Homologs in group_372

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13830 FBDBKF_13830 100.0 Morganella morganii S1 dtpB dipeptide/tripeptide permease DtpB
EHELCC_11500 EHELCC_11500 100.0 Morganella morganii S2 dtpB dipeptide/tripeptide permease DtpB
LHKJJB_11705 LHKJJB_11705 100.0 Morganella morganii S3 dtpB dipeptide/tripeptide permease DtpB
HKOGLL_10315 HKOGLL_10315 100.0 Morganella morganii S5 dtpB dipeptide/tripeptide permease DtpB
F4V73_RS12695 F4V73_RS12695 94.5 Morganella psychrotolerans dtpB dipeptide/tripeptide permease DtpB
PMI_RS01190 PMI_RS01190 80.2 Proteus mirabilis HI4320 dtpB dipeptide/tripeptide permease DtpB
PMI_RS07725 PMI_RS07725 52.4 Proteus mirabilis HI4320 dtpA dipeptide/tripeptide permease DtpA

Distribution of the homologs in the orthogroup group_372

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_372

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8GFA2 0.0 773 74 0 486 3 dtpB Dipeptide and tripeptide permease B Photorhabdus luminescens
B6VMU9 0.0 769 74 0 489 3 dtpB Dipeptide and tripeptide permease B Photorhabdus asymbiotica subsp. asymbiotica (strain ATCC 43949 / 3105-77)
A0KMY1 0.0 765 75 0 487 3 dtpB Dipeptide and tripeptide permease B Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
D0ZGL2 0.0 753 74 0 477 3 dtpB Dipeptide and tripeptide permease B Edwardsiella tarda (strain EIB202)
D3V3D1 0.0 744 73 1 489 3 dtpB Dipeptide and tripeptide permease B Xenorhabdus bovienii (strain SS-2004)
A1JRI8 0.0 740 72 0 486 3 dtpB Dipeptide and tripeptide permease B Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q8ZLD6 0.0 735 73 1 488 3 dtpB Dipeptide and tripeptide permease B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P36837 0.0 735 71 0 488 1 dtpB Dipeptide and tripeptide permease B Escherichia coli (strain K12)
Q32AW5 0.0 728 71 0 488 3 dtpB Dipeptide and tripeptide permease B Shigella dysenteriae serotype 1 (strain Sd197)
B5FDK5 0.0 625 61 0 482 3 dtpB Dipeptide and tripeptide permease B Aliivibrio fischeri (strain MJ11)
A8AH15 7.05e-180 516 53 5 490 3 dtpA Dipeptide and tripeptide permease A Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C9Y3M8 8.72e-179 513 52 3 489 3 dtpA Dipeptide and tripeptide permease A Cronobacter turicensis (strain DSM 18703 / CCUG 55852 / LMG 23827 / z3032)
Q8X651 2.92e-177 509 53 2 483 3 dtpA Dipeptide and tripeptide permease A Escherichia coli O157:H7
Q8FH91 4.88e-177 509 53 2 483 3 dtpA Dipeptide and tripeptide permease A Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZPM6 7.64e-177 509 51 4 489 2 dtpA Dipeptide and tripeptide permease A Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P77304 8.33e-177 508 52 2 483 1 dtpA Dipeptide and tripeptide permease A Escherichia coli (strain K12)
Q8Z6Q5 1.18e-176 508 51 4 489 3 dtpA Dipeptide and tripeptide permease A Salmonella typhi
