Homologs in group_300

Help

7 homologs were identified in 7 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07920 FBDBKF_07920 85.1 Morganella morganii S1 - Iron ABC transporter permease
EHELCC_13750 EHELCC_13750 85.1 Morganella morganii S2 - Iron ABC transporter permease
NLDBIP_14195 NLDBIP_14195 85.1 Morganella morganii S4 - Iron ABC transporter permease
LHKJJB_08655 LHKJJB_08655 85.1 Morganella morganii S3 - Iron ABC transporter permease
HKOGLL_08205 HKOGLL_08205 85.1 Morganella morganii S5 - Iron ABC transporter permease
F4V73_RS13065 F4V73_RS13065 85.1 Morganella psychrotolerans - iron ABC transporter permease
PMI_RS15200 PMI_RS15200 29.1 Proteus mirabilis HI4320 - putative 2-aminoethylphosphonate ABC transporter permease subunit

Distribution of the homologs in the orthogroup group_300

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_300

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q44123 0.0 879 64 3 686 3 fbpB Ferric transport system permease protein FbpB Actinobacillus pleuropneumoniae
Q57341 0.0 738 61 4 622 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57341 0.000509 47 31 2 104 3 fbpB1 Putative ferric transport system permease protein FbpB 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75681 4.93e-61 202 90 0 113 5 afuB Putative ferric transport system permease-like protein AfuB Escherichia coli (strain K12)
Q9TJR4 3.92e-16 82 30 3 202 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
Q9TJR4 1.4e-13 74 30 2 162 3 cysT Probable sulfate transport system permease protein cysT Prototheca wickerhamii
A2CI71 8.19e-15 79 28 2 204 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
A2CI71 1.21e-06 54 24 4 205 3 cysT Probable sulfate transport system permease protein cysT Chlorokybus atmophyticus
P26246 1.62e-14 78 26 2 202 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
P26246 6.43e-06 52 21 3 201 3 cysT Probable sulfate transport system permease protein cysT Marchantia polymorpha
O30143 3.29e-14 76 27 4 232 1 wtpB Molybdate/tungstate transport system permease protein WtpB Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q9TKU8 4.63e-14 76 28 2 190 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
Q9TKU8 1.57e-06 53 25 3 153 3 cysT Probable sulfate transport system permease protein cysT Nephroselmis olivacea
P18795 1.16e-13 75 24 6 225 3 nifC Probable transport system permease protein NifC Clostridium pasteurianum
P56343 6.94e-13 72 28 3 211 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
P56343 9.01e-10 63 24 6 239 3 cysT Probable sulfate transport system permease protein cysT Chlorella vulgaris
Q9MUL9 1.23e-12 72 27 3 198 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
Q9MUL9 3.7e-07 55 23 2 162 3 cysT Probable sulfate transport system permease protein cysT Mesostigma viride
P71338 1.95e-12 73 21 10 497 3 fbpB2 Fe(3+)-transport system permease protein FbpB 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P41032 3.41e-12 70 27 2 190 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P41032 2.21e-10 65 25 4 211 3 cysU Sulfate transport system permease protein CysT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P16701 3.99e-12 70 27 2 190 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
P16701 2.22e-11 68 25 4 211 3 cysU Sulfate transport system permease protein CysT Escherichia coli (strain K12)
Q32RF7 4.14e-12 70 28 3 204 3 cysT Probable sulfate transport system permease protein cysT Zygnema circumcarinatum
P45322 9.59e-12 68 27 5 199 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45322 0.000385 46 25 2 145 3 modB Molybdenum transport system permease protein ModB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37731 4.01e-11 67 29 5 182 3 modB Molybdenum transport system permease protein ModB Azotobacter vinelandii
P55452 4.76e-11 69 23 12 463 3 NGR_a03680 Probable ABC transporter permease protein y4fN Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9V2C1 6.03e-11 66 24 2 200 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus abyssi (strain GE5 / Orsay)
O57893 1.35e-10 65 26 4 203 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q2EEX6 3.48e-10 65 28 1 163 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q2EEX6 4.23e-09 61 25 4 208 3 cysT Probable sulfate transport system permease protein cysT Helicosporidium sp. subsp. Simulium jonesii
Q5JEB3 1.01e-09 63 24 2 198 3 wtpB Molybdate/tungstate transport system permease protein WtpB Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q6QJE2 6.52e-09 62 25 7 247 1 SULP2 Sulfate permease 2, chloroplastic Chlamydomonas reinhardtii
P27367 1.18e-08 60 27 3 197 2 cysT Sulfate transport system permease protein CysT Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P27367 9.73e-05 48 25 3 202 2 cysT Sulfate transport system permease protein CysT Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8RVC7 1.18e-08 61 29 3 203 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
Q8RVC7 2.09e-05 51 27 4 197 1 SULP1 Sulfate permease 1, chloroplastic Chlamydomonas reinhardtii
Q58763 1.86e-08 59 29 3 158 3 wtpB Molybdate/tungstate transport system permease protein WtpB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8U4K4 2.41e-08 58 24 3 200 3 wtpB Molybdate/tungstate transport system permease protein WtpB Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P27370 1.63e-07 57 22 2 238 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P27370 0.000133 48 23 4 213 2 cysW Sulfate transport system permease protein CysW Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0AEB0 1.83e-06 53 22 5 245 1 cysW Sulfate transport system permease protein CysW Escherichia coli (strain K12)
P0AEB1 1.83e-06 53 22 5 245 3 cysW Sulfate transport system permease protein CysW Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q5PFQ5 2.13e-06 53 27 8 255 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q08382 2.67e-06 52 26 5 179 3 modB Molybdenum transport system permease protein ModB Rhodobacter capsulatus
Q8Z8X0 2.83e-06 53 26 7 247 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhi
Q01895 3.53e-06 52 26 4 188 2 cysT Sulfate transport system permease protein CysT Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P31549 3.54e-06 53 21 11 462 1 thiP Thiamine transport system permease protein ThiP Escherichia coli (strain K12)
P74547 5.77e-06 52 21 5 230 3 cysW Sulfate transport system permease protein CysW Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8Z8W9 1.09e-05 51 24 3 182 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhi
P96064 1.16e-05 51 26 3 158 2 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PFQ6 1.19e-05 51 26 3 158 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57SD8 1.51e-05 50 26 7 247 3 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella choleraesuis (strain SC-B67)
P96065 1.65e-05 50 27 8 255 2 phnV Putative 2-aminoethylphosphonate transport system permease protein PhnV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P47290 2.35e-05 50 23 5 202 3 potC Spermidine/putrescine transport system permease protein PotC homolog Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q85AI0 4.09e-05 49 26 3 188 2 cysT Probable sulfate transport system permease protein cysT Anthoceros angustus
Q57SD7 4.84e-05 49 26 3 158 3 phnU Putative 2-aminoethylphosphonate transport system permease protein PhnU Salmonella choleraesuis (strain SC-B67)
P0AF01 5.02e-05 48 28 5 172 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF01 0.000112 47 25 7 233 1 modB Molybdenum transport system permease protein ModB Escherichia coli (strain K12)
P0AF02 5.02e-05 48 28 5 172 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
P0AF02 0.000112 47 25 7 233 3 modB Molybdenum transport system permease protein ModB Escherichia coli O157:H7
Q8ZRV1 0.000102 49 21 9 389 1 thiP Thiamine transport system permease protein ThiP Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0CL49 0.000102 48 23 5 221 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WF94 0.000102 48 23 5 221 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhimurium (strain SL1344)
P0A2J8 0.000102 48 23 5 221 3 potB Spermidine/putrescine transport system permease protein PotB Salmonella typhi
P0AFS0 0.000146 47 30 3 165 3 ydcV Inner membrane ABC transporter permease protein YdcV Shigella flexneri
P0AFR9 0.000146 47 30 3 165 1 ydcV Inner membrane ABC transporter permease protein YdcV Escherichia coli (strain K12)
P0AFK5 0.000164 47 23 2 169 3 potB Spermidine/putrescine transport system permease protein PotB Shigella flexneri
P0AFK4 0.000164 47 23 2 169 1 potB Spermidine/putrescine transport system permease protein PotB Escherichia coli (strain K12)
O32209 0.000371 46 24 3 161 3 yvgM Putative molybdenum transport system permease protein YvgM Bacillus subtilis (strain 168)
D4GQ17 0.000755 45 21 2 201 3 HVO_B0370 Probable molybdenum ABC transporter permease protein HVO_B0370 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P21409 0.000824 46 20 10 473 3 fbpB Fe(3+)-transport system permease protein SfuB Serratia marcescens

