Homologs in group_1486

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09585 FBDBKF_09585 80.1 Morganella morganii S1 moaA GTP 3',8-cyclase MoaA
EHELCC_04385 EHELCC_04385 80.1 Morganella morganii S2 moaA GTP 3',8-cyclase MoaA
NLDBIP_04385 NLDBIP_04385 80.1 Morganella morganii S4 moaA GTP 3',8-cyclase MoaA
LHKJJB_14245 LHKJJB_14245 80.1 Morganella morganii S3 moaA GTP 3',8-cyclase MoaA
HKOGLL_12290 HKOGLL_12290 80.1 Morganella morganii S5 moaA GTP 3',8-cyclase MoaA
F4V73_RS00760 F4V73_RS00760 79.1 Morganella psychrotolerans moaA GTP 3',8-cyclase MoaA

Distribution of the homologs in the orthogroup group_1486

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1486

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N6P6 0.0 538 76 0 326 3 moaA GTP 3',8-cyclase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8ZGW5 0.0 533 77 0 326 3 moaA GTP 3',8-cyclase Yersinia pestis
A6T6M5 0.0 516 74 1 326 3 moaA GTP 3',8-cyclase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A7MJ10 0.0 516 73 1 326 3 moaA GTP 3',8-cyclase Cronobacter sakazakii (strain ATCC BAA-894)
Q32I50 0.0 514 73 1 326 3 moaA GTP 3',8-cyclase Shigella dysenteriae serotype 1 (strain Sd197)
A7ZY37 0.0 514 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O9:H4 (strain HS)
P30745 0.0 513 73 1 326 1 moaA GTP 3',8-cyclase Escherichia coli (strain K12)
B1X7B1 0.0 513 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli (strain K12 / DH10B)
C4ZXV3 0.0 513 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli (strain K12 / MC4100 / BW2952)
Q324B1 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Shigella boydii serotype 4 (strain Sb227)
B1LM72 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli (strain SMS-3-5 / SECEC)
B6I7T6 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli (strain SE11)
P65382 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7M753 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O8 (strain IAI1)
B7MQN5 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O81 (strain ED1a)
B5YRM0 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P65383 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O157:H7
B7LC63 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli (strain 55989 / EAEC)
A7ZJJ0 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O139:H28 (strain E24377A / ETEC)
B5XYW6 0.0 512 73 1 326 3 moaA GTP 3',8-cyclase Klebsiella pneumoniae (strain 342)
B7ULX8 0.0 511 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7NA81 0.0 511 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q3Z403 0.0 511 73 1 326 3 moaA GTP 3',8-cyclase Shigella sonnei (strain Ss046)
B7MGN9 0.0 510 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LJY1 0.0 509 73 1 326 3 moaA GTP 3',8-cyclase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NNL1 0.0 509 73 1 326 3 moaA GTP 3',8-cyclase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B2TVE9 0.0 509 73 1 326 3 moaA GTP 3',8-cyclase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q83S40 0.0 508 73 1 326 3 moaA GTP 3',8-cyclase Shigella flexneri
C5B7H2 0.0 508 72 1 328 3 moaA GTP 3',8-cyclase Edwardsiella ictaluri (strain 93-146)
Q6D3C7 0.0 507 76 1 328 3 moaA GTP 3',8-cyclase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A9MTH7 1.03e-180 505 72 1 326 3 moaA GTP 3',8-cyclase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
C0PWZ0 1.27e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella paratyphi C (strain RKS4594)
P65386 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P65387 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella typhi
B4TQU6 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella schwarzengrund (strain CVM19633)
B5BC24 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella paratyphi A (strain AKU_12601)
Q5PG37 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZK4 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella newport (strain SL254)
B5F079 1.28e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella agona (strain SL483)
B5R769 1.92e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QX73 1.92e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella enteritidis PT4 (strain P125109)
B5FP68 1.92e-180 504 72 1 326 3 moaA GTP 3',8-cyclase Salmonella dublin (strain CT_02021853)
B4TC55 4.28e-180 503 72 1 326 3 moaA GTP 3',8-cyclase Salmonella heidelberg (strain SL476)