B5XWP3 2.82e-175 504 51 3 489 3 dtpA Dipeptide and tripeptide permease A Klebsiella pneumoniae (strain 342)
A4W9W3 2.91e-174 502 52 2 484 3 dtpA Dipeptide and tripeptide permease A Enterobacter sp. (strain 638)
D2TBH1 1.19e-172 498 51 2 485 3 dtpA Dipeptide and tripeptide permease A Erwinia pyrifoliae (strain DSM 12163 / CIP 106111 / Ep16/96)
B4EY98 4.45e-170 491 51 3 483 3 dtpA Dipeptide and tripeptide permease A Proteus mirabilis (strain HI4320)
C6DH09 1.25e-169 490 49 2 487 3 dtpA Dipeptide and tripeptide permease A Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q0WEG0 1.33e-169 490 52 4 484 3 dtpA Dipeptide and tripeptide permease A Yersinia pestis
D0Z7W2 8.74e-169 488 51 4 484 3 dtpA Dipeptide and tripeptide permease A Edwardsiella tarda (strain EIB202)
A8GDZ4 1.07e-163 475 52 3 483 3 dtpA Dipeptide and tripeptide permease A Serratia proteamaculans (strain 568)
Q7NRM5 2.12e-163 474 51 2 480 3 dtpA Dipeptide and tripeptide permease A Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A0A2R9TD79 3.12e-55 195 28 11 512 1 YEP4_02370 Peptide transporter YePEPT Yersinia enterocolitica subsp. palearctica serotype O:3 (strain YE-P4)
C0PWD2 2.59e-52 187 27 8 466 3 dtpD Dipeptide permease D Salmonella paratyphi C (strain RKS4594)
Q57RM6 5.11e-52 186 27 8 466 3 dtpD Dipeptide permease D Salmonella choleraesuis (strain SC-B67)
Q7CQY0 6.22e-52 186 27 8 466 3 dtpD Dipeptide permease D Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZQC5 6.22e-52 186 27 8 466 3 dtpD Dipeptide permease D Salmonella typhimurium (strain 14028s / SGSC 2262)
Q8X9D3 2.81e-50 182 26 9 465 1 dtpD Dipeptide permease D Escherichia coli O157:H7
Q83S84 3.64e-50 181 27 10 477 3 dtpD Dipeptide permease D Shigella flexneri
P75742 4.2e-50 181 27 10 477 1 dtpD Dipeptide permease D Escherichia coli (strain K12)
B5XZE5 6.74e-50 181 27 6 443 3 dtpD Dipeptide permease D Klebsiella pneumoniae (strain 342)
A6T6E2 1.32e-49 180 27 6 443 3 dtpD Dipeptide permease D Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P94408 1.92e-49 179 29 10 438 3 yclF Uncharacterized transporter YclF Bacillus subtilis (strain 168)
A8AJB3 5.09e-49 178 26 10 479 3 dtpD Dipeptide permease D Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
D2TNL4 4.85e-48 176 27 10 478 3 dtpD Dipeptide permease D Citrobacter rodentium (strain ICC168)
P0C2U2 8.9e-48 175 27 12 454 3 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. lactis (strain IL1403)
A2RMA8 2.78e-46 171 27 13 462 3 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. cremoris (strain MG1363)
P0C2U3 2.78e-46 171 27 13 462 1 dtpT Di-/tripeptide transporter Lactococcus lactis subsp. cremoris
P39276 6.07e-39 150 28 9 440 1 dtpC Dipeptide and tripeptide permease C Escherichia coli (strain K12)
Q9ES07 2.87e-16 85 25 13 386 1 Slc15a2 Solute carrier family 15 member 2 Mus musculus
