Homologs in group_1914

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14010 FBDBKF_14010 52.5 Morganella morganii S1 btuF vitamin B12 ABC transporter substrate-binding protein BtuF
EHELCC_11685 EHELCC_11685 52.5 Morganella morganii S2 btuF vitamin B12 ABC transporter substrate-binding protein BtuF
NLDBIP_12025 NLDBIP_12025 52.5 Morganella morganii S4 btuF vitamin B12 ABC transporter substrate-binding protein BtuF
LHKJJB_11885 LHKJJB_11885 52.5 Morganella morganii S3 btuF vitamin B12 ABC transporter substrate-binding protein BtuF
HKOGLL_10500 HKOGLL_10500 52.5 Morganella morganii S5 btuF vitamin B12 ABC transporter substrate-binding protein BtuF
F4V73_RS12865 F4V73_RS12865 51.9 Morganella psychrotolerans btuF vitamin B12 ABC transporter substrate-binding protein BtuF

Distribution of the homologs in the orthogroup group_1914

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1914

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
A4TPX1 4.19e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pestis (strain Pestoides F)
Q1CLU2 4.19e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pestis bv. Antiqua (strain Nepal516)
A9R1E1 4.19e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pestis bv. Antiqua (strain Angola)
Q8ZBM3 4.19e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pestis
Q1C3X6 4.19e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pestis bv. Antiqua (strain Antiqua)
Q66EE7 5.04e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K552 5.04e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FM05 5.04e-110 322 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JK18 1.45e-109 321 58 2 261 3 btuF Vitamin B12-binding protein Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q7N842 3.37e-107 315 59 1 248 3 btuF Vitamin B12-binding protein Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6D1Z3 1.76e-100 298 55 3 270 3 btuF Vitamin B12-binding protein Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DC28 1.74e-99 295 54 4 268 3 btuF Vitamin B12-binding protein Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q57T49 2.41e-88 266 48 4 270 3 btuF Vitamin B12-binding protein Salmonella choleraesuis (strain SC-B67)
Q8ZRP7 3.17e-88 266 48 4 270 3 btuF Vitamin B12-binding protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PD47 3.35e-88 266 49 4 270 3 btuF Vitamin B12-binding protein Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P37028 2.14e-87 264 50 4 266 1 btuF Vitamin B12-binding protein Escherichia coli (strain K12)
Q8CWD2 2.16e-87 264 50 4 266 3 btuF Vitamin B12-binding protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83MD7 3.06e-87 263 50 4 266 3 btuF Vitamin B12-binding protein Shigella flexneri
Q8X8Z0 7.16e-87 263 50 4 266 3 btuF Vitamin B12-binding protein Escherichia coli O157:H7
Q8Z9B2 2.08e-86 261 48 4 270 3 btuF Vitamin B12-binding protein Salmonella typhi
C3LQF3 2.27e-69 218 43 2 264 3 btuF Vitamin B12-binding protein Vibrio cholerae serotype O1 (strain M66-2)
Q9KPI6 2.27e-69 218 43 2 264 3 btuF Vitamin B12-binding protein Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5P5 2.27e-69 218 43 2 264 1 btuF Vitamin B12-binding protein Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q87SE7 1.79e-66 211 38 3 271 3 btuF Vitamin B12-binding protein Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7MXP0 5.94e-65 207 38 4 273 3 btuF Vitamin B12-binding protein Vibrio campbellii (strain ATCC BAA-1116)
Q8DEM7 8.04e-64 204 41 5 254 3 btuF Vitamin B12-binding protein Vibrio vulnificus (strain CMCP6)
Q6LUR6 2.15e-63 203 38 3 272 3 btuF Vitamin B12-binding protein Photobacterium profundum (strain SS9)
Q7MNT2 5.65e-63 202 40 5 254 3 btuF Vitamin B12-binding protein Vibrio vulnificus (strain YJ016)
O34805 7.77e-24 101 26 8 253 3 yvrC Uncharacterized ABC transporter substrate-binding lipoprotein YvrC Bacillus subtilis (strain 168)
Q56991 2.55e-14 74 27 6 227 1 hmuT Hemin-binding periplasmic protein HmuT Yersinia pestis
Q9HQ20 4.3e-13 72 22 8 262 1 btuF Cobalamin-binding protein Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R5G2 4.3e-13 72 22 8 262 3 btuF Cobalamin-binding protein Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01025
Feature type CDS
Gene btuF
Product vitamin B12 ABC transporter substrate-binding protein BtuF
Location 252452 - 253282 (strand: -1)
Length 831 (nucleotides) / 276 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1914
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01497 Periplasmic binding protein

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0614 Inorganic ion transport and metabolism (P) P ABC-type Fe3+-hydroxamate transport system, periplasmic component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06858 vitamin B12 transport system substrate-binding protein ABC transporters -

Protein Sequence

MRFLNTFALLLSLILTPCYVIAATPAQRVITLSPSATEMAYAAGMGENMVAASAYSDYPQAAKDLVQVADWQGINVERILLLKPDLIIAWPSGNPQRPLDQLKSLGIPIIYSDPHSIEEIIDDLTRLSSYSTHPEVALASAQKLRQQYQELQQKYASTTPHQAKKKVFIQFGMQPLFTTSKHSLQNEITELCGGENIFANSAVPWPQVSREQVISKKPDLILFSGKPNQIAAIQQFWQPQLDIPIIAIDEDSFSRPAPRIIYAAQQICEAIKDNNK

Flanking regions ( +/- flanking 50bp)

GCAGGTAAGATAAAAATAGACGGGTATATTTGACTATAAAGACGAGAAAAATGCGTTTCTTAAACACTTTTGCACTGCTGCTAAGCCTGATATTGACACCTTGTTATGTTATCGCAGCCACTCCCGCACAACGTGTTATTACTTTATCCCCGTCTGCCACGGAAATGGCTTATGCCGCAGGTATGGGAGAGAATATGGTTGCGGCGAGCGCTTATTCTGATTATCCACAAGCAGCAAAAGATCTCGTACAAGTTGCCGACTGGCAAGGCATTAATGTAGAACGCATTTTGCTATTAAAACCTGATTTAATTATTGCATGGCCAAGCGGTAATCCTCAACGACCGCTCGATCAGTTAAAATCATTGGGTATCCCTATTATTTACTCTGATCCACACAGTATCGAAGAAATCATTGACGATCTTACCCGACTTTCTTCTTATAGCACTCATCCTGAAGTCGCTTTAGCAAGTGCACAAAAATTACGTCAGCAATATCAAGAATTACAGCAAAAGTACGCCTCAACGACGCCTCATCAAGCGAAGAAAAAAGTCTTTATTCAATTTGGTATGCAACCCCTATTTACGACATCAAAACATTCATTACAAAATGAGATTACCGAACTTTGTGGCGGAGAAAATATTTTTGCGAATAGTGCAGTTCCTTGGCCACAAGTCAGCCGCGAGCAAGTGATCAGTAAAAAACCTGATTTGATTTTATTTAGTGGTAAACCAAACCAAATTGCCGCAATACAACAATTTTGGCAACCTCAACTAGATATTCCTATTATCGCTATTGATGAAGATAGTTTTAGCAGACCAGCACCACGTATTATTTATGCGGCTCAACAGATTTGTGAGGCTATTAAAGATAATAATAAGTAAAATCAATAATATTAGTCTAGTCTGTTTTTTATTAATTATTACGATGACGG