Q87MY0 3.99e-163 461 64 1 327 3 moaA GTP 3',8-cyclase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q65TT2 5.94e-162 458 63 1 325 3 moaA GTP 3',8-cyclase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B7VLU4 2.56e-161 456 63 1 327 3 moaA GTP 3',8-cyclase Vibrio atlanticus (strain LGP32)
C3LTS1 2.84e-160 453 64 1 327 3 moaA GTP 3',8-cyclase Vibrio cholerae serotype O1 (strain M66-2)
Q9KT81 2.84e-160 453 64 1 327 3 moaA GTP 3',8-cyclase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2Q5 2.84e-160 453 64 1 327 3 moaA GTP 3',8-cyclase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8D894 2.19e-158 449 62 1 327 3 moaA GTP 3',8-cyclase Vibrio vulnificus (strain CMCP6)
Q7MM75 9.08e-158 447 62 1 327 3 moaA GTP 3',8-cyclase Vibrio vulnificus (strain YJ016)
C4LFK3 1.59e-156 444 62 0 323 3 moaA GTP 3',8-cyclase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
P45311 4.19e-155 440 63 1 325 3 moaA GTP 3',8-cyclase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0BNX2 2.18e-154 439 61 1 327 3 moaA GTP 3',8-cyclase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A5UBK4 2.29e-154 439 62 1 325 3 moaA GTP 3',8-cyclase Haemophilus influenzae (strain PittEE)
B3GXC5 3.45e-154 438 61 1 327 3 moaA GTP 3',8-cyclase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A5UFB4 6.05e-154 437 62 1 325 3 moaA GTP 3',8-cyclase Haemophilus influenzae (strain PittGG)
A3N054 6.58e-154 437 61 1 327 3 moaA GTP 3',8-cyclase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q4QJR9 2.02e-153 436 62 1 325 3 moaA GTP 3',8-cyclase Haemophilus influenzae (strain 86-028NP)
A0KIL8 1.08e-151 432 60 1 331 3 moaA GTP 3',8-cyclase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9CN21 1.67e-150 429 63 1 324 3 moaA GTP 3',8-cyclase Pasteurella multocida (strain Pm70)
A6VPY2 1.61e-148 424 60 1 325 3 moaA GTP 3',8-cyclase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q7VLN1 6.66e-143 410 60 1 324 3 moaA GTP 3',8-cyclase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1SWQ3 1.43e-142 409 58 0 325 3 moaA GTP 3',8-cyclase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q12T28 3.41e-136 392 57 2 327 3 moaA GTP 3',8-cyclase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B4SL67 1.44e-122 357 51 0 326 3 moaA GTP 3',8-cyclase Stenotrophomonas maltophilia (strain R551-3)
B2FUM0 8.18e-122 355 51 0 326 3 moaA GTP 3',8-cyclase Stenotrophomonas maltophilia (strain K279a)
Q56211 1.07e-100 302 45 1 327 3 moaA GTP 3',8-cyclase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5N5F7 1.56e-100 301 45 1 327 3 moaA GTP 3',8-cyclase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9NZB8 3.74e-69 230 40 5 311 1 MOCS1 Molybdenum cofactor biosynthesis protein 1 Homo sapiens
A1U578 1.51e-68 220 37 4 330 3 moaA GTP 3',8-cyclase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
A9BF51 8.24e-68 218 34 3 326 3 moaA GTP 3',8-cyclase Petrotoga mobilis (strain DSM 10674 / SJ95)
Q31JB9 3.75e-67 216 36 4 314 3 moaA GTP 3',8-cyclase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q5RKZ7 7.3e-67 224 40 4 309 1 Mocs1 Molybdenum cofactor biosynthesis protein 1 Mus musculus
A4J6S5 1.44e-66 214 36 3 313 3 moaA GTP 3',8-cyclase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q1JQD7 1.89e-66 223 39 5 311 2 MOCS1 Molybdenum cofactor biosynthesis protein 1 Bos taurus
A6TVF9 2.42e-65 211 36 5 323 3 moaA GTP 3',8-cyclase Alkaliphilus metalliredigens (strain QYMF)
Q39055 5.77e-65 213 37 5 311 1 CNX2 GTP 3',8-cyclase, mitochondrial Arabidopsis thaliana
B0TI16 1.43e-64 209 37 4 328 3 moaA GTP 3',8-cyclase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A8MLW5 4.59e-64 208 36 3 306 3 moaA GTP 3',8-cyclase Alkaliphilus oremlandii (strain OhILAs)
A4XW05 5.01e-64 208 36 3 327 3 moaA GTP 3',8-cyclase Pseudomonas mendocina (strain ymp)
Q20624 2.98e-63 213 38 5 311 3 moc-5 Molybdenum cofactor biosynthesis protein moc-5 Caenorhabditis elegans
C1L1W8 3.88e-63 206 36 3 311 3 moaA GTP 3',8-cyclase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q721B9 4.61e-63 206 36 3 311 3 moaA GTP 3',8-cyclase Listeria monocytogenes serotype 4b (strain F2365)
B1JCW0 7.86e-63 205 36 4 327 3 moaA GTP 3',8-cyclase Pseudomonas putida (strain W619)
Q1I6J5 7.94e-63 205 35 5 334 3 moaA GTP 3',8-cyclase Pseudomonas entomophila (strain L48)
C6C060 8.9e-63 205 35 4 329 3 moaA GTP 3',8-cyclase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q8Y870 1.57e-62 204 35 3 311 3 moaA GTP 3',8-cyclase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8IQF1 1.67e-62 211 37 8 313 2 Mocs1 Molybdenum cofactor biosynthesis protein 1 Drosophila melanogaster
