Homologs in group_4363

Help

0 homologs were identified in 0 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product

Distribution of the homologs in the orthogroup group_4363

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_4363

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ET09 0.0 1144 100 0 556 3 fhs Formate--tetrahydrofolate ligase Proteus mirabilis (strain HI4320)
A9KNJ5 0.0 805 67 0 556 3 fhs Formate--tetrahydrofolate ligase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4ZBG8 0.0 795 67 0 556 3 fhs Formate--tetrahydrofolate ligase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
C4Z1V6 0.0 770 65 0 556 3 fhs Formate--tetrahydrofolate ligase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q251P8 0.0 729 62 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Desulfitobacterium hafniense (strain Y51)
B0TBP1 0.0 722 60 0 556 3 fhs Formate--tetrahydrofolate ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q0SQ82 0.0 721 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium perfringens (strain SM101 / Type A)
A0PXN0 0.0 720 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium novyi (strain NT)
A5I7P9 0.0 720 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
C3KVU4 0.0 720 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain 657 / Type Ba4)
A7FZB0 0.0 720 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain ATCC 19397 / Type A)
A7GJB8 0.0 719 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IGY1 0.0 719 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Okra / Type B1)
Q97EB3 0.0 719 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8XHL4 0.0 717 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium perfringens (strain 13 / Type A)
Q0TMI3 0.0 717 62 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C1FND0 0.0 714 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Kyoto / Type A2)
B8I3S9 0.0 712 61 0 556 3 fhs Formate--tetrahydrofolate ligase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A6LPL1 0.0 712 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
B1KTC6 0.0 704 61 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Loch Maree / Type A3)
B0KC36 0.0 701 61 1 556 3 fhs Formate--tetrahydrofolate ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B2UXU5 0.0 700 60 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Alaska E43 / Type E3)
B2TI29 0.0 699 60 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium botulinum (strain Eklund 17B / Type B)
B0K5A5 0.0 698 60 1 556 3 fhs Formate--tetrahydrofolate ligase Thermoanaerobacter sp. (strain X514)
A8MIN1 0.0 694 59 0 556 3 fhs Formate--tetrahydrofolate ligase Alkaliphilus oremlandii (strain OhILAs)
Q3A9K2 0.0 692 60 0 556 3 fhs Formate--tetrahydrofolate ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8R7L3 0.0 688 61 2 557 3 fhs Formate--tetrahydrofolate ligase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A3DI22 0.0 684 59 0 556 3 fhs Formate--tetrahydrofolate ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A2SS72 0.0 681 60 2 555 3 fhs Formate--tetrahydrofolate ligase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q2RM91 0.0 678 58 0 554 1 fhs Formate--tetrahydrofolate ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A5N5B3 0.0 676 57 2 557 3 fhs Formate--tetrahydrofolate ligase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9DYW1 0.0 676 57 2 557 3 fhs Formate--tetrahydrofolate ligase Clostridium kluyveri (strain NBRC 12016)
Q5XZD9 0.0 674 60 0 556 3 fhs Formate--tetrahydrofolate ligase Peptoclostridium acidaminophilum
Q0AX38 0.0 673 59 1 556 3 fhs Formate--tetrahydrofolate ligase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q07064 0.0 671 58 0 555 3 fhs Formate--tetrahydrofolate ligase Clostridium cylindrosporum
P21164 0.0 671 58 0 554 1 fhs Formate--tetrahydrofolate ligase Moorella thermoacetica
Q24ZZ8 0.0 671 59 3 558 3 fhs2 Formate--tetrahydrofolate ligase 2 Desulfitobacterium hafniense (strain Y51)
Q891R3 0.0 670 58 0 554 3 fhs Formate--tetrahydrofolate ligase Clostridium tetani (strain Massachusetts / E88)
B9IYP4 0.0 669 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain Q1)
Q6HJK9 0.0 669 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q63C61 0.0 669 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain ZK / E33L)
