Homologs in group_3133

Help

5 homologs were identified in 1 genome with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
PMI_RS00020 PMI_RS00020 26.5 Proteus mirabilis HI4320 - calcium-binding protein
PMI_RS01360 PMI_RS01360 52.2 Proteus mirabilis HI4320 - M10 family metallopeptidase
PMI_RS01365 PMI_RS01365 71.8 Proteus mirabilis HI4320 - M10 family metallopeptidase C-terminal domain-containing protein
PMI_RS01370 PMI_RS01370 86.6 Proteus mirabilis HI4320 - M10 family metallopeptidase C-terminal domain-containing protein
PMI_RS10070 PMI_RS10070 33.2 Proteus mirabilis HI4320 rtxA MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA

Distribution of the homologs in the orthogroup group_3133

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3133

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P16316 8.74e-52 189 35 7 355 1 prtB Serralysin B Dickeya chrysanthemi
P16316 0.00034 47 34 3 103 1 prtB Serralysin B Dickeya chrysanthemi
P16317 9.56e-52 189 49 2 208 1 prtC Serralysin C Dickeya chrysanthemi
P16317 0.000616 46 33 3 105 1 prtC Serralysin C Dickeya chrysanthemi
P07268 3.95e-51 187 35 7 359 1 None Serralysin Serratia marcescens (strain ATCC 21074 / E-15)
P07268 4.96e-06 53 30 3 136 1 None Serralysin Serratia marcescens (strain ATCC 21074 / E-15)
P23694 1.57e-50 186 35 7 359 1 None Serralysin Serratia marcescens
P23694 2.48e-06 54 30 3 136 1 None Serralysin Serratia marcescens
Q07295 3.2e-49 182 38 7 335 1 prtA Serralysin A Dickeya chrysanthemi
Q07295 2.5e-05 50 29 4 146 1 prtA Serralysin A Dickeya chrysanthemi
P19144 9.19e-49 181 35 9 384 1 prtC Serralysin C Dickeya chrysanthemi
P19144 4.52e-06 53 28 4 146 1 prtC Serralysin C Dickeya chrysanthemi
P82115 5.28e-47 176 42 4 260 1 prtA Serralysin Photorhabdus sp. (strain Az29)
P82115 0.000516 46 32 2 109 1 prtA Serralysin Photorhabdus sp. (strain Az29)
Q03023 9.72e-47 175 42 4 254 1 aprA Serralysin Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q11137 2.55e-46 174 41 4 256 3 zapA Serralysin Proteus mirabilis
Q7N8R3 1.32e-45 172 47 2 206 3 prtA Serralysin Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N8R3 2.36e-05 51 33 2 109 3 prtA Serralysin Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q84F70 4.27e-45 171 41 4 258 3 prtA1 Serralysin Photorhabdus luminescens
Q84F70 0.000751 46 31 2 109 3 prtA1 Serralysin Photorhabdus luminescens
A0A0C5CJR8 6.15e-42 161 40 6 277 1 aprA Metallopeptidase AprA Pseudomonas marginalis
A0A0C5CJR8 0.000495 47 39 2 78 1 aprA Metallopeptidase AprA Pseudomonas marginalis
Q1ID47 1.04e-40 158 45 3 210 1 aprA Metalloprotease AprA Pseudomonas entomophila (strain L48)
Q1ID47 0.000132 48 30 3 117 1 aprA Metalloprotease AprA Pseudomonas entomophila (strain L48)
Q07162 2.44e-40 157 38 4 247 1 prtG Serralysin G Dickeya chrysanthemi
P55131 1.28e-21 103 37 3 176 3 apxIIIA RTX-III toxin determinant A from serotype 8 Actinobacillus pleuropneumoniae
P55130 3.82e-21 102 37 4 186 3 apxIIIA RTX-III toxin determinant A from serotype 2 Actinobacillus pleuropneumoniae
Q9RCG8 2.61e-20 99 36 3 176 3 paxA Exotoxin PaxA Pasteurella aerogenes
P16462 4e-19 95 36 2 168 1 ltxA Leukotoxin Aggregatibacter actinomycetemcomitans
P08715 5.27e-17 89 33 4 192 1 hlyA Hemolysin, plasmid Escherichia coli
P09983 1.14e-16 88 40 1 125 1 hlyA Hemolysin, chromosomal Escherichia coli
P55128 2.59e-15 83 42 2 126 1 apxIA RTX-I toxin determinant A from serotypes 1/9 Actinobacillus pleuropneumoniae
P55129 2.82e-15 83 42 2 126 3 apxIA RTX-I toxin determinant A from serotypes 5/10 Actinobacillus pleuropneumoniae
Q57506 1.38e-13 78 34 9 187 3 cya Bifunctional hemolysin/adenylate cyclase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57506 5.68e-13 76 35 5 157 3 cya Bifunctional hemolysin/adenylate cyclase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57506 6.89e-08 59 41 1 85 3 cya Bifunctional hemolysin/adenylate cyclase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57506 1.4e-07 58 41 2 92 3 cya Bifunctional hemolysin/adenylate cyclase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q57506 5.32e-06 53 38 2 100 3 cya Bifunctional hemolysin/adenylate cyclase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P0DKX7 1.95e-13 77 41 3 117 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX7 2.03e-12 74 35 5 157 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX7 5.67e-08 60 41 1 85 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX7 8.04e-08 59 41 1 90 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P0DKX7 6.99e-06 53 38 3 107 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
J7QLC0 1.95e-13 77 41 3 117 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
J7QLC0 2.03e-12 74 35 5 157 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
J7QLC0 5.67e-08 60 41 1 85 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
J7QLC0 8.04e-08 59 41 1 90 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
J7QLC0 6.99e-06 53 38 3 107 1 cya Bifunctional hemolysin/adenylate cyclase Bordetella pertussis (strain ATCC 9797 / DSM 5571 / CCUG 30873 / LMG 14455 / NCTC 10739 / 18323)
P55126 7.27e-13 75 34 3 155 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup C
P55126 1.55e-09 65 46 0 78 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup C
P55126 0.000236 48 45 0 62 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup C
P55126 0.00068 46 42 2 68 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup C