P36836 1.7e-15 82 24 13 409 1 SLC15A1 Solute carrier family 15 member 1 Oryctolagus cuniculus
P91679 1.91e-15 82 25 9 336 1 yin Peptide transporter family 1 Drosophila melanogaster
Q16348 2.09e-15 82 25 11 369 1 SLC15A2 Solute carrier family 15 member 2 Homo sapiens
Q63424 3.65e-15 82 25 14 388 1 Slc15a2 Solute carrier family 15 member 2 Rattus norvegicus
Q8WMX5 7.91e-15 80 23 13 402 2 SLC15A1 Solute carrier family 15 member 1 Canis lupus familiaris
P51574 8.29e-15 80 24 9 396 2 Slc15a1 Solute carrier family 15 member 1 Rattus norvegicus
Q9JIP7 1.2e-14 80 24 12 403 1 Slc15a1 Solute carrier family 15 member 1 Mus musculus
P46029 2.26e-14 79 28 5 242 1 SLC15A2 Solute carrier family 15 member 2 Oryctolagus cuniculus
O07380 2.91e-14 78 26 2 180 3 dtpT Di-/tripeptide transporter Lactobacillus helveticus
B0S6T2 1.4e-13 77 24 10 341 1 slc15a2 Solute carrier family 15 member 2 Danio rerio
P46059 1.56e-12 73 23 12 395 1 SLC15A1 Solute carrier family 15 member 1 Homo sapiens
Q17758 1.34e-11 70 25 9 336 1 pept-2 Peptide transporter family 2 Caenorhabditis elegans
Q21219 2.95e-11 69 30 3 193 2 pept-1 Peptide transporter family 1 Caenorhabditis elegans
O01840 2.59e-08 60 26 2 169 1 pept-3 Peptide transporter 3 Caenorhabditis elegans
Q9M1I2 2.9e-08 59 26 2 183 2 NPF5.4 Protein NRT1/ PTR FAMILY 5.4 Arabidopsis thaliana
Q9SK99 9.77e-08 58 24 4 201 2 NPF5.15 Protein NRT1/ PTR FAMILY 5.15 Arabidopsis thaliana
Q8VZE2 8.27e-07 55 25 3 196 2 NPF5.14 Protein NRT1/ PTR FAMILY 5.14 Arabidopsis thaliana
P32901 2.93e-06 53 23 22 535 1 PTR2 Peptide transporter PTR2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9SK96 4.91e-06 52 21 7 338 2 NPF5.16 Protein NRT1/ PTR FAMILY 5.16 Arabidopsis thaliana
Q9FNL7 5.21e-06 52 22 2 224 2 NPF5.2 Protein NRT1/ PTR FAMILY 5.2 Arabidopsis thaliana
Q05085 4.04e-05 50 24 2 201 1 NPF6.3 Protein NRT1/ PTR FAMILY 6.3 Arabidopsis thaliana
P46032 6.26e-05 49 26 5 252 1 NPF8.3 Protein NRT1/ PTR FAMILY 8.3 Arabidopsis thaliana
Q9C7U1 0.000109 48 24 7 299 2 NPF5.12 Protein NRT1/ PTR FAMILY 5.12 Arabidopsis thaliana
Q9FNL8 0.00014 48 22 3 208 2 NPF5.3 Protein NRT1/ PTR FAMILY 5.3 Arabidopsis thaliana
Q84WG0 0.000166 47 25 5 219 2 NPF8.4 Protein NRT1/ PTR FAMILY 8.4 Arabidopsis thaliana
Q0WP01 0.000179 47 27 3 218 2 NPF5.10 Protein NRT1/ PTR FAMILY 5.10 Arabidopsis thaliana
Q0WSZ6 0.000322 47 24 4 208 2 NPF5.13 Protein NRT1/ PTR FAMILY 5.13 Arabidopsis thaliana
Q9M390 0.000333 47 24 4 199 1 NPF8.1 Protein NRT1/ PTR FAMILY 8.1 Arabidopsis thaliana
Q9LVE0 0.000391 46 25 3 210 1 NPF6.4 Protein NRT1/ PTR FAMILY 6.4 Arabidopsis thaliana
Q9LFB8 0.000791 45 24 2 182 2 NPF8.2 Protein NRT1/ PTR FAMILY 8.2 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11845
Feature type CDS
Gene dtpB
Product dipeptide/tripeptide permease DtpB
Location 144701 - 146170 (strand: 1)
Length 1470 (nucleotides) / 489 (amino acids)

