Homologs in group_2056

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15415 FBDBKF_15415 63.3 Morganella morganii S1 rbsD D-ribose pyranase
EHELCC_15775 EHELCC_15775 63.3 Morganella morganii S2 rbsD D-ribose pyranase
NLDBIP_16595 NLDBIP_16595 63.3 Morganella morganii S4 rbsD D-ribose pyranase
LHKJJB_16210 LHKJJB_16210 63.3 Morganella morganii S3 rbsD D-ribose pyranase
HKOGLL_15980 HKOGLL_15980 63.3 Morganella morganii S5 rbsD D-ribose pyranase
F4V73_RS17730 F4V73_RS17730 62.6 Morganella psychrotolerans rbsD D-ribose pyranase

Distribution of the homologs in the orthogroup group_2056

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2056

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EU30 2.09e-99 284 100 0 139 3 rbsD D-ribose pyranase Proteus mirabilis (strain HI4320)
Q0TAW1 4.88e-59 182 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N2I7 4.88e-59 182 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O81 (strain ED1a)
A8ACQ4 1.82e-58 180 60 0 139 3 rbsD D-ribose pyranase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A4WGD9 2.29e-58 180 60 0 139 3 rbsD D-ribose pyranase Enterobacter sp. (strain 638)
Q8FBS4 2.44e-58 180 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UML3 2.98e-58 180 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R4I4 5.68e-58 179 61 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain UTI89 / UPEC)
A1AHS8 5.68e-58 179 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O1:K1 / APEC
B7MGG8 5.68e-58 179 61 0 139 3 rbsD D-ribose pyranase Escherichia coli O45:K1 (strain S88 / ExPEC)
P04982 6.99e-58 179 60 0 139 1 rbsD D-ribose pyranase Escherichia coli (strain K12)
B1X9X5 6.99e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain K12 / DH10B)
C4ZZ26 6.99e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain K12 / MC4100 / BW2952)
B5YY06 6.99e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW8 6.99e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli O157:H7
Q3YVK9 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Shigella sonnei (strain Ss046)
Q83PJ1 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Shigella flexneri
Q0SYV0 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Shigella flexneri serotype 5b (strain 8401)
Q31UM5 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Shigella boydii serotype 4 (strain Sb227)
B2TU31 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LK93 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LL75 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain SMS-3-5 / SECEC)
B7NF64 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1IWZ0 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6L1 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli O9:H4 (strain HS)
B7NR51 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7L894 8.71e-58 179 60 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain 55989 / EAEC)
Q8ZKW0 9.3e-58 179 59 0 139 1 rbsD D-ribose pyranase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TN49 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella schwarzengrund (strain CVM19633)
B5BIQ2 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella paratyphi A (strain AKU_12601)
C0Q2P8 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella paratyphi C (strain RKS4594)
Q5PJX6 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYE9 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella newport (strain SL254)
B4TAZ0 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella heidelberg (strain SL476)
B5RFU7 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVE8 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella enteritidis PT4 (strain P125109)
B5FN51 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella dublin (strain CT_02021853)
Q57HW2 9.3e-58 179 59 0 139 3 rbsD D-ribose pyranase Salmonella choleraesuis (strain SC-B67)
B5EZ14 1.28e-57 178 59 0 139 3 rbsD D-ribose pyranase Salmonella agona (strain SL483)
A9MJQ1 1.49e-57 178 59 0 139 3 rbsD D-ribose pyranase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B6I3Y5 2.6e-57 177 59 0 139 3 rbsD D-ribose pyranase Escherichia coli (strain SE11)
B7M5A4 2.6e-57 177 59 0 139 3 rbsD D-ribose pyranase Escherichia coli O8 (strain IAI1)