C1ES77 0.0 669 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain 03BB102)
A0RD97 0.0 669 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus thuringiensis (strain Al Hakam)
Q189R2 0.0 668 58 2 557 3 fhs Formate--tetrahydrofolate ligase Clostridioides difficile (strain 630)
B8D067 0.0 668 61 1 556 3 fhs Formate--tetrahydrofolate ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B7HP29 0.0 668 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain AH187)
Q739F4 0.0 668 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7IUA4 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain G9842)
B7JLG8 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain AH820)
Q81RE1 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus anthracis
C3LKJ6 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P858 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus anthracis (strain A0248)
Q81E87 0.0 667 58 0 556 3 fhs Formate--tetrahydrofolate ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P13419 0.0 664 59 0 556 3 fhs Formate--tetrahydrofolate ligase Clostridium acidurici
Q67JH9 0.0 659 58 2 557 3 fhs Formate--tetrahydrofolate ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B2A3Q6 0.0 658 57 0 556 3 fhs Formate--tetrahydrofolate ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B3GX43 0.0 657 59 2 557 3 fhs Formate--tetrahydrofolate ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZI4 0.0 657 59 2 557 3 fhs Formate--tetrahydrofolate ligase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A8FEC9 0.0 655 57 0 554 3 fhs Formate--tetrahydrofolate ligase Bacillus pumilus (strain SAFR-032)
Q8Y624 0.0 654 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92AD2 0.0 653 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AJY2 0.0 651 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B8DDM6 0.0 650 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria monocytogenes serotype 4a (strain HCC23)
Q7VLW6 0.0 650 58 2 557 3 fhs Formate--tetrahydrofolate ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A5WI04 0.0 650 58 5 565 3 fhs Formate--tetrahydrofolate ligase Psychrobacter sp. (strain PRwf-1)
Q71YD9 0.0 650 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria monocytogenes serotype 4b (strain F2365)
C1KWH6 0.0 650 57 0 556 3 fhs Formate--tetrahydrofolate ligase Listeria monocytogenes serotype 4b (strain CLIP80459)
B2KDK9 0.0 646 57 0 555 3 fhs Formate--tetrahydrofolate ligase Elusimicrobium minutum (strain Pei191)
Q834D6 0.0 646 58 0 556 3 fhs Formate--tetrahydrofolate ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q9JXY2 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVY8 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RP08 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria gonorrhoeae (strain NCCP11945)
A1KS57 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A9M1J1 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria meningitidis serogroup C (strain 053442)
Q5FAG1 0.0 640 58 2 557 3 fhs Formate--tetrahydrofolate ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1B1M8 0.0 639 55 1 556 3 fhs1 Formate--tetrahydrofolate ligase Paracoccus denitrificans (strain Pd 1222)
Q1J4C0 0.0 639 57 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M4 (strain MGAS10750)
C0QX38 0.0 638 57 2 556 3 fhs Formate--tetrahydrofolate ligase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q02ZS7 0.0 638 56 1 556 3 fhs Formate--tetrahydrofolate ligase Lactococcus lactis subsp. cremoris (strain SK11)
A2RLK1 0.0 637 56 1 556 3 fhs Formate--tetrahydrofolate ligase Lactococcus lactis subsp. cremoris (strain MG1363)
Q1JEK4 0.0 636 57 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M2 (strain MGAS10270)
B9J7E8 0.0 635 57 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q99XR2 0.0 635 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M1
Q65IA6 0.0 633 56 0 554 3 fhs Formate--tetrahydrofolate ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A3CL27 0.0 633 56 2 555 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus sanguinis (strain SK36)
P0DF93 0.0 632 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DF92 0.0 632 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q5M4U2 0.0 631 55 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q48QZ2 0.0 631 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RGS2 0.0 631 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1WTW0 0.0 631 56 2 553 3 fhs Formate--tetrahydrofolate ligase Ligilactobacillus salivarius (strain UCC118)