Q1QN98 2.01e-62 204 35 4 331 3 moaA GTP 3',8-cyclase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q21I62 2.51e-62 204 35 2 307 3 moaA GTP 3',8-cyclase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A6U9U3 2.64e-62 204 35 4 331 3 moaA GTP 3',8-cyclase Sinorhizobium medicae (strain WSM419)
Q3ADX8 4.58e-62 203 34 3 325 3 moaA GTP 3',8-cyclase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q9I3K7 5.69e-62 203 34 3 327 3 moaA2 GTP 3',8-cyclase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B5YJ09 6.1e-62 202 37 5 327 3 moaA GTP 3',8-cyclase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q3STB0 3.21e-61 201 34 4 331 3 moaA GTP 3',8-cyclase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
A0AHG0 4.45e-61 201 35 3 311 3 moaA GTP 3',8-cyclase Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q92CY2 5.75e-61 201 35 3 311 3 moaA GTP 3',8-cyclase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q54NM6 6.94e-61 208 35 3 310 3 mocs1 Molybdenum cofactor biosynthesis protein 1 Dictyostelium discoideum
Q88WY1 8.88e-61 200 34 3 317 3 moaA GTP 3',8-cyclase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q98MK6 1.3e-60 199 34 4 330 3 moaA GTP 3',8-cyclase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B8HWW4 1.54e-60 199 38 6 325 3 moaA GTP 3',8-cyclase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B0KST1 2.31e-60 199 35 4 327 3 moaA GTP 3',8-cyclase Pseudomonas putida (strain GB-1)
Q88E69 2.9e-60 199 35 4 329 3 moaA GTP 3',8-cyclase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VQC9 3.08e-60 199 35 4 312 3 moaA GTP 3',8-cyclase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5VZZ2 4.27e-60 198 35 4 329 3 moaA GTP 3',8-cyclase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8G0X4 4.53e-60 198 35 4 312 3 moaA GTP 3',8-cyclase Brucella suis biovar 1 (strain 1330)
B0CLT0 4.53e-60 198 35 4 312 3 moaA GTP 3',8-cyclase Brucella suis (strain ATCC 23445 / NCTC 10510)
A9MAX5 4.53e-60 198 35 4 312 3 moaA GTP 3',8-cyclase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q4ZU05 4.69e-60 198 35 5 328 3 moaA GTP 3',8-cyclase Pseudomonas syringae pv. syringae (strain B728a)
Q48HV8 4.9e-60 198 35 5 328 3 moaA GTP 3',8-cyclase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q8YGY6 6.05e-60 198 35 4 312 3 moaA GTP 3',8-cyclase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RIT4 6.05e-60 198 35 4 312 3 moaA GTP 3',8-cyclase Brucella melitensis biotype 2 (strain ATCC 23457)
Q882V6 7.06e-60 197 36 7 329 3 moaA GTP 3',8-cyclase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q92PB4 1.14e-59 197 38 3 276 3 moaA GTP 3',8-cyclase Rhizobium meliloti (strain 1021)
B1KU20 1.47e-59 196 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain Loch Maree / Type A3)
C1FPG7 2.16e-59 196 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain Kyoto / Type A2)
A5I365 2.16e-59 196 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FUZ6 2.16e-59 196 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain ATCC 19397 / Type A)
Q57DG3 4.22e-59 196 34 4 312 3 moaA GTP 3',8-cyclase Brucella abortus biovar 1 (strain 9-941)
Q2YNT7 4.22e-59 196 34 4 312 3 moaA GTP 3',8-cyclase Brucella abortus (strain 2308)
B2S5I1 4.22e-59 196 34 4 312 3 moaA GTP 3',8-cyclase Brucella abortus (strain S19)
Q89NT2 5.01e-59 196 34 5 310 3 moaA GTP 3',8-cyclase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A7GEQ5 9.23e-59 194 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q93KD1 1.54e-58 194 33 4 316 3 moaA GTP 3',8-cyclase Peptoclostridium acidaminophilum
Q139F2 1.93e-58 194 34 2 310 3 moaA GTP 3',8-cyclase Rhodopseudomonas palustris (strain BisB5)
Q0AVU6 2.59e-58 193 34 3 313 3 moaA GTP 3',8-cyclase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q44118 2.59e-58 194 37 7 343 1 moaA GTP 3',8-cyclase Paenarthrobacter nicotinovorans
Q2RGL2 3.02e-58 193 34 3 310 3 moaA GTP 3',8-cyclase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A0L7R4 3.85e-58 193 35 3 317 3 moaA GTP 3',8-cyclase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
C3KXJ8 4.02e-58 192 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain 657 / Type Ba4)
B1IN35 6.45e-58 192 32 5 325 3 moaA GTP 3',8-cyclase Clostridium botulinum (strain Okra / Type B1)
Q2K7L4 8.66e-58 192 37 3 275 3 moaA GTP 3',8-cyclase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
