Homologs in group_2011

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14820 FBDBKF_14820 100.0 Morganella morganii S1 yeiE DNA-binding transcriptional regulator YeiE
EHELCC_15625 EHELCC_15625 100.0 Morganella morganii S2 yeiE DNA-binding transcriptional regulator YeiE
LHKJJB_15685 LHKJJB_15685 100.0 Morganella morganii S3 yeiE DNA-binding transcriptional regulator YeiE
HKOGLL_14805 HKOGLL_14805 100.0 Morganella morganii S5 yeiE DNA-binding transcriptional regulator YeiE
F4V73_RS07620 F4V73_RS07620 88.5 Morganella psychrotolerans yieE DNA-binding transcriptional regulator YeiE
PMI_RS04125 PMI_RS04125 68.1 Proteus mirabilis HI4320 yieE DNA-binding transcriptional regulator YeiE

Distribution of the homologs in the orthogroup group_2011

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2011

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACR4 1.05e-135 388 65 1 287 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.05e-135 388 65 1 287 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.05e-135 388 65 1 287 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
Q85G62 1.11e-46 161 34 5 293 3 rbcR Probable RuBisCO transcriptional regulator Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P39647 1.97e-45 158 36 4 269 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
P25544 9.43e-42 149 31 3 291 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
Q3MCB5 1.54e-40 146 33 5 295 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YQ82 4.53e-40 145 33 5 295 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P48271 6.65e-38 139 31 6 290 3 rbcR Probable RuBisCO transcriptional regulator Cyanophora paradoxa
Q55459 2.75e-37 137 29 3 287 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06610 2.91e-36 134 28 2 287 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
O78432 3.21e-36 134 30 3 290 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
Q5N5I5 3.76e-36 134 29 3 291 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 3.76e-36 134 29 3 291 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O19892 8.07e-36 133 32 6 293 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
Q1XDT2 1.55e-34 130 30 4 290 3 rbcR Probable RuBisCO transcriptional regulator Neopyropia yezoensis
P51205 2.1e-34 130 30 4 290 3 rbcR Probable RuBisCO transcriptional regulator Porphyra purpurea
Q6B936 8.19e-34 128 30 4 290 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P73123 3.68e-33 127 31 4 291 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2CI69 5.89e-33 125 31 5 292 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q4G384 2.38e-31 121 28 4 291 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
Q57748 1.72e-29 116 27 4 297 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P42722 2.13e-27 111 27 3 290 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P49518 2.12e-26 108 27 6 294 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
P25545 1.21e-25 107 27 6 290 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
P52595 1.3e-25 106 27 8 295 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
A0T0G2 9.79e-25 103 26 5 290 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
O32186 3.7e-24 102 29 4 281 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P94501 5.74e-23 99 27 7 292 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
A0T0V5 1.57e-22 97 27 5 292 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P33634 9.77e-21 92 25 2 285 3 yfiE Uncharacterized HTH-type transcriptional regulator YfiE Escherichia coli (strain K12)
P37499 2.21e-20 91 23 6 288 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
Q2IN45 3.42e-20 93 32 2 203 3 phnC Phosphonates import ATP-binding protein PhnC Anaeromyxobacter dehalogenans (strain 2CP-C)
O33812 2e-19 89 24 6 286 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
Q44311 2.52e-19 89 24 5 284 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
P56885 1.54e-18 87 25 5 290 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
P96725 1.97e-18 86 24 8 296 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P58332 2.36e-18 86 25 6 294 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
P0ACR8 4.77e-18 85 25 3 295 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 4.77e-18 85 25 3 295 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
Q47083 1.16e-17 84 25 5 244 1 cbl HTH-type transcriptional regulator cbl Escherichia coli (strain K12)
P67668 3.52e-17 83 32 6 278 3 BQ2027_MB2303C Uncharacterized HTH-type transcriptional regulator Mb2303c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMF3 3.52e-17 83 32 6 278 1 Rv2282c Uncharacterized HTH-type transcriptional regulator Rv2282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF2 3.52e-17 83 32 6 278 3 MT2340 Uncharacterized HTH-type transcriptional regulator MT2340 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P03030 1.24e-16 81 26 4 276 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
P30864 3.11e-16 80 25 8 297 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
O35038 3.84e-16 80 27 4 243 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
P52690 4.59e-16 80 25 5 290 3 cbbR HTH-type transcriptional regulator CbbR Cereibacter sphaeroides
