Homologs in group_2151

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_16185 FBDBKF_16185 100.0 Morganella morganii S1 lysR Transcriptional regulator, LysR family
EHELCC_16220 EHELCC_16220 100.0 Morganella morganii S2 lysR Transcriptional regulator, LysR family
LHKJJB_17040 LHKJJB_17040 100.0 Morganella morganii S3 lysR Transcriptional regulator, LysR family
HKOGLL_16800 HKOGLL_16800 100.0 Morganella morganii S5 lysR Transcriptional regulator, LysR family
F4V73_RS17440 F4V73_RS17440 78.3 Morganella psychrotolerans - LysR family transcriptional regulator
PMI_RS06050 PMI_RS06050 57.3 Proteus mirabilis HI4320 - LysR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2151

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2151

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37641 4.5e-32 123 30 6 306 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
P52689 1.64e-25 106 29 4 261 3 ltrA Probable HTH-type transcriptional regulator LtrA Klebsiella pneumoniae
P43011 1.84e-23 100 28 3 277 3 HI_1364 Uncharacterized HTH-type transcriptional regulator HI_1364 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P30864 1.07e-22 98 25 6 295 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
Q9JPU9 2.08e-22 97 26 5 299 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
Q9JXW7 1.59e-21 95 26 5 299 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P77333 6.27e-19 88 28 7 292 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P67662 5.1e-17 83 30 2 183 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 5.1e-17 83 30 2 183 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 5.1e-17 83 30 2 183 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P37459 2.17e-16 81 22 6 294 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57083 4.82e-16 80 27 4 252 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
P76250 1.04e-15 79 26 9 304 1 dmlR HTH-type transcriptional regulator DmlR Escherichia coli (strain K12)
A5F9F9 2.06e-15 78 27 4 248 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q01610 2.26e-15 78 28 7 288 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0C6D1 2.4e-15 78 27 4 248 3 irgB Iron-regulated virulence regulatory protein IrgB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A0A0H2ZDG9 1.32e-13 73 25 5 299 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P52686 1.61e-13 73 32 7 196 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
P72131 6.59e-12 68 30 6 262 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P75836 7.39e-12 68 24 8 312 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
P0ACR8 3.19e-11 66 33 2 127 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 3.19e-11 66 33 2 127 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P55576 3.26e-11 66 29 7 255 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P42507 4.02e-11 65 27 8 273 3 hvrB AhcY transcriptional activator HvrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P45099 5.77e-11 65 24 7 301 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45461 1.96e-10 63 25 3 202 3 ampR HTH-type transcriptional activator AmpR Yersinia enterocolitica
Q5N5I5 2.05e-10 64 24 7 309 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.05e-10 64 24 7 309 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P0A9F6 5.75e-10 62 29 1 144 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 5.75e-10 62 29 1 144 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 5.75e-10 62 29 1 144 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
P27111 1.62e-09 61 34 1 115 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
O68014 2.77e-09 60 30 0 123 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P45463 3.51e-09 60 27 4 188 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain K12)
Q0TD46 3.68e-09 60 27 4 188 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
O87883 4.48e-09 58 37 1 116 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
Q8XBK9 5.79e-09 59 27 4 188 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O157:H7
Q1R6S1 7.58e-09 59 26 3 188 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli (strain UTI89 / UPEC)
Q8FDH0 7.58e-09 59 26 3 188 3 ttdR HTH-type transcriptional activator TtdR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4QH19 7.65e-09 59 44 0 68 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
Q8X4M5 1.1e-08 58 33 1 115 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
O34685 1.21e-08 58 32 3 143 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P77559 2.09e-08 57 26 14 324 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P77309 2.12e-08 57 31 1 125 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
O32186 2.94e-08 57 33 2 128 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P39647 5.28e-08 56 20 9 311 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P52696 6.97e-08 56 28 1 125 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P94501 8.87e-08 56 22 11 314 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
P52677 1.08e-07 55 36 1 116 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
P44821 1.17e-07 55 25 11 308 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P12529 1.65e-07 55 26 5 192 1 ampR HTH-type transcriptional activator AmpR Citrobacter freundii
P0ACR0 1.77e-07 55 27 10 282 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 1.77e-07 55 27 10 282 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
P46068 1.88e-07 55 26 1 152 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
P96194 1.98e-07 52 40 0 84 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P52678 2.64e-07 54 47 0 59 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P25544 4.49e-07 53 30 4 148 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q8FK66 5.84e-07 53 42 1 88 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 5.84e-07 53 42 1 88 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A7Z5E4 5.89e-07 53 28 1 148 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P77744 6.3e-07 53 28 1 123 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
Q1RF30 9.32e-07 53 47 0 63 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 9.32e-07 53 47 0 63 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC
P23841 1.09e-06 52 31 2 130 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
Q04778 1.46e-06 52 26 3 169 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q57S50 1.8e-06 52 39 1 88 3 allS HTH-type transcriptional activator AllS Salmonella choleraesuis (strain SC-B67)
