Homologs in group_372

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13830 FBDBKF_13830 80.2 Morganella morganii S1 dtpB dipeptide/tripeptide permease DtpB
EHELCC_11500 EHELCC_11500 80.2 Morganella morganii S2 dtpB dipeptide/tripeptide permease DtpB
NLDBIP_11845 NLDBIP_11845 80.2 Morganella morganii S4 dtpB dipeptide/tripeptide permease DtpB
LHKJJB_11705 LHKJJB_11705 80.2 Morganella morganii S3 dtpB dipeptide/tripeptide permease DtpB
HKOGLL_10315 HKOGLL_10315 80.2 Morganella morganii S5 dtpB dipeptide/tripeptide permease DtpB
F4V73_RS12695 F4V73_RS12695 78.2 Morganella psychrotolerans dtpB dipeptide/tripeptide permease DtpB
PMI_RS07725 PMI_RS07725 53.2 Proteus mirabilis HI4320 dtpA dipeptide/tripeptide permease DtpA

Distribution of the homologs in the orthogroup group_372

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_372

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B6VMU9 0.0 820 79 1 489 3 dtpB Dipeptide and tripeptide permease B Photorhabdus asymbiotica subsp. asymbiotica (strain ATCC 43949 / 3105-77)
Q8GFA2 0.0 818 79 1 487 3 dtpB Dipeptide and tripeptide permease B Photorhabdus luminescens
D0ZGL2 0.0 790 78 1 482 3 dtpB Dipeptide and tripeptide permease B Edwardsiella tarda (strain EIB202)
A0KMY1 0.0 788 76 2 493 3 dtpB Dipeptide and tripeptide permease B Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P36837 0.0 785 77 1 489 1 dtpB Dipeptide and tripeptide permease B Escherichia coli (strain K12)
A1JRI8 0.0 785 75 1 488 3 dtpB Dipeptide and tripeptide permease B Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q32AW5 0.0 776 76 1 489 3 dtpB Dipeptide and tripeptide permease B Shigella dysenteriae serotype 1 (strain Sd197)
Q8ZLD6 0.0 773 78 2 485 3 dtpB Dipeptide and tripeptide permease B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D3V3D1 0.0 757 74 2 489 3 dtpB Dipeptide and tripeptide permease B Xenorhabdus bovienii (strain SS-2004)
B5FDK5 0.0 652 62 3 496 3 dtpB Dipeptide and tripeptide permease B Aliivibrio fischeri (strain MJ11)
C9Y3M8 1.34e-176 508 51 4 490 3 dtpA Dipeptide and tripeptide permease A Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
A8AH15 2.42e-175 505 52 4 491 3 dtpA Dipeptide and tripeptide permease A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5XWP3 2.36e-174 502 51 4 494 3 dtpA Dipeptide and tripeptide permease A Klebsiella pneumoniae (strain 342)
Q8ZPM6 1.41e-173 500 51 3 482 2 dtpA Dipeptide and tripeptide permease A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X651 2.2e-173 500 52 3 475 3 dtpA Dipeptide and tripeptide permease A Escherichia coli O157:H7
Q8FH91 3.59e-173 499 52 3 475 3 dtpA Dipeptide and tripeptide permease A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77304 5.68e-173 499 52 3 475 1 dtpA Dipeptide and tripeptide permease A Escherichia coli (strain K12)
Q8Z6Q5 7.63e-173 498 51 3 482 3 dtpA Dipeptide and tripeptide permease A Salmonella typhi