A7ZTV9 2.6e-57 177 59 0 139 3 rbsD D-ribose pyranase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q8Z2R3 3e-57 177 58 0 139 3 rbsD D-ribose pyranase Salmonella typhi
B5XZK8 4.91e-57 177 58 0 139 3 rbsD D-ribose pyranase Klebsiella pneumoniae (strain 342)
A9MXC5 9.48e-57 176 58 0 139 3 rbsD D-ribose pyranase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A7MMV4 1.48e-56 176 58 0 139 3 rbsD D-ribose pyranase Cronobacter sakazakii (strain ATCC BAA-894)
A6TG52 3.64e-56 174 58 0 139 3 rbsD D-ribose pyranase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A1JHR8 9.84e-55 171 58 0 139 3 rbsD D-ribose pyranase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8GLK3 8.32e-54 169 56 0 139 3 rbsD D-ribose pyranase Serratia proteamaculans (strain 568)
B1JR25 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66GH4 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TSH7 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pestis (strain Pestoides F)
Q1CNU0 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pestis bv. Antiqua (strain Nepal516)
A9QYG7 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pestis bv. Antiqua (strain Angola)
Q7CLE5 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pestis
B2K7I5 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CC43 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FCN3 1.59e-53 168 58 0 139 3 rbsD D-ribose pyranase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C5BDG5 1.6e-53 168 53 0 139 3 rbsD D-ribose pyranase Edwardsiella ictaluri (strain 93-146)
Q6DB88 3.85e-53 167 57 0 139 3 rbsD D-ribose pyranase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7NA80 6.3e-53 166 60 0 139 3 rbsD D-ribose pyranase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DJF3 9.25e-53 166 56 0 139 3 rbsD D-ribose pyranase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
B8F777 1.94e-51 162 56 0 139 3 rbsD D-ribose pyranase Glaesserella parasuis serovar 5 (strain SH0165)
Q9CP97 3.07e-49 157 53 0 139 3 rbsD D-ribose pyranase Pasteurella multocida (strain Pm70)
P44734 5.55e-49 156 53 0 139 3 rbsD D-ribose pyranase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5U9Z0 7.46e-49 156 53 0 139 3 rbsD D-ribose pyranase Haemophilus influenzae (strain PittEE)
Q4QN45 7.46e-49 156 53 0 139 3 rbsD D-ribose pyranase Haemophilus influenzae (strain 86-028NP)
B3H2R4 7.87e-49 156 53 0 139 3 rbsD D-ribose pyranase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
B0BS95 1.25e-48 155 53 0 139 3 rbsD D-ribose pyranase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2W7 1.25e-48 155 53 0 139 3 rbsD D-ribose pyranase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B6EKH2 3.68e-48 154 51 0 139 3 rbsD D-ribose pyranase Aliivibrio salmonicida (strain LFI1238)
A5UH08 4.79e-48 154 53 0 139 3 rbsD D-ribose pyranase Haemophilus influenzae (strain PittGG)
Q5E4V7 2.01e-47 152 51 0 139 3 rbsD D-ribose pyranase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KN38 2.91e-47 152 51 0 139 3 rbsD D-ribose pyranase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F1C1 2.91e-47 152 51 0 139 3 rbsD D-ribose pyranase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B5FEJ4 4.46e-47 151 51 0 139 3 rbsD D-ribose pyranase Aliivibrio fischeri (strain MJ11)
Q87H78 4.81e-47 151 49 0 139 3 rbsD D-ribose pyranase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MEV2 1.31e-45 148 47 0 139 3 rbsD D-ribose pyranase Vibrio vulnificus (strain YJ016)
Q8D7T8 1.31e-45 148 47 0 139 3 rbsD D-ribose pyranase Vibrio vulnificus (strain CMCP6)
B2UZT8 2.08e-45 147 52 1 139 3 rbsD D-ribose pyranase Clostridium botulinum (strain Alaska E43 / Type E3)
Q0TPX4 3.92e-45 146 51 1 139 3 rbsD D-ribose pyranase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A6VKS7 5.98e-45 146 50 0 139 3 rbsD D-ribose pyranase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A1SRU1 8.78e-45 145 49 2 141 3 rbsD D-ribose pyranase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q0SSI9 1.74e-44 145 50 1 139 3 rbsD D-ribose pyranase Clostridium perfringens (strain SM101 / Type A)
A7N2S3 1.8e-44 145 49 0 139 3 rbsD D-ribose pyranase Vibrio campbellii (strain ATCC BAA-1116)
B2A2D7 4.81e-44 144 49 1 139 3 rbsD D-ribose pyranase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B2TK87 5.91e-44 143 51 1 139 3 rbsD D-ribose pyranase Clostridium botulinum (strain Eklund 17B / Type B)