Q5X9K7 0.0 631 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q5M083 0.0 630 55 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus thermophilus (strain CNRZ 1066)
Q9CH07 0.0 630 55 1 556 3 fhs Formate--tetrahydrofolate ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q8NZ49 0.0 629 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q03L41 0.0 629 55 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q59925 0.0 629 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q1JJK1 0.0 628 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1J9F2 0.0 628 56 2 555 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus pyogenes serotype M12 (strain MGAS2096)
B9JZN5 0.0 628 55 0 554 3 fhs Formate--tetrahydrofolate ligase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
P0DF91 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2REC4 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JLK2 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBM0 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5XC12 0.0 628 55 0 556 1 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DF90 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q99ZI9 0.0 628 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M1
C0MFU5 0.0 627 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus equi subsp. zooepidemicus (strain H70)
Q1JGN8 0.0 627 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q48TE8 0.0 627 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
C0M9N3 0.0 627 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus equi subsp. equi (strain 4047)
B4U2T6 0.0 626 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
Q1J6F7 0.0 626 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
B0S0G1 0.0 625 56 4 558 3 fhs Formate--tetrahydrofolate ligase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q8P0X5 0.0 625 55 0 556 3 fhs1 Formate--tetrahydrofolate ligase 1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
B9DS83 0.0 625 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q8CNV9 0.0 625 55 3 555 3 fhs Formate--tetrahydrofolate ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNH4 0.0 625 55 3 555 3 fhs Formate--tetrahydrofolate ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A6UBV0 0.0 625 56 0 556 3 fhs Formate--tetrahydrofolate ligase Sinorhizobium medicae (strain WSM419)
Q38X32 0.0 625 56 2 557 3 fhs Formate--tetrahydrofolate ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q0APT3 0.0 624 55 0 556 3 fhs Formate--tetrahydrofolate ligase Maricaulis maris (strain MCS10)
Q4L776 0.0 622 55 4 557 3 fhs Formate--tetrahydrofolate ligase Staphylococcus haemolyticus (strain JCSC1435)
B3PV59 0.0 622 56 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium etli (strain CIAT 652)
Q11G79 0.0 621 56 0 556 3 fhs Formate--tetrahydrofolate ligase Chelativorans sp. (strain BNC1)
C1CKW9 0.0 620 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain P1031)
B2IPQ3 0.0 620 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain CGSP14)
C1C7J4 0.0 620 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain 70585)
Q8NW37 0.0 620 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain MW2)
Q6G8J5 0.0 620 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain MSSA476)
Q6GFX6 0.0 620 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain MRSA252)
Q2G296 0.0 620 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
C1CEI6 0.0 619 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain JJA)
B1IC26 0.0 619 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain Hungary19A-6)
Q92N42 0.0 619 56 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium meliloti (strain 1021)
Q2K5P2 0.0 619 55 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
C1CR74 0.0 619 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain Taiwan19F-14)
Q8DPL5 0.0 619 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZJQ0 0.0 619 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B5E4W4 0.0 619 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae serotype 19F (strain G54)