B2GCN4 1.11e-57 192 36 3 300 3 moaA GTP 3',8-cyclase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q8UER0 3.39e-57 191 33 4 330 3 moaA GTP 3',8-cyclase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9HXD6 3.69e-57 191 36 2 287 3 moaA1 GTP 3',8-cyclase 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q65DY5 9.09e-57 190 35 9 340 3 moaA GTP 3',8-cyclase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q747W9 1.03e-56 189 36 4 301 3 moaA GTP 3',8-cyclase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B5ZRM8 1.14e-56 190 36 3 275 3 moaA GTP 3',8-cyclase Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A0RMJ2 1.23e-56 189 37 4 282 3 moaA GTP 3',8-cyclase Campylobacter fetus subsp. fetus (strain 82-40)
Q9WX96 2.25e-56 188 34 6 309 3 moaA GTP 3',8-cyclase Clostridium perfringens (strain 13 / Type A)
Q7NCF5 3.46e-56 188 36 6 321 3 moaA GTP 3',8-cyclase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3KAS8 3.76e-56 188 33 4 327 3 moaA GTP 3',8-cyclase Pseudomonas fluorescens (strain Pf0-1)
Q3V7S1 4.09e-56 188 33 6 333 3 moaA GTP 3',8-cyclase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q0SS32 4.33e-56 187 34 6 309 3 moaA GTP 3',8-cyclase Clostridium perfringens (strain SM101 / Type A)
Q2JI46 7.33e-56 187 36 3 300 3 moaA GTP 3',8-cyclase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q0TPG6 8.69e-56 187 34 6 309 3 moaA GTP 3',8-cyclase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q97HL8 1.09e-55 186 30 4 311 3 moaA GTP 3',8-cyclase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q3MC34 1.39e-55 186 35 5 324 3 moaA GTP 3',8-cyclase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQG6 1.72e-55 186 35 5 324 3 moaA GTP 3',8-cyclase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q9ZIM6 2.02e-55 186 34 8 312 3 moaA GTP 3',8-cyclase Staphylococcus carnosus (strain TM300)
B3PQ08 2.21e-55 186 36 3 275 3 moaA GTP 3',8-cyclase Rhizobium etli (strain CIAT 652)
B2J1M7 2.67e-55 186 35 5 324 3 moaA GTP 3',8-cyclase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B3QCQ7 3.47e-55 186 33 6 333 3 moaA GTP 3',8-cyclase Rhodopseudomonas palustris (strain TIE-1)
A1B4A2 5.5e-55 185 34 4 310 3 moaA GTP 3',8-cyclase Paracoccus denitrificans (strain Pd 1222)
A5CYZ0 6.87e-55 184 34 3 311 3 moaA GTP 3',8-cyclase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A8LIR8 1.12e-54 184 34 8 337 3 moaA GTP 3',8-cyclase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
A7Z9P0 1.3e-54 184 35 9 338 3 moaA GTP 3',8-cyclase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q5HX04 1.68e-54 183 34 6 283 3 moaA GTP 3',8-cyclase Campylobacter jejuni (strain RM1221)
A1VXP5 2.15e-54 183 34 6 283 3 moaA GTP 3',8-cyclase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q9PIW6 2.15e-54 183 34 6 283 3 moaA GTP 3',8-cyclase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A8FJX0 2.15e-54 183 34 6 283 3 moaA GTP 3',8-cyclase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q7UT69 4.82e-54 183 35 7 320 3 moaA GTP 3',8-cyclase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C3LA56 5.98e-54 182 33 9 339 3 moaA GTP 3',8-cyclase Bacillus anthracis (strain CDC 684 / NRRL 3495)
A7H1N9 7.68e-54 182 34 6 283 3 moaA GTP 3',8-cyclase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A6Q5D0 8.1e-54 182 37 6 283 3 moaA GTP 3',8-cyclase Nitratiruptor sp. (strain SB155-2)
B0CDZ6 9.05e-54 182 34 4 326 3 moaA GTP 3',8-cyclase Acaryochloris marina (strain MBIC 11017)
Q9K9W9 1.22e-53 182 35 9 320 3 moaA GTP 3',8-cyclase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q931G4 1.53e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X5J1 1.53e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GEG6 1.65e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain MRSA252)
P65389 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain MW2)
A8Z366 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G754 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain MSSA476)
P65388 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain N315)
A6QJA8 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain Newman)
Q5HDT9 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain COL)
A5IV50 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain JH9)
P69848 1.78e-53 181 35 9 314 1 moaA GTP 3',8-cyclase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FEM4 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain USA300)