A0KKN1 2.13e-43 142 48 0 139 3 rbsD D-ribose pyranase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q6LH12 2.68e-43 142 48 0 139 3 rbsD D-ribose pyranase Photobacterium profundum (strain SS9)
A4SMC0 3.06e-43 142 48 0 139 3 rbsD D-ribose pyranase Aeromonas salmonicida (strain A449)
Q8XJX2 9.29e-43 140 50 1 139 3 rbsD D-ribose pyranase Clostridium perfringens (strain 13 / Type A)
B0UV47 2.11e-42 140 50 0 139 3 rbsD D-ribose pyranase Histophilus somni (strain 2336)
A0Q217 2.94e-41 136 48 1 139 3 rbsD D-ribose pyranase Clostridium novyi (strain NT)
Q7UU60 7.46e-40 133 47 2 139 3 rbsD D-ribose pyranase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q88RZ2 7.54e-40 133 48 1 139 3 rbsD D-ribose pyranase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B1J6T8 9.05e-40 133 49 1 139 3 rbsD D-ribose pyranase Pseudomonas putida (strain W619)
Q5KUX2 1.27e-39 132 47 1 139 3 rbsD D-ribose pyranase Geobacillus kaustophilus (strain HTA426)
Q88K33 1.94e-39 132 48 1 139 3 rbsD D-ribose pyranase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W5E7 1.94e-39 132 48 1 139 3 rbsD D-ribose pyranase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q0I1S1 2.59e-39 132 48 0 139 3 rbsD D-ribose pyranase Histophilus somni (strain 129Pt)
A8GZV5 5.15e-39 131 41 0 139 3 rbsD D-ribose pyranase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A7GLA2 6.07e-39 130 49 1 139 3 rbsD D-ribose pyranase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q891M0 6.2e-39 130 48 1 139 3 rbsD D-ribose pyranase Clostridium tetani (strain Massachusetts / E88)
A4IT64 7.05e-39 130 48 1 139 3 rbsD D-ribose pyranase Geobacillus thermodenitrificans (strain NG80-2)
B0K1M3 7.25e-39 130 51 2 139 3 rbsD D-ribose pyranase Thermoanaerobacter sp. (strain X514)
B0KDE7 7.25e-39 130 51 2 139 3 rbsD D-ribose pyranase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0KKS4 7.87e-39 130 48 1 139 3 rbsD D-ribose pyranase Pseudomonas putida (strain GB-1)
Q883I5 1.1e-38 130 49 3 141 3 rbsD D-ribose pyranase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B0TS18 1.12e-38 130 42 0 139 3 rbsD D-ribose pyranase Shewanella halifaxensis (strain HAW-EB4)
Q4ZUH3 1.18e-38 130 48 3 141 3 rbsD D-ribose pyranase Pseudomonas syringae pv. syringae (strain B728a)
C1D8A6 1.71e-38 129 51 2 139 3 rbsD D-ribose pyranase Laribacter hongkongensis (strain HLHK9)
Q8RD44 1.87e-38 129 51 2 139 3 rbsD D-ribose pyranase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5WC30 2.52e-38 129 47 2 139 3 rbsD D-ribose pyranase Shouchella clausii (strain KSM-K16)
C6BY79 3.08e-38 129 44 0 139 3 rbsD D-ribose pyranase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C1EXK2 3.84e-38 129 50 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain 03BB102)
Q73DH8 4.48e-38 128 49 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain ATCC 10987 / NRS 248)
B5Y646 4.94e-38 128 48 1 139 3 rbsD D-ribose pyranase Coprothermobacter proteolyticus (strain ATCC 35245 / DSM 5265 / OCM 4 / BT)
Q48JS8 5.58e-38 128 47 3 141 3 rbsD D-ribose pyranase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B9J4V7 8.07e-38 128 49 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain Q1)
B7HW89 8.07e-38 128 49 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain AH187)
A0R9V2 8.72e-38 127 50 2 139 3 rbsD D-ribose pyranase Bacillus thuringiensis (strain Al Hakam)
C3JZP4 1.27e-37 127 50 1 139 3 rbsD D-ribose pyranase Pseudomonas fluorescens (strain SBW25)
Q63FY0 1.36e-37 127 50 3 139 3 rbsD D-ribose pyranase Bacillus cereus (strain ZK / E33L)
Q6HNE8 1.54e-37 127 49 2 139 3 rbsD D-ribose pyranase Bacillus thuringiensis subsp. konkukian (strain 97-27)
B7JQF1 1.54e-37 127 49 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain AH820)
Q81V37 1.54e-37 127 49 2 139 3 rbsD D-ribose pyranase Bacillus anthracis
C3LG97 1.54e-37 127 49 2 139 3 rbsD D-ribose pyranase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P0E9 1.54e-37 127 49 2 139 3 rbsD D-ribose pyranase Bacillus anthracis (strain A0248)
B1YL34 2.05e-37 127 48 2 139 3 rbsD D-ribose pyranase Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8ENB2 2.13e-37 127 49 1 139 3 rbsD D-ribose pyranase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P36946 3.56e-37 126 49 2 139 1 rbsD D-ribose pyranase Bacillus subtilis (strain 168)