Q9S4Y7 2.01e-06 52 39 1 88 3 allS HTH-type transcriptional activator AllS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PCH2 2.01e-06 52 39 1 88 3 allS HTH-type transcriptional activator AllS Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P33634 3.18e-06 51 29 7 179 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P67668 3.43e-06 51 42 0 68 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 3.43e-06 51 42 0 68 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 3.43e-06 51 42 0 68 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q765S2 3.53e-06 51 29 6 201 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
Q9X5P2 3.82e-06 51 37 2 95 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
Q9HWH8 4.52e-06 50 44 0 68 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P70785 4.88e-06 50 42 0 68 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q8Z8R3 4.91e-06 50 39 1 88 3 allS HTH-type transcriptional activator AllS Salmonella typhi
P0ACR2 4.99e-06 50 25 9 299 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli (strain K12)
P0ACR3 4.99e-06 50 25 9 299 3 ydhB Uncharacterized HTH-type transcriptional regulator YdhB Escherichia coli O157:H7
P42427 5.58e-06 50 28 2 125 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O87324 6.64e-06 50 30 2 148 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium marinum
Q6HPH4 1.06e-05 49 38 0 70 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81IX0 1.15e-05 49 38 0 70 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63H01 1.19e-05 49 38 0 70 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 1.19e-05 49 38 0 70 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q81VJ1 1.29e-05 49 38 0 70 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P0A2Q2 1.46e-05 49 23 12 318 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 1.46e-05 49 23 12 318 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
A0R8S0 1.52e-05 49 40 0 64 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
P52665 1.68e-05 47 38 0 70 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P52691 1.98e-05 48 25 6 249 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P16931 2e-05 48 28 1 118 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P11720 2.16e-05 48 29 1 141 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52693 2.31e-05 48 32 4 128 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8VWE6 2.53e-05 48 29 3 148 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P05051 2.55e-05 48 27 3 149 3 ampR HTH-type transcriptional activator AmpR Enterobacter cloacae
P05827 2.56e-05 48 31 2 128 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P36771 3.04e-05 48 29 3 148 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
Q57748 3.64e-05 48 20 5 268 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B2TU26 3.72e-05 48 38 1 85 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P52666 4.04e-05 48 36 1 82 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
Q55459 4.45e-05 47 22 10 304 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7NF72 6.19e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NU32 6.36e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P03030 6.66e-05 47 27 4 136 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
P52659 6.74e-05 47 34 0 109 3 abaB HTH-type transcriptional regulator AbaB Streptomyces antibioticus
B7LUJ5 6.78e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q3YVK2 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 6.84e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q1R4H3 6.97e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 6.97e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 6.97e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 6.97e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 6.97e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
Q8KA72 7.05e-05 47 23 1 121 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q3MCB5 7.16e-05 47 28 2 141 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q329U3 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 7.3e-05 47 43 0 64 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P14145 8.79e-05 47 28 3 150 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
Q8YQ82 9.05e-05 47 28 2 141 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52670 9.87e-05 47 31 3 119 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P71025 9.94e-05 46 24 2 131 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
P34818 0.000164 46 27 1 141 3 trpI HTH-type transcriptional regulator TrpI Pseudomonas syringae pv. syringae
P73123 0.000184 46 27 1 127 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1XDT2 0.000201 45 25 2 141 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P52662 0.000215 45 28 1 128 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P20668 0.000232 45 25 3 147 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P51205 0.000249 45 25 2 141 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
Q6B936 0.00025 45 26 2 142 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P0DUU5 0.000257 45 31 2 129 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q05840 0.000266 45 38 0 68 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
B5FN59 0.0003 45 26 10 252 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B4TNR5 0.000306 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
O78432 0.00032 45 25 1 127 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
P0A2Q0 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SYF7 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
B4TAZ8 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 0.000335 45 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
P52669 0.000341 45 37 0 66 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
O19892 0.000367 45 34 0 76 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
A0T0V5 0.00038 45 28 3 121 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
Q9I6Z9 0.000385 45 34 0 66 3 bauR HTH-type transcriptional activator BauR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1JQ39 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000499 44 42 0 64 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
P0A4T7 0.000513 44 30 0 90 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 0.000513 44 30 0 90 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
A1JI47 0.000556 44 41 0 68 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77700 0.000575 44 32 2 86 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
O69772 0.000602 44 28 1 144 3 ampR HTH-type transcriptional activator AmpR Providencia stuartii
P77171 0.000636 44 25 6 184 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P49518 0.001 43 27 4 140 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
O33945 0.001 43 34 1 78 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_17120
Feature type CDS
Gene lysR
Product Transcriptional regulator, LysR family
Location 34995 - 35903 (strand: -1)
Length 909 (nucleotides) / 302 (amino acids)