P55181 9.62e-16 79 25 5 248 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P20668 1.13e-15 79 26 7 290 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
P52686 1.62e-15 78 27 6 280 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
Q81IX0 2.99e-15 77 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q63H01 6.9e-15 76 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 6.9e-15 76 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
B4E8V9 7.08e-15 76 23 3 244 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A0R8S0 7.85e-15 76 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
Q81VJ1 9.72e-15 76 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
P27111 2.68e-14 75 27 1 203 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
Q6HPH4 2.96e-14 74 24 7 285 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
P39592 5.45e-14 73 22 8 303 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
O34685 1.08e-13 73 24 5 282 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
P52696 1.13e-13 73 23 1 242 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
P71025 2.7e-13 72 23 6 290 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
Q08598 3.3e-13 72 28 9 253 3 cbl HTH-type transcriptional regulator cbl Klebsiella aerogenes
Q8X4M5 6.35e-13 70 26 1 203 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
B4E8S9 1.13e-12 70 23 4 258 1 ssuR HTH-type transcriptional regulator SsuR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P0A4T3 1.26e-12 70 27 3 198 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 1.26e-12 70 27 3 198 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
P74422 1.31e-12 70 23 3 252 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P52693 7.26e-12 68 23 6 252 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
O69055 7.33e-12 66 29 3 193 3 ptxE Putative HTH-type transcriptional regulator protein PtxE (Fragment) Stutzerimonas stutzeri
O68014 1.46e-11 67 26 2 179 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A7Z5E4 1.88e-11 66 25 4 235 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P39127 2.56e-11 66 21 2 250 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
P52678 3.11e-11 66 28 6 249 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
Q47141 3.65e-11 65 26 3 191 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
P77744 4.7e-11 65 25 4 199 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
Q9HWH8 5.19e-11 65 26 5 249 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A9F3 6.71e-11 65 25 7 246 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 6.71e-11 65 25 7 246 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 6.71e-11 65 25 7 246 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
P0ACQ9 1.76e-10 63 25 3 198 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 1.76e-10 63 25 3 198 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 1.76e-10 63 25 3 198 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
P45349 2.25e-10 63 24 6 200 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P06614 2.27e-10 63 25 7 246 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A4T7 3.65e-10 63 21 5 262 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 3.65e-10 63 21 5 262 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
P72294 4.43e-10 62 29 4 149 3 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium meliloti
P44418 7.35e-10 62 20 1 201 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45600 1.02e-09 62 24 7 246 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
O32255 1.34e-09 61 24 4 200 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
O87324 1.51e-09 61 24 4 278 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium marinum
A0A0H2ZDG9 1.53e-09 61 25 4 198 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P96194 1.61e-09 58 36 2 106 3 None Uncharacterized HTH-type transcriptional regulator in ibpB-leuC intergenic region Azotobacter vinelandii
P35112 1.78e-09 60 26 1 192 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
Q00678 2.01e-09 60 26 1 192 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P07774 2.66e-09 60 26 1 142 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P71318 3.31e-09 60 20 1 240 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
Q9X725 3.62e-09 60 20 2 254 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P45105 5.43e-09 59 23 9 257 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9JPU9 1.13e-08 58 24 11 297 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P0ACQ4 1.51e-08 58 20 4 244 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 1.51e-08 58 20 4 244 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 1.51e-08 58 20 4 244 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
O06703 1.52e-08 58 23 1 249 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P77559 1.53e-08 58 24 5 248 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P75836 5.39e-08 56 23 8 303 3 ycaN Uncharacterized HTH-type transcriptional regulator YcaN Escherichia coli (strain K12)
Q47005 6.46e-08 56 26 9 253 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P52661 6.79e-08 56 25 7 212 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P05827 7.27e-08 56 23 2 247 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