A9VEU6 1.26e-36 125 48 2 139 3 rbsD D-ribose pyranase Bacillus mycoides (strain KBAB4)
Q67RD6 1.29e-36 125 46 1 139 3 rbsD D-ribose pyranase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B7HBU7 1.32e-36 125 48 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain B4264)
Q81HW9 2.36e-36 124 48 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q1IC21 2.41e-36 124 49 1 139 3 rbsD D-ribose pyranase Pseudomonas entomophila (strain L48)
Q9K6K0 3.01e-36 124 47 1 139 3 rbsD D-ribose pyranase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B7IXT0 3.77e-36 124 48 2 139 3 rbsD D-ribose pyranase Bacillus cereus (strain G9842)
A7Z9G4 4.58e-36 123 49 2 139 3 rbsD D-ribose pyranase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q3KEY9 4.95e-36 123 46 1 139 3 rbsD D-ribose pyranase Pseudomonas fluorescens (strain Pf0-1)
Q4LA40 6.91e-36 123 46 1 139 3 rbsD D-ribose pyranase Staphylococcus haemolyticus (strain JCSC1435)
Q5FJ20 8.82e-36 122 43 1 139 3 rbsD D-ribose pyranase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q4KEW9 8.93e-36 122 49 2 141 3 rbsD D-ribose pyranase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q82ZT7 1.47e-35 122 46 2 139 3 rbsD D-ribose pyranase Enterococcus faecalis (strain ATCC 700802 / V583)
B2G634 2.35e-35 121 42 1 139 3 rbsD D-ribose pyranase Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VIK0 2.35e-35 121 42 1 139 3 rbsD D-ribose pyranase Limosilactobacillus reuteri (strain DSM 20016)
Q65E56 2.9e-35 121 49 2 139 3 rbsD D-ribose pyranase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q7NTN5 3.44e-35 121 43 1 139 3 rbsD D-ribose pyranase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B9DUX3 5.68e-35 120 46 1 139 3 rbsD D-ribose pyranase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
C5CL95 7.38e-35 120 49 3 139 3 rbsD D-ribose pyranase Variovorax paradoxus (strain S110)
Q8CN17 7.74e-35 120 46 2 141 3 rbsD D-ribose pyranase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q02XM8 1.69e-34 119 45 1 139 3 rbsD D-ribose pyranase Lactococcus lactis subsp. cremoris (strain SK11)
Q03DK3 1.83e-34 119 43 2 139 3 rbsD D-ribose pyranase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q5HL86 3.16e-34 119 45 2 141 3 rbsD D-ribose pyranase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q03CA5 3.46e-34 119 42 1 139 3 rbsD D-ribose pyranase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3W789 3.46e-34 119 42 1 139 3 rbsD D-ribose pyranase Lacticaseibacillus casei (strain BL23)
Q043F6 3.6e-34 119 42 1 139 3 rbsD D-ribose pyranase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
B2GEJ1 9.82e-34 117 41 1 139 3 rbsD D-ribose pyranase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q03Q56 1.17e-33 117 41 1 139 3 rbsD D-ribose pyranase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
A8Z0N3 1.83e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain USA300 / TCH1516)
Q2FK01 1.83e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain USA300)
A2RJD5 1.97e-33 117 44 1 139 3 rbsD D-ribose pyranase Lactococcus lactis subsp. cremoris (strain MG1363)
Q7A1V6 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain MW2)
Q6GCK3 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain MSSA476)
Q6GK42 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain MRSA252)
Q7A7T6 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain N315)
Q99WV6 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QDP3 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain Newman)
Q5HJA7 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain COL)
Q2YVA4 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IPD8 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain JH9)
Q2G1A5 2.04e-33 117 45 2 141 1 rbsD D-ribose pyranase Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6TY54 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain JH1)
A7WXT5 2.04e-33 117 45 2 141 3 rbsD D-ribose pyranase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q74J96 2.11e-33 117 41 1 139 3 rbsD D-ribose pyranase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8E7N8 2.44e-33 116 45 2 137 3 rbsD D-ribose pyranase Streptococcus agalactiae serotype III (strain NEM316)
A4J7I2 3.64e-33 116 43 2 139 3 rbsD D-ribose pyranase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A1TUV3 4.68e-33 115 44 2 140 3 rbsD D-ribose pyranase Paracidovorax citrulli (strain AAC00-1)