D2TBH1 4.84e-171 494 51 3 486 3 dtpA Dipeptide and tripeptide permease A Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
A4W9W3 5.22e-170 491 50 3 485 3 dtpA Dipeptide and tripeptide permease A Enterobacter sp. (strain 638)
B4EY98 1.37e-169 490 52 3 484 3 dtpA Dipeptide and tripeptide permease A Proteus mirabilis (strain HI4320)
C6DH09 4.73e-169 489 51 3 476 3 dtpA Dipeptide and tripeptide permease A Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q0WEG0 2.69e-166 482 51 5 485 3 dtpA Dipeptide and tripeptide permease A Yersinia pestis
D0Z7W2 1.28e-162 472 50 5 485 3 dtpA Dipeptide and tripeptide permease A Edwardsiella tarda (strain EIB202)
A8GDZ4 3.76e-159 464 51 4 490 3 dtpA Dipeptide and tripeptide permease A Serratia proteamaculans (strain 568)
Q7NRM5 6.27e-157 458 50 3 479 3 dtpA Dipeptide and tripeptide permease A Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A0A2R9TD79 7.05e-55 194 28 12 515 1 YEP4_02370 Peptide transporter YePEPT Yersinia enterocolitica subsp. palearctica serotype O:3 (strain YE-P4)
P94408 2.65e-53 190 30 13 501 3 yclF Uncharacterized transporter YclF Bacillus subtilis (strain 168)
P0C2U2 2.12e-51 185 30 12 456 3 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. lactis (strain IL1403)
A2RMA8 3.98e-50 181 30 13 456 3 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. cremoris (strain MG1363)
P0C2U3 3.98e-50 181 30 13 456 1 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. cremoris
C0PWD2 6.62e-50 181 27 10 504 3 dtpD Dipeptide permease D Salmonella paratyphi C (strain RKS4594)
Q57RM6 1.47e-49 180 27 10 504 3 dtpD Dipeptide permease D Salmonella choleraesuis (strain SC-B67)
Q7CQY0 2.99e-49 179 27 10 504 3 dtpD Dipeptide permease D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZQC5 2.99e-49 179 27 10 504 3 dtpD Dipeptide permease D Salmonella typhimurium (strain 14028s / SGSC 2262)
A8AJB3 3.87e-49 179 26 10 507 3 dtpD Dipeptide permease D Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
P75742 8.69e-49 177 27 11 507 1 dtpD Dipeptide permease D Escherichia coli (strain K12)
Q83S84 1.07e-48 177 27 11 507 3 dtpD Dipeptide permease D Shigella flexneri
Q8X9D3 1.36e-48 177 27 11 507 1 dtpD Dipeptide permease D Escherichia coli O157:H7
B5XZE5 1.7e-46 171 27 9 446 3 dtpD Dipeptide permease D Klebsiella pneumoniae (strain 342)
A6T6E2 1.02e-45 169 27 9 446 3 dtpD Dipeptide permease D Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
D2TNL4 1.04e-44 167 26 11 491 3 dtpD Dipeptide permease D Citrobacter rodentium (strain ICC168)
P39276 8.66e-37 144 27 8 444 1 dtpC Dipeptide and tripeptide permease C Escherichia coli (strain K12)
Q21219 8.5e-17 87 26 10 382 2 pept-1 Peptide transporter family 1 Caenorhabditis elegans
P91679 9.13e-17 87 26 11 334 1 yin Peptide transporter family 1 Drosophila melanogaster
Q9ES07 2.48e-15 82 25 12 388 1 Slc15a2 Solute carrier family 15 member 2 Mus musculus
Q63424 9.22e-15 80 24 10 379 1 Slc15a2 Solute carrier family 15 member 2 Rattus norvegicus
Q16348 5.85e-14 78 24 7 359 1 SLC15A2 Solute carrier family 15 member 2 Homo sapiens