Contig

Accession ZDB_535
Length 62169 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2151
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MAVDLNLLPVFLAVAEQGSFTGAATRLGMPSSNVSRAIRQLETQTGCRLIERTTRRMRLTAQGQQLYQCAGKTDSMLRETFSQIRNDDVLTGCFRLTVPGEGCGEMLAPVLARFAALHPDLQIRCDTKLTPADIISDDIDLLLTYQRGEMADSSYHSRLIQSWSCVVVAAPSLLARTGIPVSSAELPRLPCISSLSTLNGQPWIFRKPDGGWLTVRINSRYQVNGAALAAAAAVEGLGFAILTTHLCQQAFRDGTLQAVRLNEEPAPIELRAVYVSRREVSPVVDKFLHFLESSLRDQDKNQ

Flanking regions ( +/- flanking 50bp)

TGTTTGTGATAACAATATGGGTGAATATCTCTCACAACGGGGACGCGGTCATGGCGGTCGATCTGAATTTACTGCCGGTTTTTCTGGCGGTGGCGGAGCAGGGCAGTTTTACCGGTGCGGCCACCCGGCTGGGTATGCCGTCATCCAATGTCAGCCGGGCCATCAGACAGCTGGAAACCCAGACCGGCTGCCGCCTGATTGAACGGACAACCCGGCGTATGCGCCTGACGGCACAGGGGCAGCAGCTGTATCAGTGCGCCGGAAAGACGGACTCCATGCTGCGGGAAACTTTTTCACAGATCCGCAATGATGATGTGCTGACCGGTTGTTTCCGGCTGACGGTGCCCGGTGAAGGCTGCGGGGAAATGCTGGCACCGGTACTGGCCCGTTTTGCCGCACTGCATCCGGATTTGCAGATCCGGTGTGATACAAAGCTGACCCCGGCGGATATTATCAGTGATGATATCGATCTGCTGCTGACTTATCAGCGCGGGGAGATGGCAGACAGCAGTTATCACAGCCGTCTGATTCAGTCCTGGTCGTGTGTGGTGGTGGCAGCTCCGTCATTACTGGCGCGGACCGGTATTCCGGTTTCTTCCGCTGAGCTGCCCCGGCTGCCCTGTATTTCCAGCCTGAGTACCCTGAATGGTCAGCCGTGGATTTTCCGTAAACCGGACGGCGGATGGCTGACTGTGCGCATTAACAGCCGCTATCAGGTTAACGGTGCTGCACTGGCAGCAGCGGCGGCTGTTGAAGGGCTGGGTTTTGCGATTCTGACCACACATTTGTGTCAGCAGGCTTTCCGTGACGGTACATTACAGGCTGTCCGGCTGAATGAAGAACCGGCTCCCATCGAACTGAGAGCCGTCTATGTCAGCCGCCGTGAGGTGTCACCGGTTGTCGACAAATTCCTGCATTTTCTTGAAAGTTCGCTGCGGGATCAGGATAAAAATCAATAGCTGCGGAATACCGTCTGCTTTCCGTCCGCATCATAGGCGACCACATCATA