Q04K90 0.0 619 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q2YTF6 0.0 619 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q1MDG4 0.0 619 55 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A4VU67 0.0 619 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus suis (strain 05ZYH33)
A4W0G0 0.0 619 54 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus suis (strain 98HAH33)
A3CN49 0.0 619 54 0 556 3 fhs2 Formate--tetrahydrofolate ligase 2 Streptococcus sanguinis (strain SK36)
A8Z2Q0 0.0 618 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHR5 0.0 618 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain Newman)
Q2FG06 0.0 618 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain USA300)
Q97QI2 0.0 618 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A8LIR1 0.0 617 55 0 554 3 fhs Formate--tetrahydrofolate ligase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q5HF42 0.0 617 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain COL)
Q160C2 0.0 616 56 0 555 3 fhs Formate--tetrahydrofolate ligase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
B5ZYA2 0.0 616 55 0 556 3 fhs Formate--tetrahydrofolate ligase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q7A535 0.0 615 54 4 556 1 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain N315)
Q99TD2 0.0 615 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITQ4 0.0 615 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain JH9)
A6U2J8 0.0 615 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain JH1)
A7X3G5 0.0 615 54 4 556 3 fhs Formate--tetrahydrofolate ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8E5E3 0.0 613 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus agalactiae serotype III (strain NEM316)
Q98HQ4 0.0 613 55 0 556 3 fhs Formate--tetrahydrofolate ligase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0BW57 0.0 613 55 1 556 3 fhs Formate--tetrahydrofolate ligase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
A9IM41 0.0 613 55 0 554 3 fhs Formate--tetrahydrofolate ligase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q3K138 0.0 612 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8DZP5 0.0 611 53 0 556 3 fhs Formate--tetrahydrofolate ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q03FM6 0.0 610 56 1 554 3 fhs Formate--tetrahydrofolate ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A5G276 0.0 610 55 1 557 3 fhs Formate--tetrahydrofolate ligase Acidiphilium cryptum (strain JF-5)
Q4FL49 0.0 608 54 1 558 3 fhs Formate--tetrahydrofolate ligase Pelagibacter ubique (strain HTCC1062)
O66164 0.0 608 55 0 554 3 fhs Formate--tetrahydrofolate ligase Sphingobium sp. (strain NBRC 103272 / SYK-6)
C3MFQ8 0.0 607 56 0 556 3 fhs Formate--tetrahydrofolate ligase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B2IC30 0.0 605 56 2 557 3 fhs Formate--tetrahydrofolate ligase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
B9DN77 0.0 605 54 3 555 3 fhs Formate--tetrahydrofolate ligase Staphylococcus carnosus (strain TM300)
B2GF64 0.0 604 55 2 556 3 fhs Formate--tetrahydrofolate ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q28TR4 0.0 602 54 0 555 3 fhs Formate--tetrahydrofolate ligase Jannaschia sp. (strain CCS1)
Q8RHF4 0.0 601 53 4 555 3 fhs Formate--tetrahydrofolate ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q5LNV0 0.0 600 54 0 555 3 fhs1 Formate--tetrahydrofolate ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q605Q9 0.0 600 54 4 557 3 fhs Formate--tetrahydrofolate ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q038Y4 0.0 598 55 2 557 3 fhs Formate--tetrahydrofolate ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
A7HLZ4 0.0 598 53 2 556 3 fhs Formate--tetrahydrofolate ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
B0UQF5 0.0 597 53 2 558 3 fhs Formate--tetrahydrofolate ligase Methylobacterium sp. (strain 4-46)
B2G5A9 0.0 597 54 3 555 3 fhs Formate--tetrahydrofolate ligase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHS9 0.0 597 54 3 555 3 fhs Formate--tetrahydrofolate ligase Limosilactobacillus reuteri (strain DSM 20016)
A6LJS5 0.0 597 54 3 555 3 fhs Formate--tetrahydrofolate ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
B3WEG3 0.0 597 55 2 557 3 fhs Formate--tetrahydrofolate ligase Lacticaseibacillus casei (strain BL23)