Q9CF43 5.07e-33 115 45 1 139 3 rbsD D-ribose pyranase Lactococcus lactis subsp. lactis (strain IL1403)
Q8E280 5.36e-33 115 45 2 137 3 rbsD D-ribose pyranase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K3R1 6.17e-33 115 45 2 137 3 rbsD D-ribose pyranase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q04DK7 8.5e-33 115 43 1 139 3 rbsD D-ribose pyranase Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B8G635 8.69e-33 115 43 2 139 3 rbsD D-ribose pyranase Chloroflexus aggregans (strain MD-66 / DSM 9485)
B0TIM6 1.42e-32 114 41 1 139 3 rbsD D-ribose pyranase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q38Z79 2.24e-32 114 41 2 139 3 rbsD D-ribose pyranase Latilactobacillus sakei subsp. sakei (strain 23K)
B9DIF1 6.17e-32 113 43 2 141 3 rbsD D-ribose pyranase Staphylococcus carnosus (strain TM300)
A8FI51 2.29e-31 111 46 2 139 3 rbsD D-ribose pyranase Bacillus pumilus (strain SAFR-032)
C4KZD1 2.65e-31 111 40 1 139 3 rbsD D-ribose pyranase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B7IGD0 2.94e-31 111 44 1 139 3 rbsD D-ribose pyranase Thermosipho africanus (strain TCF52B)
Q1AXG1 1.95e-30 109 39 1 139 3 rbsD1 D-ribose pyranase 1 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q49XF7 2.43e-29 106 42 2 139 3 rbsD D-ribose pyranase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A9BJQ0 2.47e-29 106 37 1 139 3 rbsD D-ribose pyranase Petrotoga mobilis (strain DSM 10674 / SJ95)
A5INL8 3.58e-29 106 38 1 139 3 rbsD D-ribose pyranase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
B9KA10 9.86e-29 105 35 1 139 3 rbsD D-ribose pyranase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q9X054 9.86e-29 105 35 1 139 3 rbsD D-ribose pyranase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
C5CEY9 7.72e-28 102 37 3 140 3 rbsD D-ribose pyranase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
A4QDL6 1.51e-27 101 43 2 139 3 rbsD D-ribose pyranase Corynebacterium glutamicum (strain R)
Q8NR09 2.16e-27 101 43 2 139 3 rbsD D-ribose pyranase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B1VU78 1.81e-26 99 38 1 139 3 rbsD2 D-ribose pyranase 2 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q1AUT6 2.97e-26 99 36 2 138 3 rbsD2 D-ribose pyranase 2 Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
A8F3M5 4.65e-26 98 36 1 139 3 rbsD D-ribose pyranase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q6ABP6 5.48e-26 97 39 2 140 3 rbsD D-ribose pyranase Cutibacterium acnes (strain DSM 16379 / KPA171202)
B1VNF2 1.33e-24 95 38 3 138 3 rbsD1 D-ribose pyranase 1 Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q82CM8 2.04e-24 94 35 2 139 3 rbsD D-ribose pyranase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9RDH8 8.42e-23 89 33 2 139 3 rbsD D-ribose pyranase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A8AP17 7.12e-07 48 28 4 137 3 fucU L-fucose mutarotase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TD85 1.57e-06 47 28 4 139 3 fucU L-fucose mutarotase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q8Z427 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella typhi
B4TUJ9 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella schwarzengrund (strain CVM19633)
B5BF33 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella paratyphi A (strain AKU_12601)
C0PXG7 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella paratyphi C (strain RKS4594)
A9N2J4 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PEK7 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T4X3 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella newport (strain SL254)
B4TGN5 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella heidelberg (strain SL476)
B5QWR2 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella enteritidis PT4 (strain P125109)
B5FTY3 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella dublin (strain CT_02021853)
Q57KD8 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella choleraesuis (strain SC-B67)
B5F4S5 2.77e-06 47 27 4 137 3 fucU L-fucose mutarotase Salmonella agona (strain SL483)