Q9K0K9 2.7e-12 73 34 3 155 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 1.22e-11 72 39 1 121 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 1.36e-09 65 47 0 78 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 1.36e-09 65 47 0 78 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 3.97e-09 63 42 1 109 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 1.24e-07 58 38 1 100 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 6.2e-06 53 38 0 96 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K0K9 0.000505 47 45 0 62 3 frpA Iron-regulated protein FrpA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P55127 4.06e-12 73 33 2 155 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 2.59e-11 70 39 1 121 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 3.38e-11 70 39 1 121 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 1.35e-10 68 38 1 121 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 7.71e-10 66 48 0 78 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 2.18e-09 64 47 0 78 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 2.84e-09 64 47 0 78 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 2.84e-09 64 47 0 78 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 7.65e-09 63 42 1 109 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 9.97e-09 62 42 1 109 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 9.97e-09 62 42 1 109 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 2.68e-07 58 38 1 100 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 3.8e-07 57 38 1 100 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 1.04e-06 56 37 1 100 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 1.64e-05 52 38 0 96 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 1.64e-05 52 38 0 96 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 1.74e-05 52 38 0 96 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
P55127 3.77e-05 50 43 0 76 1 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup C
Q9JYV5 2.92e-11 70 33 3 155 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 2.95e-11 70 39 1 121 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.84e-11 70 39 1 121 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.84e-11 70 39 1 121 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 2.5e-09 64 47 0 78 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.26e-09 64 47 0 78 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.26e-09 64 47 0 78 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.26e-09 64 47 0 78 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 9e-09 62 42 1 109 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.17e-08 62 42 1 109 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.17e-08 62 42 1 109 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.26e-07 57 38 1 100 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 3.26e-07 57 38 1 100 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.26e-06 55 37 1 100 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.45e-05 52 38 0 96 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.54e-05 52 38 0 96 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 1.96e-05 52 38 0 96 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JYV5 0.001 46 45 0 62 3 frpC Iron-regulated protein FrpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A1YKW7 5.81e-11 69 53 1 73 1 rtxA Cytolysin RtxA Kingella kingae
A1YKW7 5.67e-09 63 36 4 115 1 rtxA Cytolysin RtxA Kingella kingae
A1YKW7 7.61e-08 59 32 2 119 1 rtxA Cytolysin RtxA Kingella kingae
Q7BHI8 7.13e-11 69 37 6 154 1 lktA Leukotoxin Mannheimia haemolytica
Q7BHI8 4.92e-07 57 35 2 97 1 lktA Leukotoxin Mannheimia haemolytica
P16535 7.13e-11 69 37 6 154 3 lktA Leukotoxin Mannheimia haemolytica
P16535 4.92e-07 57 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
P0C083 9.62e-11 68 37 4 145 3 lktA Leukotoxin Mannheimia haemolytica
P0C083 5.4e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
P0C084 9.62e-11 68 37 4 145 3 lktA Leukotoxin Mannheimia haemolytica
P0C084 5.4e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV29 1.01e-10 68 37 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV29 5.36e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV34 1.06e-10 68 37 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV34 5.5e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
P55118 1.91e-10 67 37 4 142 3 lktA Leukotoxin Mannheimia haemolytica
P55118 1.09e-05 52 39 1 73 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV32 2.31e-10 67 35 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV32 6.63e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
P0C085 2.41e-10 67 35 4 145 3 lktA Leukotoxin Mannheimia haemolytica
P0C085 6.63e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV27 2.41e-10 67 35 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV27 6.63e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
Q9ETX2 2.47e-10 67 37 4 142 3 lktA Leukotoxin Mannheimia glucosida
Q9ETX2 6.09e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia glucosida
Q9EV33 2.54e-10 67 35 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV33 7.04e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV31 2.79e-10 67 35 4 145 3 lktA Leukotoxin Mannheimia haemolytica
Q9EV31 7.41e-07 56 35 2 97 3 lktA Leukotoxin Mannheimia haemolytica
P55117 3.29e-10 67 35 4 145 3 lktA Leukotoxin Bibersteinia trehalosi
P55117 8.8e-07 56 35 2 97 3 lktA Leukotoxin Bibersteinia trehalosi
Q9EV30 1.5e-09 65 32 7 177 3 lktA Leukotoxin Mannheimia haemolytica
P15377 5.09e-07 57 43 1 73 3 apxIIA RTX-II toxin determinant A Actinobacillus pleuropneumoniae
P15377 4.29e-06 53 39 1 83 3 apxIIA RTX-II toxin determinant A Actinobacillus pleuropneumoniae
Q00951 5.94e-07 56 43 1 73 3 appA Hemolysin Actinobacillus suis
Q00951 4.75e-06 53 39 1 83 3 appA Hemolysin Actinobacillus suis
Q9ZFG9 1.11e-06 55 44 1 77 1 algE7 Alginate lyase 7 Azotobacter vinelandii
Q9ZFG9 7.96e-06 53 34 2 103 1 algE7 Alginate lyase 7 Azotobacter vinelandii
P15728 1.78e-06 53 26 5 191 1 nodO Nodulation protein O Rhizobium leguminosarum bv. viciae
P73817 2.5e-06 54 34 4 126 1 sll1951 S-layer protein Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A0A2S3R7M0 3.73e-05 51 39 4 104 1 CRN52_02910 Multifunctional-autoprocessing repeats-in-toxin Vibrio vulnificus
Q9KS12 4.28e-05 50 39 4 104 1 rtxA Multifunctional-autoprocessing repeats-in-toxin Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q44496 0.000144 48 43 1 73 3 algE3 Mannuronan C5-epimerase AlgE3 Azotobacter vinelandii
Q44495 0.000145 48 39 2 79 1 algE2 Mannuronan C5-epimerase AlgE2 Azotobacter vinelandii
Q9ZFH0 0.000759 46 36 3 100 1 algE6 Mannuronan C5-epimerase AlgE6 Azotobacter vinelandii
Q44492 0.001 46 37 1 80 2 algE5 Mannuronan C5-epimerase AlgE5 Azotobacter vinelandii