A8Z6G1 0.0 595 54 4 556 3 fhs Formate--tetrahydrofolate ligase Campylobacter concisus (strain 13826)
A4WQ11 0.0 595 55 1 556 3 fhs Formate--tetrahydrofolate ligase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
A7GZZ0 0.0 595 55 6 559 3 fhs Formate--tetrahydrofolate ligase Campylobacter curvus (strain 525.92)
Q1GE26 0.0 595 55 0 555 3 fhs Formate--tetrahydrofolate ligase Ruegeria sp. (strain TM1040)
Q1GZ16 0.0 595 52 1 557 3 fhs Formate--tetrahydrofolate ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q0BX04 0.0 594 53 0 555 3 fhs Formate--tetrahydrofolate ligase Hyphomonas neptunium (strain ATCC 15444)
A4J0S6 0.0 593 52 3 563 3 fhs Formate--tetrahydrofolate ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q3J047 0.0 592 54 1 556 3 fhs Formate--tetrahydrofolate ligase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PM52 0.0 592 54 1 556 3 fhs Formate--tetrahydrofolate ligase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
B1MY45 0.0 592 55 3 557 3 fhs Formate--tetrahydrofolate ligase Leuconostoc citreum (strain KM20)
Q88W76 0.0 592 55 2 553 3 fhs Formate--tetrahydrofolate ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B9KLK4 0.0 591 54 2 557 3 fhs Formate--tetrahydrofolate ligase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B8EKB9 0.0 591 53 2 558 3 fhs Formate--tetrahydrofolate ligase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q03YB1 0.0 589 54 2 556 3 fhs Formate--tetrahydrofolate ligase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B8IBS4 0.0 587 54 2 558 3 fhs Formate--tetrahydrofolate ligase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B7IG29 0.0 585 52 2 555 3 fhs Formate--tetrahydrofolate ligase Thermosipho africanus (strain TCF52B)
A2SKX8 0.0 585 52 3 561 3 fhs Formate--tetrahydrofolate ligase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A9WMW3 0.0 585 52 5 560 3 fhs Formate--tetrahydrofolate ligase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A8F7D5 0.0 585 51 2 556 3 fhs Formate--tetrahydrofolate ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q5NQC7 0.0 584 55 2 558 3 fhs Formate--tetrahydrofolate ligase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q03S45 0.0 584 54 2 553 3 fhs Formate--tetrahydrofolate ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A4XIU2 0.0 584 53 3 553 3 fhs Formate--tetrahydrofolate ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A0JZ10 0.0 583 54 4 560 3 fhs Formate--tetrahydrofolate ligase Arthrobacter sp. (strain FB24)
B1ZJ88 0.0 581 53 1 557 3 fhs Formate--tetrahydrofolate ligase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B1M0D1 0.0 578 53 1 557 3 fhs Formate--tetrahydrofolate ligase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B7L0A5 0.0 576 53 1 557 1 fhs Formate--tetrahydrofolate ligase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
A9VZT0 0.0 576 53 1 557 3 fhs Formate--tetrahydrofolate ligase Methylorubrum extorquens (strain PA1)
Q83WS0 0.0 575 53 1 557 1 fhs Formate--tetrahydrofolate ligase Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
Q5FIU5 0.0 574 52 2 556 3 fhs2 Formate--tetrahydrofolate ligase 2 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A1R8N9 0.0 569 53 1 555 3 fhs Formate--tetrahydrofolate ligase Paenarthrobacter aurescens (strain TC1)
B1LAQ7 0.0 568 52 1 541 3 fhs Formate--tetrahydrofolate ligase Thermotoga sp. (strain RQ2)
A5ILJ8 0.0 568 52 1 541 3 fhs Formate--tetrahydrofolate ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A6LAR6 0.0 567 51 4 557 3 fhs Formate--tetrahydrofolate ligase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q6NH87 0.0 567 52 3 556 3 fhs Formate--tetrahydrofolate ligase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
B9MM59 0.0 566 52 1 538 3 fhs Formate--tetrahydrofolate ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q64U80 0.0 566 49 3 556 3 fhs Formate--tetrahydrofolate ligase Bacteroides fragilis (strain YCH46)
Q5LD60 0.0 566 49 3 556 3 fhs Formate--tetrahydrofolate ligase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