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00910
Feature type CDS
Gene -
Product iron ABC transporter permease
Location 224095 - 226173 (strand: -1)
Length 2079 (nucleotides) / 692 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_300
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1178 Inorganic ion transport and metabolism (P) P ABC-type Fe3+ transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02011 iron(III) transport system permease protein ABC transporters -

Protein Sequence

MSHTLALSEKKRWDPIFLWILIAWMAFILMPSWSLDYGLFDSTADELLTSYGWSNLNISLLWFLLPSILLIRPLHPVGRENRIRHYFDASFAFFCAFITIVTATMEGRGLGYSVIVLFISLGMIAKHALTRLEWLGGDSFVIGSLITVVALIGVFIIFPSVAIFIPMFQDSAGNFAPFEFIAILSQAHIVQVMINSILLSIAVGIGCTFFGLILAIYTSRIAVRSAIIGRVFSILPIVTPPFVVGLGVTLMMGRSGYITEFLATYAGLENTNWLYGFTGIWLAQVLAFTPMSFMILDGAIKTIHPSLEEASYTLRANRYQTFFHVFMPLLKPALANAFLIVIVQSLADFSNPLVLGGNFDVIATQIYFYITGSQLDYQAASTLGASLLVFSLLVFCIQYMWIGKRSYVTVSGKSYRGDVQPLPTSLVTFVTSVLGIWVIFNILLYGSIFYGSFTVNWGVDYTLTFDNFIKLFGQGMSDGAWPSLLDTLLYAGIAAPITAILGLLIAYIVVRQDFKGKKSIEFTTMLCFAVPGTVAGVSYILAFNDSPFYLTGTAAIVIISMTMRNVPVGIRAGIAGLGQIDKSLDEASLSLRANSMRTILYVLLPLLRPAILSALIYSFVRAITTVSAIVFLVTPETRVATAYILNRVEDGEYGVAIAYGSILIIVMLAIIFLFDYLIGEARVSRSKAKNAQ

