/nuclease subunit A Geobacillus thermodenitrificans (strain NG80-2)
A8MJ41 4.51e-05 50 24 4 133 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus oremlandii (strain OhILAs)
B3WEJ1 4.9e-05 50 31 3 116 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus casei (strain BL23)
P9WMP9 5e-05 50 32 2 99 1 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMP9 0.000585 47 34 2 90 1 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMP8 5e-05 50 32 2 99 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WMP8 0.000585 47 34 2 90 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P64321 5e-05 50 32 2 99 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P64321 0.000585 47 34 2 90 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q038V7 5.11e-05 50 31 3 116 3 addA ATP-dependent helicase/nuclease subunit A Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q49WA6 5.28e-05 50 30 2 130 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q0AXU8 6.66e-05 50 23 7 190 3 addA ATP-dependent helicase/nuclease subunit A Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q67MD5 9.86e-05 49 26 5 165 3 addA ATP-dependent helicase/nuclease subunit A Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q48UB8 9.92e-05 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JCJ8 0.000103 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q03D71 0.000104 49 28 4 124 3 addA ATP-dependent helicase/nuclease subunit A Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q1JMH5 0.000107 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M12 (strain MGAS9429)
B5XKR4 0.000111 49 28 4 129 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M49 (strain NZ131)
Q9A0H3 0.000111 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M1
A2RFA8 0.000113 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J7E4 0.000117 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q8P1J2 0.000118 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ53 0.000123 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain SSI-1)
P0CZ52 0.000123 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8RCZ0 0.000123 49 27 3 118 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RCZ0 0.000165 48 40 1 69 3 addA ATP-dependent helicase/nuclease subunit A Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q1JHM1 0.000125 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q5XCW6 0.000125 49 29 4 121 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P53528 0.000128 48 31 2 99 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
P53528 0.000284 48 35 2 94 3 uvrD2 ATP-dependent DNA helicase UvrD2 Mycobacterium leprae (strain TN)
Q8E061 0.000142 49 27 3 119 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E061 0.000602 47 34 1 84 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K1I4 0.000145 48 27 3 119 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q3K1I4 0.000582 47 34 1 84 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8ERW5 0.000152 48 27 5 151 3 addA ATP-dependent helicase/nuclease subunit A Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8E5T9 0.000175 48 27 3 119 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype III (strain NEM316)
Q8E5T9 0.000628 47 34 1 84 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus agalactiae serotype III (strain NEM316)