C5CI89 0.0 565 51 0 556 3 fhs Formate--tetrahydrofolate ligase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q9X287 0.0 563 52 1 541 1 fhs Formate--tetrahydrofolate ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q5V5Y2 0.0 561 51 6 554 3 fhs Formate--tetrahydrofolate ligase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q8A9S8 0.0 559 48 3 556 3 fhs Formate--tetrahydrofolate ligase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A9BIV8 0.0 557 50 2 555 3 fhs Formate--tetrahydrofolate ligase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q18JB5 0.0 554 50 5 563 3 fhs Formate--tetrahydrofolate ligase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q1AXZ4 0.0 554 49 3 571 3 fhs1 Formate--tetrahydrofolate ligase 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AT39 0.0 553 49 3 573 3 fhs3 Formate--tetrahydrofolate ligase 3 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q1AVP8 0.0 552 49 3 571 3 fhs2 Formate--tetrahydrofolate ligase 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A6L4P0 0.0 551 49 4 558 3 fhs Formate--tetrahydrofolate ligase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q73RR6 0.0 549 51 6 558 3 fhs Formate--tetrahydrofolate ligase Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q4JVW2 0.0 547 49 3 561 3 fhs Formate--tetrahydrofolate ligase Corynebacterium jeikeium (strain K411)
Q2LU82 0.0 544 50 0 543 3 fhs Formate--tetrahydrofolate ligase Syntrophus aciditrophicus (strain SB)
A5UPV2 0.0 541 49 4 564 3 fhs Formate--tetrahydrofolate ligase Roseiflexus sp. (strain RS-1)
A7NGQ9 0.0 540 49 5 565 3 fhs Formate--tetrahydrofolate ligase Roseiflexus castenholzii (strain DSM 13941 / HLO8)
Q74JC1 0.0 540 51 3 558 3 fhs Formate--tetrahydrofolate ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q7MUZ8 0.0 537 50 3 556 3 fhs Formate--tetrahydrofolate ligase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A1SQH3 0.0 536 51 3 558 3 fhs Formate--tetrahydrofolate ligase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A4FL80 0.0 535 49 2 563 3 fhs Formate--tetrahydrofolate ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q043I0 0.0 534 50 4 561 3 fhs Formate--tetrahydrofolate ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q04FS6 0.0 531 50 4 556 3 fhs Formate--tetrahydrofolate ligase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q72GY9 0.0 523 50 4 544 3 fhs Formate--tetrahydrofolate ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q6ABS5 4.47e-179 519 47 2 564 3 fhs Formate--tetrahydrofolate ligase Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q1GA94 1.96e-178 518 48 3 561 3 fhs Formate--tetrahydrofolate ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5FJY2 2.09e-178 517 50 4 559 3 fhs1 Formate--tetrahydrofolate ligase 1 Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q04AM0 2.8e-178 517 48 3 561 3 fhs Formate--tetrahydrofolate ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1DFW5 3.85e-178 516 47 3 547 3 fhs Formate--tetrahydrofolate ligase Myxococcus xanthus (strain DK1622)
B9LKW0 7.08e-177 514 47 5 576 3 fhs Formate--tetrahydrofolate ligase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WIW3 7.08e-177 514 47 5 576 3 fhs Formate--tetrahydrofolate ligase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
A9B4H8 7.8e-177 514 46 5 575 3 fhs Formate--tetrahydrofolate ligase Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q9HI67 1.57e-176 512 49 4 541 3 fhs Formate--tetrahydrofolate ligase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B8GC03 2.39e-176 513 47 5 572 3 fhs Formate--tetrahydrofolate ligase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q97CL3 8.4e-175 507 49 4 541 3 fhs Formate--tetrahydrofolate ligase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
A4SPE5 7.67e-171 499 48 5 580 3 fhs Formate--tetrahydrofolate ligase Aeromonas salmonicida (strain A449)
B5FG96 4.61e-167 489 46 6 582 3 fhs Formate--tetrahydrofolate ligase Aliivibrio fischeri (strain MJ11)
Q5E3V8 2.35e-166 488 46 6 582 3 fhs Formate--tetrahydrofolate ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KIN9 2.56e-164 482 48 6 577 3 fhs Formate--tetrahydrofolate ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9KLX7 9.3e-164 481 45 7 582 3 fhs Formate--tetrahydrofolate ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6KZM3 1.22e-163 479 45 3 540 3 fhs Formate--tetrahydrofolate ligase Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q7MEE8 2.58e-163 480 46 8 583 3 fhs Formate--tetrahydrofolate ligase Vibrio vulnificus (strain YJ016)