Flanking regions ( +/- flanking 50bp)

CTCGCTCTTTTTTTTACATAATAATAATGAGCTTTACTGTCGGGGGATTTATGTCTCACACACTCGCTTTGTCTGAAAAAAAGAGGTGGGATCCCATATTTTTATGGATCCTGATTGCATGGATGGCATTTATATTAATGCCTTCATGGAGCCTTGATTATGGTCTATTTGATTCTACCGCAGATGAATTACTTACCTCTTATGGCTGGAGTAACTTAAATATCAGTCTGCTCTGGTTTTTACTTCCCAGCATACTATTAATTCGTCCTTTACATCCTGTAGGGCGAGAAAATCGTATTCGCCACTATTTTGATGCAAGTTTTGCCTTTTTCTGCGCCTTTATCACTATTGTTACCGCAACGATGGAAGGTCGTGGTCTGGGTTATTCGGTTATCGTGCTATTTATTTCATTAGGAATGATAGCCAAGCATGCTTTAACACGCTTAGAGTGGTTAGGGGGTGATAGCTTTGTGATTGGCTCATTAATCACAGTTGTCGCCTTAATCGGTGTTTTTATTATCTTTCCAAGTGTCGCTATCTTTATTCCGATGTTTCAAGATAGTGCTGGCAATTTTGCCCCCTTTGAATTTATTGCCATTCTCAGCCAAGCCCATATTGTTCAGGTGATGATCAATTCAATCTTACTGTCTATCGCAGTTGGTATTGGCTGTACTTTTTTTGGTTTGATCCTCGCCATTTATACATCACGTATTGCAGTAAGATCAGCGATTATTGGTCGAGTATTTTCTATTTTACCTATTGTCACTCCCCCTTTTGTTGTGGGTTTAGGTGTGACCTTGATGATGGGACGTTCAGGTTATATCACTGAATTTTTGGCAACTTATGCAGGTTTAGAAAATACCAACTGGTTATATGGCTTTACGGGAATTTGGCTTGCACAAGTACTTGCCTTTACCCCTATGTCTTTTATGATCTTAGATGGTGCAATTAAAACTATCCATCCGTCATTAGAAGAGGCTTCTTATACCCTTAGAGCTAATCGCTACCAAACATTCTTTCATGTTTTTATGCCGTTACTAAAACCAGCATTAGCCAATGCCTTTTTGATCGTTATAGTGCAATCATTGGCTGATTTTAGTAACCCATTGGTGCTAGGTGGCAACTTTGACGTGATTGCCACTCAAATTTATTTCTATATCACCGGCTCTCAACTTGATTACCAAGCAGCAAGTACGTTAGGTGCTTCACTGTTGGTATTCTCATTATTAGTGTTCTGCATTCAATATATGTGGATTGGCAAACGCTCATATGTCACGGTGTCAGGTAAATCCTATCGTGGTGATGTTCAACCATTACCCACCTCCTTAGTAACCTTTGTCACTAGCGTGTTGGGTATTTGGGTTATCTTTAATATCTTACTCTATGGCAGCATTTTCTACGGCAGTTTTACGGTTAACTGGGGTGTGGATTACACCTTAACCTTTGATAACTTTATTAAATTATTTGGTCAAGGGATGAGCGATGGCGCATGGCCATCATTACTTGATACCTTACTTTATGCGGGTATCGCAGCACCTATTACCGCTATTTTAGGGCTTTTGATCGCCTATATTGTCGTGCGCCAAGATTTTAAAGGTAAAAAGAGTATCGAATTTACGACTATGCTCTGTTTTGCCGTTCCCGGTACTGTTGCGGGGGTCTCTTATATCTTGGCATTTAATGATTCACCGTTTTATTTAACAGGAACGGCAGCCATTGTGATTATCTCAATGACCATGCGTAACGTGCCCGTGGGAATACGAGCGGGTATTGCAGGATTAGGGCAAATCGATAAATCGTTGGATGAGGCGTCATTAAGTTTAAGAGCAAATTCAATGCGAACTATTTTGTATGTGCTATTGCCTTTATTACGCCCCGCGATTTTATCCGCTTTAATTTATAGTTTTGTCCGCGCGATAACCACCGTCAGTGCGATTGTATTCTTAGTCACCCCTGAAACTCGCGTTGCTACCGCTTATATTTTAAATCGTGTTGAGGATGGTGAATACGGCGTCGCAATTGCCTATGGCTCGATTTTAATCATCGTGATGTTGGCTATTATTTTCTTATTTGACTATTTGATTGGCGAAGCCCGTGTTTCACGCTCTAAAGCCAAAAATGCACAGTAATACGGAGTATAAATCATGACACAATCACATTTCGTTGAACTGAAAAATAT