B0TDI0 0.000181 48 26 6 204 3 addA ATP-dependent helicase/nuclease subunit A Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q2RL77 0.000184 48 29 6 151 3 addA ATP-dependent helicase/nuclease subunit A Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q033I1 0.000186 48 26 5 160 3 addA ATP-dependent helicase/nuclease subunit A Lactococcus lactis subsp. cremoris (strain SK11)
B2THC8 0.000212 48 25 7 167 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Eklund 17B / Type B)
Q88U41 0.000224 48 36 2 80 3 addA ATP-dependent helicase/nuclease subunit A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88U41 0.000229 48 26 4 139 3 addA ATP-dependent helicase/nuclease subunit A Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A4VUD2 0.000237 48 38 1 73 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 05ZYH33)
A4W0M7 0.000237 48 38 1 73 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus suis (strain 98HAH33)
Q18AN9 0.000271 48 27 5 136 3 addA ATP-dependent helicase/nuclease subunit A Clostridioides difficile (strain 630)
Q5LY80 0.000332 47 40 1 69 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain CNRZ 1066)
Q5LY80 0.000685 47 26 5 172 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain CNRZ 1066)
Q5M2T7 0.000335 47 40 1 69 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M2T7 0.000685 47 26 5 172 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
B2UX57 0.000354 47 25 4 133 3 addA ATP-dependent helicase/nuclease subunit A Clostridium botulinum (strain Alaska E43 / Type E3)
Q03IZ8 0.000374 47 40 1 69 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03IZ8 0.000785 46 26 5 172 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
A9VJ02 0.000376 47 25 4 148 3 addA ATP-dependent helicase/nuclease subunit A Bacillus mycoides (strain KBAB4)
Q5HQJ4 0.000467 47 26 4 130 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3CNT9 0.000536 47 32 3 94 3 addA ATP-dependent helicase/nuclease subunit A Streptococcus sanguinis (strain SK36)
A8YVK0 0.000539 47 29 3 111 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus helveticus (strain DPC 4571)
A8YVK0 0.000592 47 40 2 71 3 addA ATP-dependent helicase/nuclease subunit A Lactobacillus helveticus (strain DPC 4571)
A2RH77 0.000543 47 26 5 160 1 rexA Exonuclease/helicase subunit RexA Lactococcus lactis subsp. cremoris (strain MG1363)
A6LPC4 0.000642 47 25 5 151 3 addA ATP-dependent helicase/nuclease subunit A Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B9DIS2 0.000746 46 31 3 95 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus carnosus (strain TM300)
Q03W49 0.000747 46 26 3 130 3 addA ATP-dependent helicase/nuclease subunit A Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B7HZR5 0.000808 46 24 4 148 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain AH187)
B9ITE9 0.000815 46 24 4 148 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain Q1)
Q8CPT9 0.000871 46 26 4 130 3 addA ATP-dependent helicase/nuclease subunit A Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A6TVN2 0.001 46 29 2 88 3 addA ATP-dependent helicase/nuclease subunit A Alkaliphilus metalliredigens (strain QYMF)
B1YKM8 0.001 46 28 4 109 3 addA ATP-dependent helicase/nuclease subunit A Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q73C23 0.001 46 24 4 148 3 addA ATP-dependent helicase/nuclease subunit A Bacillus cereus (strain ATCC 10987 / NRS 248)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03875
Feature type CDS
Gene helD
Product DNA helicase IV