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01375
Feature type CDS
Gene -
Product M10 family metallopeptidase C-terminal domain-containing protein
Location 338218 - 340167 (strand: -1)
Length 1950 (nucleotides) / 649 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_3133
Orthogroup size 6
N. genomes 1

Actions

Genomic region

Domains

PF00353 RTX calcium-binding nonapeptide repeat (4 copies)
PF00413 Matrixin
PF08548 Peptidase M10 serralysin C terminal

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2931 Secondary metabolites biosynthesis, transport and catabolism (Q) Q Ca2+-binding protein, RTX toxin-related

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K01406 serralysin [EC:3.4.24.40] Cationic antimicrobial peptide (CAMP) resistance -

Protein Sequence

MELIKNTKKPTVFYLSEGIISTGVISGWPKNSTDGTTHLTYTFPNYSDRSENIRKKYPITESQKKETLKNIAEYYKLDYEIKERKKELEAIKDSEDPKKRIQEINEDIKLKTERRYEIKKGIPLYFSVTTMTIFPHQQEVVTEILQLASDFADLTFTRVPIQKNANLKFGYYKQFATGYYMTRETVGFASKPNYNGTPIKEIGQNESYDFSGSIFINLASHDFYQWVKRDNLDKYIENEANIGDLYNYHDNNQVAIIKSTDVLLNETMKSKHKLGSQIYYVFLHELGHALGLEHIDAYLKNIKNSAIETYKYTVMGMGFADIKDADFGGLYPMTFMLVDILLLQYLYGPNMTTRLENNTYGFNSNTGRAAYSLKSIEDKLVSCIWDAGGIDTLDFSLYTVNQVINLNEGCFSDIGGLRSNISIAYKTIIENAIGGKGDDTLIGNPFDNNLIGGDGNDLFYGGDGNDLFYGGSGNDVIYGEMGNDVLYGDDGDDMLIDYYGANMLDGGKGNDRICVASMDRGLPGRNIIQGGEGDDEIYLGTGTHRITGGQGNDTFNFFCYEGVESNSSIWDFEKNKDKITLITRDYRKIDISKMKKVDKLSGDKNEFSLNHNKPANKTIIDVSTSSNDDKSIVHIEIVGIFNHDELFAV