O07380 1.04e-13 77 26 4 191 3 dtpT Di-/tripeptide transporter Lactobacillus helveticus
P46029 1.61e-13 76 28 3 208 1 SLC15A2 Solute carrier family 15 member 2 Oryctolagus cuniculus
P51574 4.08e-13 75 23 10 400 2 Slc15a1 Solute carrier family 15 member 1 Rattus norvegicus
P36836 4.52e-13 75 24 11 394 1 SLC15A1 Solute carrier family 15 member 1 Oryctolagus cuniculus
Q9JIP7 4.34e-12 72 23 10 400 1 Slc15a1 Solute carrier family 15 member 1 Mus musculus
B0S6T2 5.55e-12 72 30 5 184 1 slc15a2 Solute carrier family 15 member 2 Danio rerio
P46059 5.79e-12 71 23 10 395 1 SLC15A1 Solute carrier family 15 member 1 Homo sapiens
Q8WMX5 6.72e-12 71 22 10 400 2 SLC15A1 Solute carrier family 15 member 1 Canis lupus familiaris
Q17758 3.49e-11 69 25 11 384 1 pept-2 Peptide transporter family 2 Caenorhabditis elegans
O01840 4.87e-10 65 28 4 173 1 pept-3 Peptide transporter 3 Caenorhabditis elegans
Q9SK96 3.4e-08 59 23 9 390 2 NPF5.16 Protein NRT1/ PTR FAMILY 5.16 Arabidopsis thaliana
Q8VZE2 8.3e-08 58 23 3 194 2 NPF5.14 Protein NRT1/ PTR FAMILY 5.14 Arabidopsis thaliana
Q9SK99 9.29e-08 58 24 4 207 2 NPF5.15 Protein NRT1/ PTR FAMILY 5.15 Arabidopsis thaliana
Q9M1I2 4.99e-07 55 24 2 182 2 NPF5.4 Protein NRT1/ PTR FAMILY 5.4 Arabidopsis thaliana
Q0WP01 5.17e-07 55 23 9 384 2 NPF5.10 Protein NRT1/ PTR FAMILY 5.10 Arabidopsis thaliana
Q9M390 1.46e-06 54 26 4 193 1 NPF8.1 Protein NRT1/ PTR FAMILY 8.1 Arabidopsis thaliana
Q84WG0 2.08e-06 53 25 4 202 2 NPF8.4 Protein NRT1/ PTR FAMILY 8.4 Arabidopsis thaliana
Q9FNL7 4.96e-06 52 22 2 215 2 NPF5.2 Protein NRT1/ PTR FAMILY 5.2 Arabidopsis thaliana
Q9FNL8 6.45e-06 52 23 5 229 2 NPF5.3 Protein NRT1/ PTR FAMILY 5.3 Arabidopsis thaliana
P46032 1.21e-05 51 26 3 194 1 NPF8.3 Protein NRT1/ PTR FAMILY 8.3 Arabidopsis thaliana
Q0WSZ6 1.42e-05 51 22 3 210 2 NPF5.13 Protein NRT1/ PTR FAMILY 5.13 Arabidopsis thaliana
Q05085 1.5e-05 51 23 3 240 1 NPF6.3 Protein NRT1/ PTR FAMILY 6.3 Arabidopsis thaliana
Q9LFB8 2.26e-05 50 23 2 211 2 NPF8.2 Protein NRT1/ PTR FAMILY 8.2 Arabidopsis thaliana
Q9LVE0 6.34e-05 49 26 3 201 1 NPF6.4 Protein NRT1/ PTR FAMILY 6.4 Arabidopsis thaliana
Q9C7U1 8.07e-05 48 26 2 178 2 NPF5.12 Protein NRT1/ PTR FAMILY 5.12 Arabidopsis thaliana
Q93Z20 0.000137 48 23 9 362 2 NPF8.5 Protein NRT1/ PTR FAMILY 8.5 Arabidopsis thaliana
Q8RX67 0.0008 45 25 1 159 2 NPF5.11 Protein NRT1/ PTR FAMILY 5.11 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01190
Feature type CDS
Gene dtpB
Product dipeptide/tripeptide permease DtpB
Location 292575 - 294053 (strand: -1)
Length 1479 (nucleotides) / 492 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_372
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00854 POT family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3104 Amino acid transport and metabolism (E) E Dipeptide/tripeptide permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03305 proton-dependent oligopeptide transporter, POT family - -