A6U3Z2 1.78e-53 181 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain JH1)
Q119N9 3.7e-53 180 35 6 323 3 moaA GTP 3',8-cyclase Trichodesmium erythraeum (strain IMS101)
C0Z9B3 4.2e-53 180 34 11 331 3 moaA GTP 3',8-cyclase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B0JNC2 4.31e-53 180 35 7 328 3 moaA GTP 3',8-cyclase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B1XLR4 5.17e-53 180 34 6 329 3 moaA GTP 3',8-cyclase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q2YYS8 1.24e-52 179 35 9 314 3 moaA GTP 3',8-cyclase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NR60 1.27e-52 180 35 9 339 3 moaA GTP 3',8-cyclase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A0LVG0 1.64e-52 179 35 7 305 3 moaA GTP 3',8-cyclase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A4QDF8 2.23e-52 179 35 9 339 3 moaA GTP 3',8-cyclase Corynebacterium glutamicum (strain R)
A6Q6R2 3.52e-52 177 34 4 294 3 moaA GTP 3',8-cyclase Sulfurovum sp. (strain NBC37-1)
B9L851 3.69e-52 177 34 5 291 3 moaA GTP 3',8-cyclase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
A8ERS0 3.82e-52 177 33 10 318 3 moaA GTP 3',8-cyclase Aliarcobacter butzleri (strain RM4018)
Q8PNH1 1.5e-51 176 35 3 287 3 moaA GTP 3',8-cyclase Xanthomonas axonopodis pv. citri (strain 306)
Q4L8D2 1.77e-51 176 35 6 285 3 moaA GTP 3',8-cyclase Staphylococcus haemolyticus (strain JCSC1435)
Q8Y0K4 4.32e-51 175 35 10 345 3 moaA GTP 3',8-cyclase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9AC48 6.72e-51 175 33 8 332 3 moaA GTP 3',8-cyclase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B7JWW6 7.18e-51 174 33 6 334 3 moaA GTP 3',8-cyclase Rippkaea orientalis (strain PCC 8801 / RF-1)
B1X0G3 8.01e-51 174 33 8 333 3 moaA GTP 3',8-cyclase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B0RTE0 1.07e-50 174 35 4 299 3 moaA GTP 3',8-cyclase Xanthomonas campestris pv. campestris (strain B100)
A7GWA5 1.55e-50 173 35 5 285 3 moaA GTP 3',8-cyclase Campylobacter curvus (strain 525.92)
O67929 1.82e-50 173 37 6 283 3 moaA GTP 3',8-cyclase Aquifex aeolicus (strain VF5)
Q2NCE3 1.84e-50 173 33 3 330 3 moaA GTP 3',8-cyclase Erythrobacter litoralis (strain HTCC2594)
A7GU01 2.23e-50 173 34 6 318 3 moaA GTP 3',8-cyclase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q8CNE6 2.35e-50 173 33 9 312 3 moaA GTP 3',8-cyclase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLY1 2.35e-50 173 33 9 312 3 moaA GTP 3',8-cyclase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8PBX1 9.06e-50 172 35 4 299 3 moaA GTP 3',8-cyclase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4URN0 9.06e-50 172 35 4 299 3 moaA GTP 3',8-cyclase Xanthomonas campestris pv. campestris (strain 8004)
Q30P92 1.37e-49 171 35 9 288 3 moaA GTP 3',8-cyclase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q9ZL75 3.58e-49 169 30 9 320 3 moaA GTP 3',8-cyclase Helicobacter pylori (strain J99 / ATCC 700824)
Q9RJ47 7.59e-49 169 33 8 334 3 moaA GTP 3',8-cyclase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P39757 8.9e-49 169 34 9 343 3 moaA GTP 3',8-cyclase Bacillus subtilis (strain 168)
P59038 1.8e-48 168 29 4 324 3 moaA GTP 3',8-cyclase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A7ZB87 3.59e-48 167 33 5 286 3 moaA GTP 3',8-cyclase Campylobacter concisus (strain 13826)
B6JM01 6.91e-48 166 30 8 317 3 moaA GTP 3',8-cyclase Helicobacter pylori (strain P12)
P62589 7.62e-48 167 32 4 301 3 moaA3 GTP 3',8-cyclase 3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P62588 7.62e-48 167 32 4 301 3 moaA3 GTP 3',8-cyclase 3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1CTA2 8.92e-48 166 29 7 317 3 moaA GTP 3',8-cyclase Helicobacter pylori (strain HPAG1)
Q55369 1.27e-47 166 31 5 314 3 moaA GTP 3',8-cyclase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P56414 4.45e-47 164 29 10 319 3 moaA GTP 3',8-cyclase Helicobacter pylori (strain ATCC 700392 / 26695)
B9KDV3 5.13e-47 164 34 5 279 3 moaA GTP 3',8-cyclase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q49ZI6 1.36e-46 163 31 6 309 3 moaA GTP 3',8-cyclase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P9WJS3 1.83e-45 161 32 6 305 2 moaA1 GTP 3',8-cyclase 1 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJS2 1.83e-45 161 32 6 305 3 moaA1 GTP 3',8-cyclase 1 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TX84 1.98e-45 161 32 6 305 3 moaA1 GTP 3',8-cyclase 1 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0W3L5 6.35e-45 158 30 9 303 3 moaA Probable GTP 3',8-cyclase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P9WJS1 5.62e-44 157 34 7 332 1 moaA2 GTP 3',8-cyclase 2 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJS0 5.62e-44 157 34 7 332 3 moaA2 GTP 3',8-cyclase 2 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P65385 5.62e-44 157 34 7 332 3 moaA2 GTP 3',8-cyclase 2 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q1B3F3 4.74e-42 152 33 5 328 3 moaA GTP 3',8-cyclase Mycobacterium sp. (strain MCS)