Location 878588 - 880639 (strand: 1)
Length 2052 (nucleotides) / 683 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1262
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00580 UvrD/REP helicase N-terminal domain
PF12462 DNA helicase IV / RNA helicase N terminal
PF13361 UvrD-like helicase C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0210 Replication, recombination and repair (L) L Superfamily I DNA or RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03658 DNA helicase IV [EC:5.6.2.4] - -

Protein Sequence

MELKSTPMGQRLAQHPYNRVKLLNAGIEVSGEKHQYLIPFNELIDIFCKKGIVWGELEFLLPDNKVVRLHGTDWEETQQFYRYLYQTWQIWSQEMSEITAQVLEKQLSSIQDIIQSDKWIKQNQLAAIQQAIQESFSALPLPLERLAQFDNCKVHYQRCLQWLQQGKALIAQENEQWITRILTEHAEFFTTIETSPLNESQCKAVINGEDNILVLAGAGSGKTSVLVARAGWLLRRKLATSEQILLLAFGRKAAEEMNQRLSERLNADITAKTFHALALFIIQQSTKKQPKISELEINSEKRRTLLLTQWREQCQQKKAQAKGWREWLSEELAWEIPDGEFWHDKKLENQVAVRLERWISLLRMQGGSQKTMIDSVPAEYTDAFKKYLKLLAPLLKAWKTALKEENAIDFSGLLHQAINLIEKGRFVSPWKHILVDEFQDISPLRAALLNALKQQNTQTSLFAVGDDWQAIYRFSGAELLLTTAFHQSFGDGAECALDTTYRFNSTIGDVANTFIQQNPNQLAKPLNSLTKGNKKAVVLLPDDQLESLLNKMSGYVSDDETILLLARYHYLQPDLLKKAKTRWPKLKLQFMTFHASKGQQADYVIILGLQSGKDGFPAPARESIIETALLPPVEDYPDAEERRLMYVALTRAKKQVWLLFNKQQPSCFVSELKSQGVPTQKKP

Flanking regions ( +/- flanking 50bp)

AAAAAGAGTTTAACGACAGACTATTTGTTATTTATTGTAGGAATTACAGAATGGAACTGAAATCAACCCCAATGGGACAACGTTTAGCTCAGCATCCTTATAACAGGGTAAAATTGTTAAATGCGGGTATTGAGGTCAGTGGTGAAAAGCATCAATATTTAATTCCTTTTAATGAATTGATCGACATTTTTTGTAAAAAAGGCATTGTGTGGGGAGAGTTAGAGTTTTTACTGCCCGACAATAAAGTGGTTCGTTTGCATGGAACGGACTGGGAAGAAACGCAACAATTTTACCGCTATCTTTATCAAACTTGGCAAATATGGAGCCAAGAGATGAGTGAGATAACGGCGCAAGTACTTGAAAAGCAACTCTCTTCTATCCAAGATATAATTCAAAGCGATAAATGGATAAAGCAAAACCAGTTAGCCGCTATTCAACAGGCAATCCAAGAAAGTTTTTCTGCTCTTCCTCTTCCTCTGGAACGACTTGCTCAATTTGATAACTGTAAGGTGCATTATCAACGCTGTTTACAGTGGTTACAGCAAGGTAAGGCATTAATTGCGCAAGAAAATGAGCAATGGATCACCCGTATATTGACAGAGCATGCGGAGTTTTTTACTACCATTGAAACATCGCCTTTAAATGAATCGCAATGTAAAGCCGTTATCAACGGTGAAGATAATATATTGGTATTAGCGGGTGCTGGTAGTGGTAAAACGTCGGTACTAGTGGCAAGAGCAGGGTGGTTGTTACGTCGTAAACTAGCAACCTCTGAACAAATTCTACTATTGGCTTTTGGACGTAAAGCCGCTGAAGAGATGAACCAACGTTTATCTGAGCGCTTAAACGCTGATATTACGGCGAAAACCTTTCATGCATTGGCATTATTTATTATCCAACAGTCAACTAAAAAACAACCCAAGATCAGCGAATTAGAAATCAATAGTGAAAAGAGAAGAACACTATTGTTAACGCAGTGGCGTGAGCAGTGTCAGCAGAAAAAAGCACAAGCGAAAGGCTGGCGTGAGTGGTTATCTGAAGAGCTAGCATGGGAAATCCCTGATGGGGAGTTTTGGCATGATAAAAAATTAGAAAATCAAGTTGCCGTAAGATTAGAGCGGTGGATCAGTTTATTAAGAATGCAAGGTGGTAGCCAAAAAACAATGATTGATTCTGTGCCTGCAGAATATACGGATGCATTTAAAAAGTATTTAAAACTATTAGCACCACTGTTAAAGGCATGGAAAACCGCATTAAAAGAAGAGAATGCCATTGATTTTTCAGGGCTATTACATCAAGCCATTAATCTGATAGAAAAAGGGCGTTTCGTCAGTCCTTGGAAACATATTCTGGTGGATGAATTCCAAGATATTTCACCACTAAGAGCAGCACTATTAAATGCGTTAAAACAACAAAATACACAAACTTCATTATTTGCAGTTGGTGATGACTGGCAAGCTATTTATCGCTTTAGTGGGGCTGAATTATTACTAACAACAGCGTTTCATCAATCTTTTGGTGATGGTGCTGAGTGTGCATTAGATACCACTTATCGTTTTAATTCGACTATAGGTGACGTTGCCAATACATTTATTCAACAAAATCCTAATCAATTAGCTAAGCCTTTAAATAGCTTAACAAAAGGTAATAAAAAAGCCGTTGTATTATTGCCGGATGATCAATTAGAAAGTTTATTAAATAAAATGAGTGGTTATGTCAGTGACGATGAAACGATCCTTTTATTAGCGCGTTATCATTACTTACAACCTGATTTATTGAAAAAGGCGAAAACGCGCTGGCCCAAATTAAAATTACAGTTTATGACTTTTCATGCTTCAAAAGGTCAACAAGCTGATTATGTGATTATATTAGGTTTACAATCGGGTAAAGACGGATTTCCAGCTCCGGCAAGAGAGTCGATTATAGAAACCGCTTTATTACCCCCTGTTGAAGACTATCCTGATGCTGAAGAGCGCCGATTAATGTATGTGGCATTAACAAGAGCAAAAAAACAAGTATGGTTATTATTTAATAAACAACAACCATCTTGTTTTGTGTCAGAGTTAAAATCTCAAGGTGTCCCTACGCAAAAAAAACCATAAGGCATTATTTTAAACGTTCTTTTAAATAACCTTCATAGTCGGGAATTTTA