Protein Sequence

MDKPAKVGLLQQPKPFFMIFFVELWERFGYYGVQGILAVYFVSKLGFSQEQAFITFGAFSALVYGLISIGGYVGDHLLGTKRTIVLGAIVLAIGYFMTGMSIMYPNLIFYALATIAVGNGLFKANPASLLAKCYKPKDPRLDGAFTLFYMSINVGSLISLSIAPVLADRYGYALTYNICGIGLIMAILVYFFCRKMVVNIGSEPDHLPMNFNKLLLVIAGSVAMVFICAWLLHNVMIANIVLISLSIVVVIIYFREAFKQKDRVARNKMYVAFVLMLEAVIFYILYAQMPTSLNFFAIHNVHHTLLGFDINPVSFQALNPFWIIIASPILAMAYSHFGAKGKDLSMPAKFTTGMLLCSLGFLTAAASGMWFADAQGLTSPWFVVLIYLFQSLGELMISALGLAMIAAFVPQYMMGFILGMWFLTQATAYLLGGHVATFTAPPEGITDPLQTLPIYTDVFGKIGIVTLVVGLIMWATVPLLNRMMKEESKMIK

Flanking regions ( +/- flanking 50bp)

GTAAATAGCATCGTTGTTGAAAATAAATAATAATTAGGGGCATTAAAGATATGGATAAACCCGCTAAAGTCGGTTTATTACAACAGCCTAAACCATTCTTTATGATTTTCTTTGTGGAATTATGGGAACGTTTTGGTTACTACGGCGTACAAGGTATTCTTGCCGTTTATTTTGTTAGTAAACTCGGATTCTCTCAAGAACAAGCTTTTATTACTTTTGGTGCATTCTCCGCATTAGTTTATGGGCTTATTTCTATTGGTGGTTATGTTGGTGACCATCTATTAGGCACCAAACGAACCATTGTTTTAGGGGCTATCGTATTGGCTATCGGTTATTTTATGACCGGCATGTCAATTATGTATCCTAATTTAATCTTTTATGCTTTAGCCACTATCGCAGTAGGTAACGGTTTATTTAAAGCAAACCCAGCAAGCCTATTAGCTAAATGCTATAAACCTAAAGATCCCCGTCTTGATGGTGCATTTACACTATTTTATATGTCGATTAATGTTGGTTCATTAATCTCCTTATCTATTGCCCCCGTTCTTGCCGATCGCTATGGCTATGCGCTGACTTATAATATTTGTGGTATCGGCTTAATAATGGCCATATTGGTCTATTTTTTCTGCCGTAAAATGGTCGTGAATATTGGTTCTGAACCAGATCACCTGCCAATGAATTTCAACAAACTGCTATTAGTTATTGCAGGCTCTGTCGCTATGGTCTTTATTTGTGCATGGTTGTTGCACAATGTGATGATTGCTAACATCGTTTTAATCAGCTTGTCTATTGTTGTGGTTATCATTTATTTTCGTGAAGCCTTTAAACAAAAAGACAGAGTGGCACGTAATAAAATGTATGTTGCATTTGTTCTGATGTTAGAAGCTGTTATTTTCTATATTCTCTACGCTCAGATGCCAACCTCACTTAACTTTTTTGCTATCCATAATGTTCACCATACCCTGTTAGGCTTTGATATTAACCCGGTGAGTTTCCAAGCATTAAATCCATTTTGGATCATTATTGCCAGCCCTATCTTAGCAATGGCTTATAGCCATTTTGGCGCGAAAGGCAAAGATTTATCCATGCCGGCAAAATTTACCACAGGTATGCTTTTATGCTCATTAGGCTTCCTAACCGCTGCCGCTTCAGGTATGTGGTTTGCTGATGCTCAAGGCTTAACATCACCTTGGTTTGTTGTACTGATTTATCTCTTCCAAAGTCTAGGGGAATTGATGATCAGTGCATTAGGCTTAGCGATGATTGCCGCTTTCGTACCGCAATATATGATGGGCTTTATTTTAGGTATGTGGTTCTTAACACAAGCGACGGCTTACCTGTTAGGAGGCCATGTAGCAACCTTTACCGCGCCACCTGAAGGTATTACCGATCCACTACAAACACTGCCTATTTATACTGATGTGTTTGGCAAAATCGGTATCGTTACCTTAGTGGTTGGTTTGATTATGTGGGCAACAGTACCTTTACTAAACCGCATGATGAAAGAAGAGAGTAAAATGATTAAGTAAATAAGCAAACACCTTCGCTTATCACAGACAAAGCGCCTAGAAAGGCGCTT