A7N5E9 7.4e-163 479 44 6 586 3 fhs Formate--tetrahydrofolate ligase Vibrio campbellii (strain ATCC BAA-1116)
Q8D7D8 1.17e-162 478 46 8 583 3 fhs Formate--tetrahydrofolate ligase Vibrio vulnificus (strain CMCP6)
B0TVP3 3.49e-162 476 45 6 574 3 fhs Formate--tetrahydrofolate ligase Shewanella halifaxensis (strain HAW-EB4)
A8H8Z4 1.6e-161 475 45 5 571 3 fhs Formate--tetrahydrofolate ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QA17 4.2e-161 473 44 6 571 3 fhs Formate--tetrahydrofolate ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A3CZY6 2.95e-160 472 43 8 589 3 fhs Formate--tetrahydrofolate ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B1KJC0 6.33e-160 471 43 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella woodyi (strain ATCC 51908 / MS32)
A6WSY9 3.58e-159 469 42 6 588 3 fhs Formate--tetrahydrofolate ligase Shewanella baltica (strain OS185)
B8ECE1 7.17e-159 468 43 8 584 3 fhs Formate--tetrahydrofolate ligase Shewanella baltica (strain OS223)
A4YAP3 4.12e-158 466 42 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q3ZX40 4.17e-158 467 43 8 582 3 fhs Formate--tetrahydrofolate ligase Dehalococcoides mccartyi (strain CBDB1)
A9L3Z6 1.13e-157 466 42 8 589 3 fhs Formate--tetrahydrofolate ligase Shewanella baltica (strain OS195)
A1JMA3 1.19e-157 465 47 7 571 3 fhs Formate--tetrahydrofolate ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7VSJ2 1.27e-157 465 42 7 582 3 fhs Formate--tetrahydrofolate ligase Vibrio atlanticus (strain LGP32)
A8FQV1 2.72e-157 464 42 5 571 3 fhs Formate--tetrahydrofolate ligase Shewanella sediminis (strain HAW-EB3)
A1RFN3 8.88e-157 462 42 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella sp. (strain W3-18-1)
Q3Z8K3 8.27e-156 461 42 8 582 3 fhs1 Formate--tetrahydrofolate ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q8EJA7 1.28e-155 459 42 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q27772 1.83e-155 471 42 8 619 2 None C-1-tetrahydrofolate synthase, cytoplasmic Spodoptera frugiperda
O96553 6.92e-155 471 42 8 620 2 pug C-1-tetrahydrofolate synthase, cytoplasmic Drosophila melanogaster
Q87HX2 9.16e-155 458 43 7 588 3 fhs Formate--tetrahydrofolate ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q0HMS6 1.48e-154 457 42 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella sp. (strain MR-4)
Q6LNJ0 3.29e-154 456 45 7 584 3 fhs Formate--tetrahydrofolate ligase Photobacterium profundum (strain SS9)
Q0HR05 3.35e-154 456 42 7 573 3 fhs Formate--tetrahydrofolate ligase Shewanella sp. (strain MR-7)
Q8WZJ7 2.78e-153 466 42 4 625 3 SPBC839.16 C-1-tetrahydrofolate synthase, cytoplasmic Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A0KSN0 6.89e-153 452 42 6 573 3 fhs Formate--tetrahydrofolate ligase Shewanella sp. (strain ANA-3)
C0QAX9 3.53e-152 452 41 10 584 3 fhs Formate--tetrahydrofolate ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
A9NE95 1.18e-151 448 45 4 531 3 fhs Formate--tetrahydrofolate ligase Acholeplasma laidlawii (strain PG-8A)
B8CI99 6.97e-151 447 42 5 555 3 fhs Formate--tetrahydrofolate ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
B6EIJ9 7.26e-151 447 43 6 584 3 fhs Formate--tetrahydrofolate ligase Aliivibrio salmonicida (strain LFI1238)
Q9SPK5 9.69e-151 449 41 10 619 2 THFS Formate--tetrahydrofolate ligase Arabidopsis thaliana
P28723 6.47e-150 447 41 8 610 1 None Formate--tetrahydrofolate ligase Spinacia oleracea
Q3V3R1 2.31e-149 456 43 8 619 1 Mthfd1l Monofunctional C1-tetrahydrofolate synthase, mitochondrial Mus musculus
B5YJE1 2.09e-148 442 41 7 567 3 fhs Formate--tetrahydrofolate ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P11586 3.47e-148 452 42 9 620 1 MTHFD1 C-1-tetrahydrofolate synthase, cytoplasmic Homo sapiens
O43007 4.1e-148 453 41 9 630 3 ade9 C-1-tetrahydrofolate synthase, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q5R8P0 2.02e-146 448 42 9 620 2 MTHFD1 C-1-tetrahydrofolate synthase, cytoplasmic Pongo abelii
A1SAE2 2.16e-146 436 43 10 573 3 fhs Formate--tetrahydrofolate ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
P27653 2.25e-146 447 41 9 620 1 Mthfd1 C-1-tetrahydrofolate synthase, cytoplasmic Rattus norvegicus
Q0VCR7 5e-146 448 41 8 619 2 MTHFD1L Monofunctional C1-tetrahydrofolate synthase, mitochondrial Bos taurus