Flanking regions ( +/- flanking 50bp)

TTTATAATAAGCACACAAATAGTTTATTTTTAAATAATAAAGGATATTATATGGAATTAATAAAAAACACTAAAAAACCGACTGTTTTCTATTTATCTGAAGGGATTATATCAACAGGGGTTATATCTGGCTGGCCTAAAAATTCAACAGATGGAACAACACATCTCACCTATACATTTCCTAATTACAGTGATCGGTCAGAAAATATAAGAAAGAAATACCCGATAACAGAAAGTCAAAAAAAAGAAACGCTAAAGAATATCGCAGAGTATTACAAATTAGATTATGAAATAAAGGAAAGAAAAAAAGAACTAGAAGCCATTAAAGATAGTGAGGATCCCAAAAAAAGAATTCAGGAAATAAATGAAGATATAAAATTAAAGACCGAGAGAAGATACGAGATAAAAAAAGGCATACCTTTATATTTTTCCGTTACAACAATGACGATATTTCCTCATCAACAAGAAGTTGTCACAGAAATTTTACAATTGGCTTCAGATTTCGCAGACCTTACTTTTACTAGAGTACCTATACAAAAAAATGCCAATTTAAAGTTTGGCTATTACAAGCAGTTTGCAACTGGTTATTATATGACGAGAGAAACAGTAGGCTTTGCTAGTAAGCCTAACTATAATGGTACACCTATAAAAGAGATCGGGCAAAATGAAAGTTATGATTTCTCTGGGAGCATATTTATTAATTTAGCTTCTCATGATTTTTATCAATGGGTCAAACGGGATAATCTTGATAAATATATAGAAAATGAGGCCAATATCGGCGATTTATATAATTACCATGATAATAATCAAGTTGCTATAATAAAAAGTACGGATGTGTTACTCAACGAAACAATGAAAAGTAAACACAAACTAGGATCACAAATATATTATGTTTTTTTGCATGAATTAGGTCATGCACTAGGGCTAGAGCACATAGATGCATATTTGAAAAATATAAAAAATAGTGCAATTGAAACATATAAATATACAGTTATGGGCATGGGATTTGCTGATATTAAAGATGCAGATTTTGGCGGTCTTTATCCTATGACCTTTATGCTAGTAGATATATTATTATTACAATATCTCTATGGCCCAAATATGACCACACGCCTTGAAAATAATACCTATGGATTTAATTCCAATACGGGACGCGCCGCTTACTCTTTAAAAAGCATAGAAGATAAATTAGTGAGCTGTATTTGGGATGCGGGTGGAATTGATACATTAGACTTTTCCCTATATACCGTTAATCAAGTCATTAATCTCAATGAAGGCTGTTTTTCAGATATTGGAGGATTACGGAGTAATATCTCTATTGCCTATAAAACGATTATTGAAAATGCGATTGGTGGTAAAGGTGATGATACTCTCATAGGAAATCCTTTTGATAATAACCTAATCGGTGGTGATGGCAATGATTTATTCTATGGCGGTGATGGCAATGATTTATTCTATGGTGGCTCTGGAAACGATGTTATATACGGAGAAATGGGAAATGATGTGCTCTATGGTGATGATGGAGATGATATGCTTATTGATTATTATGGTGCTAATATGTTGGATGGTGGTAAGGGTAATGATCGGATCTGTGTAGCCTCAATGGATAGAGGGCTCCCTGGCAGAAATATCATTCAAGGGGGAGAAGGTGATGATGAAATATATTTGGGCACAGGAACTCATCGTATAACAGGTGGACAAGGAAATGATACCTTTAATTTTTTCTGCTATGAGGGCGTTGAAAGCAATAGTTCAATTTGGGATTTTGAAAAAAACAAGGATAAAATAACGTTGATCACTAGGGATTATAGAAAAATAGATATATCAAAAATGAAAAAAGTTGATAAATTATCAGGAGATAAAAATGAATTTTCATTAAATCATAACAAACCAGCCAACAAAACCATCATAGACGTTTCAACATCTTCTAACGATGATAAGTCCATTGTACATATAGAGATTGTCGGTATATTTAACCATGATGAACTCTTTGCAGTATAAATACATTTCACCATATGATTTGTAAAACTTTAAATTATTTCTCTATAAAT