A9MSA4 4.4e-06 46 26 3 136 3 fucU L-fucose mutarotase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5RDV6 7.69e-06 45 27 4 137 3 fucU L-fucose mutarotase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8ZMC4 8.61e-06 45 27 4 137 3 fucU L-fucose mutarotase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P44778 2.08e-05 45 28 5 150 3 fucU L-fucose mutarotase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UHL6 2.08e-05 45 28 5 150 3 fucU L-fucose mutarotase Haemophilus influenzae (strain PittGG)
Q4QMI4 2.25e-05 44 28 5 150 3 fucU L-fucose mutarotase Haemophilus influenzae (strain 86-028NP)
A5UAS6 0.000107 43 27 5 150 3 fucU L-fucose mutarotase Haemophilus influenzae (strain PittEE)
B0BSB3 0.000112 42 27 5 147 3 fucU L-fucose mutarotase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2T2 0.000112 42 27 5 147 3 fucU L-fucose mutarotase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2Y4 0.000112 42 27 5 147 3 fucU L-fucose mutarotase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q3YY53 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Shigella sonnei (strain Ss046)
Q0T156 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Shigella flexneri serotype 5b (strain 8401)
Q32CB4 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Shigella dysenteriae serotype 1 (strain Sd197)
Q31XI7 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Shigella boydii serotype 4 (strain Sb227)
B2TZD0 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R7N6 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain UTI89 / UPEC)
B1LQZ8 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain SMS-3-5 / SECEC)
B6I6K2 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain SE11)
B7N738 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0AEN8 0.000143 42 29 6 143 1 fucU L-fucose mutarotase Escherichia coli (strain K12)
B1IU37 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0AEN9 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TE55 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AEZ1 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O1:K1 / APEC
A8A3T9 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O9:H4 (strain HS)
B1XDL3 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain K12 / DH10B)
C4ZZV9 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LXM0 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O8 (strain IAI1)
B7MZA0 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O81 (strain ED1a)
B7NVV2 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z4C4 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0AEP0 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O157:H7
B7LEY4 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli (strain 55989 / EAEC)
B7MLC5 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHM0 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQP8 0.000143 42 29 6 143 3 fucU L-fucose mutarotase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q83QC7 0.000165 42 29 6 143 3 fucU L-fucose mutarotase Shigella flexneri
B8F6Y2 0.000882 40 28 5 147 3 fucU L-fucose mutarotase Glaesserella parasuis serovar 5 (strain SH0165)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00445
Feature type CDS
Gene rbsD
Product D-ribose pyranase
Location 119810 - 120229 (strand: -1)
Length 420 (nucleotides) / 139 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2056
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF05025 RbsD / FucU transport protein family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1869 Carbohydrate transport and metabolism (G) G D-ribose pyranose/furanose isomerase RbsD

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K06726 D-ribose pyranase [EC:5.4.99.62] ABC transporters -

Protein Sequence

MKKGVLLNSSISSVIARLGHTDKITIADAGLPIPSSVERIDLALTQGIPDFMSVLQTITHEMQVEAVMLAIEIKNINPLLFSEITRYLHLLEQQQKKPIEIIYVTHEEFKTQLPDNKAVIRTGECSPYANIVLFSGVTF

Flanking regions ( +/- flanking 50bp)

TTCATTTCCTACTATGTAGAACAGCGAAACGTTTCGCTGAGGAGGCAAAGATGAAAAAAGGTGTATTACTTAATAGTTCAATTTCTAGCGTAATTGCACGTTTAGGGCATACTGACAAAATAACGATTGCAGATGCTGGATTACCCATACCCTCCTCTGTTGAGCGTATCGATCTTGCTTTAACTCAGGGGATCCCTGACTTTATGTCAGTGTTACAAACGATCACCCATGAAATGCAAGTCGAAGCCGTTATGCTTGCCATAGAAATTAAAAATATAAACCCACTTCTTTTTAGTGAGATAACCCGTTATTTGCATTTATTAGAACAACAACAAAAAAAACCTATCGAGATCATTTATGTCACTCATGAAGAATTTAAAACACAACTTCCAGATAATAAAGCGGTGATAAGAACAGGTGAATGCTCTCCTTATGCCAATATCGTGCTGTTTTCTGGTGTGACTTTCTGAGGCCAATATGGAAGCATTACTTGAATTAAAAAATATTGATAAATCATTTC