A1ULP7 4.74e-42 152 33 5 328 3 moaA GTP 3',8-cyclase Mycobacterium sp. (strain KMS)
A3Q648 4.74e-42 152 33 5 328 3 moaA GTP 3',8-cyclase Mycobacterium sp. (strain JLS)
A0PKZ7 1.69e-41 150 32 7 332 3 moaA GTP 3',8-cyclase Mycobacterium ulcerans (strain Agy99)
Q0S2N2 1.81e-41 150 33 7 333 3 moaA GTP 3',8-cyclase Rhodococcus jostii (strain RHA1)
B2HFA4 7.13e-41 149 32 7 332 3 moaA GTP 3',8-cyclase Mycobacterium marinum (strain ATCC BAA-535 / M)
O27593 2.02e-40 146 34 6 285 3 moaA Probable GTP 3',8-cyclase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
C1B1N5 3.93e-40 147 33 8 336 3 moaA GTP 3',8-cyclase Rhodococcus opacus (strain B4)
Q8PX29 5.62e-40 146 33 10 287 3 moaA Probable GTP 3',8-cyclase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q50746 1.07e-39 144 33 5 273 3 moaA Probable GTP 3',8-cyclase Methanothermobacter marburgensis (strain ATCC BAA-927 / DSM 2133 / JCM 14651 / NBRC 100331 / OCM 82 / Marburg)
Q4J8T0 1.2e-39 144 33 8 273 3 moaA Probable GTP 3',8-cyclase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q971H1 1.77e-39 144 33 11 299 3 moaA Probable GTP 3',8-cyclase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q9X5W3 1.93e-39 144 32 8 331 3 moaA GTP 3',8-cyclase Rhodobacter capsulatus
Q979T0 3.93e-39 143 31 6 274 3 moaA Probable GTP 3',8-cyclase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
Q3AVP9 6.3e-39 143 31 8 307 3 moaA GTP 3',8-cyclase Synechococcus sp. (strain CC9902)
Q8TUG2 1.61e-38 142 32 10 288 3 moaA Probable GTP 3',8-cyclase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O28273 2.4e-38 140 29 8 312 3 moaA Probable GTP 3',8-cyclase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q3AGB7 2.41e-38 142 31 11 341 3 moaA GTP 3',8-cyclase Synechococcus sp. (strain CC9605)
Q9EYN8 1.34e-36 137 30 11 354 3 moaA GTP 3',8-cyclase Synechococcus sp. (strain WH7803)
Q8U4J5 3.13e-36 135 30 9 304 3 moaA Probable GTP 3',8-cyclase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A0R443 6.05e-36 136 34 9 333 3 moaA GTP 3',8-cyclase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9V2G2 6.31e-36 134 31 9 293 3 moaA Probable GTP 3',8-cyclase Pyrococcus abyssi (strain GE5 / Orsay)
Q7U3H2 6.39e-36 135 32 6 306 3 moaA GTP 3',8-cyclase Parasynechococcus marenigrum (strain WH8102)
Q5JHN5 1.59e-35 133 31 7 279 3 moaA Probable GTP 3',8-cyclase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A4YH62 4.21e-35 132 29 9 302 3 moaA Probable GTP 3',8-cyclase Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
O57854 7.06e-35 132 30 9 293 3 moaA Probable GTP 3',8-cyclase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A6VJM2 1.2e-34 131 30 8 292 3 moaA Probable GTP 3',8-cyclase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A9A661 1.25e-34 131 30 7 283 3 moaA Probable GTP 3',8-cyclase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q58234 2.15e-34 130 30 8 286 3 moaA Probable GTP 3',8-cyclase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6LZQ3 4.24e-34 129 30 8 292 3 moaA Probable GTP 3',8-cyclase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
C3MXF3 1.25e-33 128 31 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C4KIH7 1.25e-33 128 31 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C3MZ99 1.25e-33 128 31 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain M.16.27)
A4FYQ8 2.67e-33 127 30 7 283 3 moaA Probable GTP 3',8-cyclase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q9HKZ7 4.18e-33 127 29 5 282 3 moaA Probable GTP 3',8-cyclase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q8TV60 1.21e-32 126 30 11 313 3 moaA Probable GTP 3',8-cyclase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
C3N7B9 1.4e-32 125 30 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MR64 1.4e-32 125 30 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
A6UX30 1.45e-32 125 30 8 285 3 moaA Probable GTP 3',8-cyclase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