P09440 5.45e-146 448 40 7 631 1 MIS1 C-1-tetrahydrofolate synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6UB35 1.09e-145 447 42 7 619 1 MTHFD1L Monofunctional C1-tetrahydrofolate synthase, mitochondrial Homo sapiens
Q1MPZ9 3.5e-145 434 41 10 584 3 fhs Formate--tetrahydrofolate ligase Lawsonia intracellularis (strain PHE/MN1-00)
Q6AL19 4.63e-143 427 41 9 558 3 fhs Formate--tetrahydrofolate ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
P07245 4.06e-142 437 41 9 627 1 ADE3 C-1-tetrahydrofolate synthase, cytoplasmic Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q922D8 3.01e-141 434 41 9 620 1 Mthfd1 C-1-tetrahydrofolate synthase, cytoplasmic Mus musculus
B8J0C2 1.84e-140 422 39 8 580 3 fhs Formate--tetrahydrofolate ligase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A0LLR3 1.04e-128 391 38 5 537 3 fhs Formate--tetrahydrofolate ligase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q9PQS1 2.56e-125 380 41 8 529 3 fhs Formate--tetrahydrofolate ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
A8ZZJ0 6.66e-123 376 37 8 580 3 fhs Formate--tetrahydrofolate ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B8FGU7 1.77e-118 365 38 8 580 3 fhs Formate--tetrahydrofolate ligase Desulfatibacillum aliphaticivorans
Q8EUQ1 1.36e-107 335 36 12 538 3 fhs Formate--tetrahydrofolate ligase Malacoplasma penetrans (strain HF-2)
Q8G700 5.58e-39 152 26 17 505 3 fhs Formate--tetrahydrofolate ligase Bifidobacterium longum (strain NCC 2705)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03295
Feature type CDS
Gene -
Product formate--tetrahydrofolate ligase
Location 727559 - 729229 (strand: -1)
Length 1671 (nucleotides) / 556 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_4363
Orthogroup size 1
N. genomes 1

Actions

Genomic region

Domains

PF01268 Formate--tetrahydrofolate ligase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2759 Nucleotide transport and metabolism (F) F Formyltetrahydrofolate synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MKSDIEISHQAPLLPIQDIAKKINVDQDDIEFYGKYKAKFSQSIWSKITSKKQGKLVLVTSINPTPAGEGKTTVTVGLGQALNQLGKSAIIALREPSLGPCFGLKGGAAGGGYSQVVPMEDLNLHFTGDFHAITSANNLLAAMLDNSLYQGNPLNINPKKIIFKRCMDMNDRALRHLVIGLGGDKDGVVREDSFVITVASEIMSILCLAKDINDLKQRLARIIVAYNYEGEPVSAEDLNAVGAMATLLKDALNPNLVQTLENTPAIIHGGPFANIAHGCNSLRATKLALQLADITVTEAGFGADLGAEKFFDIKCRIGDLQPDCAVLVVTTKALKYNGGLGKTQWDHENLTALATGIENLGKHIENLKKYGVPVIVTVNAYVTDSAKEHEFIAQYCQQRGCRFAISQVWEKGGAGGIELANQVIDTLENDAPQFQLLYPDNMPLKQKIETIAQEIYGAKGVTYNANAQEMLTKIEDMGFGHFPICMAKTQYSLSDDPALLGRPTDFTINIREVYVSAGAGFVVSLTGTINTMPGLPKKPAAMAMDVDDHGAIKGLF

Flanking regions ( +/- flanking 50bp)

TGATGCATTATCACTCATGTAGCTCTACACGGGATAAAAAGAGAACCAAAATGAAATCAGATATTGAAATTTCCCATCAAGCACCGCTTTTACCCATCCAAGATATTGCTAAAAAAATAAATGTAGACCAAGACGATATTGAATTTTATGGCAAATACAAAGCCAAGTTTAGCCAGAGTATTTGGTCAAAAATCACCTCAAAAAAACAGGGTAAATTGGTGCTTGTCACTTCCATTAATCCCACACCAGCAGGTGAAGGTAAAACCACCGTTACGGTAGGATTAGGACAAGCCCTTAATCAATTAGGCAAAAGTGCCATTATTGCATTACGCGAACCCTCCTTAGGCCCTTGTTTTGGTCTAAAAGGAGGAGCGGCTGGCGGTGGATATTCACAAGTTGTACCGATGGAAGATCTCAATCTTCATTTTACCGGTGATTTTCATGCTATCACCTCTGCAAATAATTTATTAGCAGCGATGTTAGATAACTCGCTTTATCAAGGTAATCCCCTTAACATTAATCCTAAAAAGATTATTTTTAAGCGCTGTATGGATATGAATGATCGCGCACTACGTCATTTAGTGATTGGATTAGGTGGCGACAAAGATGGGGTGGTTAGAGAAGATAGCTTTGTTATCACCGTTGCTAGCGAAATTATGTCTATCCTTTGTTTAGCAAAAGATATTAATGATTTAAAACAGCGCTTAGCACGTATCATCGTTGCATATAACTATGAAGGCGAGCCTGTTAGTGCTGAAGATCTCAACGCTGTCGGCGCTATGGCAACTTTACTTAAAGATGCCCTTAATCCTAATTTAGTACAAACGTTAGAAAATACCCCCGCGATTATTCATGGTGGCCCTTTTGCCAACATTGCCCATGGCTGTAATAGCCTAAGAGCGACTAAACTTGCTCTTCAACTGGCTGATATCACTGTAACAGAAGCGGGATTTGGTGCTGATCTAGGTGCGGAAAAATTCTTTGATATCAAATGTCGCATAGGCGACTTACAACCAGACTGTGCAGTTTTAGTCGTTACCACTAAGGCATTAAAATATAATGGTGGCTTAGGCAAAACACAGTGGGATCACGAAAATCTCACCGCTTTAGCAACGGGGATCGAAAATCTAGGTAAGCATATTGAAAATCTGAAAAAATATGGTGTTCCGGTTATTGTTACAGTAAATGCTTATGTGACAGACTCTGCTAAAGAGCATGAATTTATCGCCCAATATTGCCAGCAAAGAGGATGTCGTTTTGCCATTAGTCAAGTATGGGAAAAAGGTGGCGCGGGTGGTATTGAATTAGCCAATCAGGTTATTGATACACTAGAAAATGATGCACCACAGTTTCAATTACTCTACCCTGATAATATGCCTTTAAAGCAAAAGATAGAGACCATTGCTCAAGAAATTTATGGTGCAAAAGGGGTGACTTACAATGCTAACGCCCAAGAGATGCTAACAAAAATCGAGGATATGGGCTTTGGCCATTTCCCTATTTGTATGGCAAAAACGCAATATTCTCTATCAGATGATCCCGCATTACTTGGTCGCCCGACTGATTTTACCATTAATATCCGGGAAGTGTATGTCAGTGCTGGTGCAGGCTTTGTTGTTTCATTAACGGGCACAATAAATACGATGCCAGGATTACCTAAAAAACCGGCAGCAATGGCGATGGACGTTGATGATCATGGGGCAATAAAAGGACTGTTCTAAGGCACTTAAAACCTACTCAATAAAGAATGCCAGTTAATACTGGCATTCTT