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_372
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00854 POT family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3104 Amino acid transport and metabolism (E) E Dipeptide/tripeptide permease

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03305 proton-dependent oligopeptide transporter, POT family - -

Protein Sequence

MSKPAQVGLFNQPKPFFMIFIVELWERFGYYGVQGILAVYFVQKLGFSQEQAFITFGAFAALVYGLISIGGYVGDHVLGTKRTIILGAIVMAVGYFMTGLSIMHPDLIFYALGTIAVGNGLFKANPASLLAKCYPPKDPRLDGAFTLFYMSINIGSLISLSLAPVIADKYSYTVTYNICGIGLLIALAVFLFCQKMVRNIGSEPDHKPIKFGSLLVVIAGSVATVFLCAWLLHNVIIANYVLLGVTAVVIFFFFREAFKLKGVERNKMYVAFVLMLEAVIFYVLYAQMPTSLNFFAIYNVHHTIMGIDVHPVSFQALNPFWIIVLSPVLAYFYSKMGARGKDFSMPGKFTIGMFCCSAGFLTAAASGMWFADASGLTSPWFIVLVYFFQAVGELMISALGLAMVAAFVPQYLMGFILGMWFLTQAMATLLGGYVATFTAPPEGVTDPLQTLGIYTDVFGKIGIATAVAGLIMWAIVPKLNKIMKEEKTA

Flanking regions ( +/- flanking 50bp)

CCGGGAAGGCTTTTGCGTGATGAATAATTATTAATAAGAGGCATTAAACCATGAGTAAACCCGCGCAGGTTGGTTTGTTTAACCAACCCAAGCCATTCTTCATGATTTTTATCGTGGAGCTGTGGGAACGCTTCGGCTATTACGGTGTGCAAGGCATCCTGGCCGTCTACTTTGTTCAGAAACTGGGATTCAGTCAGGAACAGGCATTCATCACCTTCGGGGCATTCGCCGCGCTGGTATACGGTCTGATCTCCATCGGTGGTTACGTCGGTGACCACGTCCTCGGGACCAAACGGACCATCATCTTAGGGGCCATCGTGATGGCTGTCGGTTATTTTATGACCGGCCTGTCTATCATGCACCCGGATCTGATTTTCTACGCACTGGGTACCATTGCTGTCGGTAACGGCTTATTCAAAGCCAACCCGGCCAGTCTGCTGGCAAAATGCTATCCGCCGAAAGACCCGCGTCTGGACGGGGCATTCACCCTGTTCTATATGTCGATCAACATCGGCTCTCTGATTTCCCTGTCACTGGCACCGGTTATCGCGGACAAATACAGCTATACCGTTACTTATAACATCTGTGGTATCGGCCTGCTGATCGCCCTGGCGGTCTTCCTGTTCTGTCAGAAAATGGTGCGTAATATCGGTTCCGAGCCGGATCACAAACCAATAAAATTCGGCAGCCTGCTGGTCGTCATCGCCGGTAGTGTGGCAACTGTTTTCCTGTGTGCATGGTTACTGCACAACGTCATTATTGCCAACTATGTGTTACTCGGCGTCACCGCTGTGGTTATCTTCTTCTTCTTCCGCGAAGCCTTCAAACTGAAAGGCGTTGAGCGGAACAAGATGTATGTGGCGTTTGTTCTGATGCTGGAAGCGGTTATCTTCTATGTGCTGTATGCCCAGATGCCGACTTCACTGAACTTCTTCGCTATCTATAACGTACATCACACCATTATGGGTATTGATGTGCATCCGGTCAGCTTCCAGGCACTGAACCCGTTCTGGATCATCGTACTGAGCCCGGTTCTGGCTTACTTCTACAGCAAGATGGGCGCACGCGGCAAAGACTTCTCCATGCCGGGTAAATTCACCATCGGTATGTTCTGCTGCTCCGCCGGTTTCCTGACAGCCGCTGCTTCCGGTATGTGGTTTGCCGATGCGTCCGGTCTGACATCTCCGTGGTTTATCGTTCTGGTTTACTTCTTCCAGGCAGTTGGTGAGCTGATGATCAGTGCGCTGGGTCTGGCGATGGTGGCTGCGTTCGTTCCGCAGTACCTGATGGGCTTTATTCTCGGGATGTGGTTCCTGACCCAGGCAATGGCAACACTGCTGGGCGGCTACGTGGCGACCTTTACCGCACCACCGGAAGGCGTGACTGATCCGCTTCAGACTCTCGGTATCTACACTGATGTGTTCGGTAAAATCGGTATCGCAACGGCAGTTGCCGGCCTGATTATGTGGGCTATCGTACCGAAACTGAACAAAATCATGAAAGAAGAAAAAACAGCCTGATTGTGTTAACCGGTGCGGCGGCACCGGTTTTCCGTCTCGTTTGCGTAATG