C3NGB5 5.58e-32 124 30 10 301 3 moaA Probable GTP 3',8-cyclase Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
Q18G49 9.81e-32 124 31 7 278 3 moaA Probable GTP 3',8-cyclase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
Q980F0 1.29e-31 123 29 9 297 3 moaA Probable GTP 3',8-cyclase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A6US67 1.64e-31 122 30 8 283 3 moaA Probable GTP 3',8-cyclase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q9YEV3 1.91e-30 121 27 10 332 3 moaA Probable GTP 3',8-cyclase Aeropyrum pernix (strain ATCC 700893 / DSM 11879 / JCM 9820 / NBRC 100138 / K1)
Q8ZYE5 1.15e-29 118 28 9 287 3 moaA Probable GTP 3',8-cyclase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q9HST4 9.27e-29 116 31 11 294 3 moaA Probable GTP 3',8-cyclase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R2L5 9.27e-29 116 31 11 294 3 moaA Probable GTP 3',8-cyclase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
A0QSB8 1.46e-13 74 25 6 220 1 mftC Mycofactocin maturase MftC Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q46BK8 3.89e-11 67 28 8 202 1 ahbC Fe-coproporphyrin III synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
P9WJ79 4.04e-11 67 25 6 213 1 mftC Mycofactocin maturase MftC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WJ78 4.04e-11 67 25 6 213 3 mftC Mycofactocin maturase MftC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0PM49 7.93e-11 65 26 5 192 1 mftC Mycofactocin maturase MftC Mycobacterium ulcerans (strain Agy99)
Q58036 5.65e-10 63 24 6 211 1 MJ0619 7,8-dihydro-6-hydroxymethylpterin dimethyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P0DW52 3.21e-09 60 29 9 206 1 vip21 S-adenosylmethionine-dependent nucleotide dehydratase Lewinella persica (strain ATCC 23167 / DSM 23188 / NBRC 102663 / NCIMB 1396 / T-3)
P0DW53 3.69e-09 61 27 8 199 1 vip60 S-adenosylmethionine-dependent nucleotide dehydratase Lacinutrix mariniflava (strain JCM 13824 / KCCM 42306 / AKS432)
Q30Y73 1.07e-07 56 27 7 160 1 ahbD AdoMet-dependent heme synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A5VXG4 1.43e-07 56 28 5 159 3 pqqE PqqA peptide cyclase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q72DS4 1.52e-07 55 27 6 164 1 ahbD AdoMet-dependent heme synthase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q608P0 1.56e-07 55 27 4 156 3 pqqE PqqA peptide cyclase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q88QV8 1.69e-07 55 28 5 159 3 pqqE PqqA peptide cyclase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6F9I9 2.44e-07 55 24 2 156 3 pqqE PqqA peptide cyclase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q89FG1 3.22e-07 55 25 6 162 3 pqqE PqqA peptide cyclase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A0A1H0NKS3 3.22e-07 54 25 5 158 1 vip6 S-adenosylmethionine-dependent nucleotide dehydratase Selenomonas ruminantium
A0A110A2W7 5.36e-07 53 26 7 192 1 vip50 S-adenosylmethionine-dependent nucleotide dehydratase Thermoplasmatales archaeon (strain ISO4-H5)
A4XTR4 6.32e-07 54 25 9 236 3 pqqE PqqA peptide cyclase Pseudomonas mendocina (strain ymp)
A0A1S1YUU1 7.85e-07 53 24 7 169 1 vip47 S-adenosylmethionine-dependent nucleotide dehydratase Flammeovirga pacifica
P24427 1.24e-06 53 24 9 212 3 nifB FeMo cofactor biosynthesis protein NifB Rhizobium leguminosarum bv. trifolii
Q48CT3 2.97e-06 52 26 7 164 3 pqqE PqqA peptide cyclase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZMC1 3.4e-06 52 26 5 159 3 pqqE PqqA peptide cyclase Pseudomonas syringae pv. syringae (strain B728a)
Q4K4U8 9.89e-06 50 26 7 164 3 pqqE PqqA peptide cyclase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q88A84 1.04e-05 50 25 5 159 3 pqqE PqqA peptide cyclase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q53205 1.73e-05 50 23 6 194 3 nifB FeMo cofactor biosynthesis protein NifB Sinorhizobium fredii (strain NBRC 101917 / NGR234)
O31423 2.03e-05 49 23 6 164 1 skfB Sporulation killing factor maturation protein SkfB Bacillus subtilis (strain 168)
P59748 2.09e-05 49 25 4 158 3 pqqE PqqA peptide cyclase Kluyvera intermedia
C1DEW5 2.15e-05 49 24 7 237 3 pqqE PqqA peptide cyclase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B8ENI9 2.96e-05 48 25 3 151 3 pqqE PqqA peptide cyclase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
P07782 3.72e-05 48 25 4 158 3 pqqE PqqA peptide cyclase Acinetobacter calcoaceticus
B1ZIB2 3.89e-05 48 30 2 120 3 pqqE PqqA peptide cyclase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q59026 5.21e-05 47 25 8 152 3 MJ1632 Putative glycyl-radical enzyme activating enzyme MJ1632 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B1LUE7 5.43e-05 48 29 2 120 3 pqqE PqqA peptide cyclase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
B2VL10 0.000108 47 25 4 158 3 pqqE PqqA peptide cyclase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A9W3R0 0.000137 47 27 3 161 3 pqqE PqqA peptide cyclase Methylorubrum extorquens (strain PA1)
B7KXC6 0.000137 47 27 3 161 3 pqqE PqqA peptide cyclase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
P07748 0.000149 47 22 7 195 3 fixZ FeMo cofactor biosynthesis protein FixZ (Fragment) Rhizobium leguminosarum
P71517 0.00016 46 27 3 161 1 pqqE PqqA peptide cyclase Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
Q5H234 0.000168 46 24 4 169 3 pqqE PqqA peptide cyclase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P4Y9 0.000168 46 24 4 169 3 pqqE PqqA peptide cyclase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
B2I0I5 0.000181 46 24 4 158 3 pqqE PqqA peptide cyclase Acinetobacter baumannii (strain ACICU)
P59749 0.000196 46 25 4 156 3 pqqE PqqA peptide cyclase Streptomyces rochei
B0V494 0.000224 46 24 4 158 3 pqqE PqqA peptide cyclase Acinetobacter baumannii (strain AYE)
B7I6M8 0.000224 46 24 4 158 3 pqqE PqqA peptide cyclase Acinetobacter baumannii (strain AB0057)
B7H2Y0 0.000224 46 24 4 158 3 pqqE PqqA peptide cyclase Acinetobacter baumannii (strain AB307-0294)
B0VQD7 0.000228 46 24 4 158 3 pqqE PqqA peptide cyclase Acinetobacter baumannii (strain SDF)
Q6N8F3 0.000262 45 31 1 70 3 pqqE PqqA peptide cyclase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
B8ITV7 0.000282 45 29 2 120 3 pqqE PqqA peptide cyclase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q46CH7 0.000307 45 26 7 156 1 ahbD AdoMet-dependent heme synthase Methanosarcina barkeri (strain Fusaro / DSM 804)
B2SSW3 0.000388 45 24 4 169 3 pqqE PqqA peptide cyclase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q9I2C0 0.000446 45 24 9 236 3 pqqE PqqA peptide cyclase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02LD6 0.000446 45 24 9 236 3 pqqE PqqA peptide cyclase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7VAB6 0.000446 45 24 9 236 3 pqqE PqqA peptide cyclase Pseudomonas aeruginosa (strain LESB58)
Q9EXU8 0.000734 44 28 2 116 3 pqqE PqqA peptide cyclase Rhizobium meliloti (strain 1021)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03005
Feature type CDS
Gene moaA
Product GTP 3',8-cyclase MoaA
Location 663808 - 664788 (strand: 1)
Length 981 (nucleotides) / 326 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1486
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04055 Radical SAM superfamily
PF06463 Molybdenum Cofactor Synthesis C
PF13353 4Fe-4S single cluster domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2896 Coenzyme transport and metabolism (H) H GTP 3',8-cyclase (molybdenum cofactor biosynthesis protein MoaA)

Kegg Ortholog Annotation(s)

Protein Sequence

MQQLVDAFSRKFFYLRLSITDVCNFRCTYCLPNGYKPNGHKSFLSLDEIRRLTHSFAELGTEKIRLTGGEPTMRRDFTDIIATINENPAIKKIAVTTNGYRLARDVAQWRDAGLSAINVSVDSLDPRQFHAITGQDKFHQVMEGIDAAFTAGYDKVKVNVVLMRNVNDKNLPDFLHWIKDRPIQLRFIELMETGDGSDVFNRFHLSGEVIRQRLLNEGWLQIPRARSDGPAQVFTHPDYQGEIGLIMPYEKDFCVTCNRLRVSAIGNLHLCLFGENGIPLRDLLADDAQQQALQQRIQGGLLHKRETHFLHQGDSGITPNLSVIGG

Flanking regions ( +/- flanking 50bp)

GGGTGCACGGTAGAAATGCCCGCATCTCCCGAATTTGGAAAGGTGTTATTATGCAACAACTTGTTGATGCGTTTTCCCGCAAATTTTTCTATTTACGTCTATCAATCACAGACGTGTGTAATTTCCGTTGCACTTACTGCTTACCTAATGGCTACAAGCCAAATGGTCATAAGTCCTTTCTATCACTGGATGAAATCCGCCGACTGACTCACTCTTTTGCTGAATTAGGCACAGAAAAAATCCGTTTAACGGGTGGTGAGCCTACGATGCGTCGAGATTTTACCGATATTATCGCGACTATTAATGAAAACCCTGCCATTAAAAAGATTGCTGTGACAACGAACGGCTATCGTTTAGCCCGTGATGTTGCACAATGGCGTGATGCGGGGCTAAGTGCGATAAATGTCAGTGTTGATAGCTTAGATCCCCGCCAATTTCATGCCATTACCGGGCAAGATAAATTCCATCAAGTGATGGAAGGAATAGACGCTGCTTTTACGGCAGGTTATGACAAAGTGAAAGTCAATGTTGTGCTAATGCGCAACGTAAATGATAAAAACTTGCCTGATTTTCTCCATTGGATCAAAGACAGACCGATACAACTACGCTTTATTGAACTAATGGAAACTGGTGATGGTAGTGATGTTTTTAATCGCTTTCATTTATCTGGTGAAGTGATCCGCCAACGTTTACTTAACGAAGGTTGGCTACAAATTCCTCGCGCCCGTAGTGATGGGCCAGCTCAAGTCTTTACTCATCCTGATTATCAAGGTGAAATTGGTCTTATCATGCCTTATGAAAAAGACTTTTGTGTCACCTGTAACCGTTTACGTGTTTCTGCGATTGGTAATCTTCATCTTTGCTTATTTGGCGAAAATGGTATTCCTTTACGCGATTTATTGGCTGATGATGCACAACAACAAGCCCTACAACAGCGTATTCAGGGTGGACTTCTTCATAAAAGAGAAACACATTTTCTTCATCAGGGCGATAGTGGTATTACCCCTAATCTTTCTGTGATTGGTGGATAAGTTTTTTCGCTCTGTTATTTAGTTAATTTCAGGAGTTGTGCATGTCTCAA