P0A2Q2 9.42e-08 55 22 2 247 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 9.42e-08 55 22 2 247 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P9WMF7 1.19e-07 55 23 7 269 1 Rv0377 Uncharacterized HTH-type transcriptional regulator Rv0377 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMF6 1.19e-07 55 23 7 269 3 MT0391 Uncharacterized HTH-type transcriptional regulator MT0391 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9JXW7 1.33e-07 55 24 11 297 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P77171 3.72e-07 53 24 4 213 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P0A2Q4 4.92e-07 53 24 1 185 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 4.92e-07 53 24 1 185 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
P76369 1.46e-06 52 29 5 182 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
Q88JX7 1.75e-06 52 25 6 207 3 galR HTH-type transcriptional regulator GalR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P45099 1.86e-06 52 22 5 274 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37459 1.96e-06 52 25 3 186 3 sinR Probable HTH-type transcriptional regulator SinR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P55576 2.06e-06 52 26 5 196 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0A9G1 2.13e-06 52 25 5 189 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 2.13e-06 52 25 5 189 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 2.13e-06 52 25 5 189 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
Q1R4H3 2.31e-06 51 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 2.31e-06 51 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 2.31e-06 51 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 2.31e-06 51 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 2.31e-06 51 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
P0DV33 2.42e-06 51 25 1 145 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
P52691 2.92e-06 51 29 5 186 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14145 3.4e-06 51 27 6 176 3 ampR HTH-type transcriptional activator AmpR Rhodobacter capsulatus
P0DUU5 3.62e-06 51 36 0 82 1 aceR HTH-type transcriptional regulator AceR Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
O34827 3.62e-06 51 25 2 148 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P67660 5.09e-06 50 37 1 89 1 yhaJ Probable HTH-type transcriptional regulator YhaJ Escherichia coli (strain K12)
P67661 5.09e-06 50 37 1 89 1 yhaJ HTH-type transcriptional regulator YhaJ Escherichia coli O157:H7
P16400 8.12e-06 50 22 11 300 3 mleR Malolactic fermentation system transcriptional activator Lactococcus lactis subsp. lactis (strain IL1403)
P0A9F6 8.73e-06 50 24 6 248 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 8.73e-06 50 24 6 248 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 8.73e-06 50 24 6 248 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
B7NF72 9.78e-06 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NU32 9.78e-06 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LUJ5 9.87e-06 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P23841 1.01e-05 49 28 6 193 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
Q3YVK2 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 1.05e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q329U3 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 1.09e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
B5FN59 1.2e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
B2TU26 1.37e-05 49 30 2 139 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B4SYF7 1.44e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
P0A2Q0 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 1.48e-05 49 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B4TNR5 1.51e-05 48 27 3 177 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
Q04778 2.83e-05 48 22 5 279 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q8KA72 4.2e-05 47 22 2 184 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P77309 9.37e-05 46 26 7 193 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
P16931 0.000115 46 26 3 142 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P52675 0.000115 44 35 5 131 3 cysB HTH-type transcriptional regulator CysB (Fragment) Thiocapsa roseopersicina
P70785 0.000185 45 24 2 197 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
O34701 0.000237 45 27 6 155 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P77700 0.000362 45 32 0 83 1 yahB Uncharacterized HTH-type transcriptional regulator YahB Escherichia coli (strain K12)
Q57083 0.000752 43 21 11 303 1 perR HTH-type transcriptional regulator PerR Escherichia coli (strain K12)
Q9I6Z9 0.000798 43 23 4 184 3 bauR HTH-type transcriptional activator BauR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_16155
Feature type CDS
Gene yeiE
Product DNA-binding transcriptional regulator YeiE
Location 95653 - 96519 (strand: -1)
Length 867 (nucleotides) / 288 (amino acids)
In genomic island -

Contig

Accession ZDB_532
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2011
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Protein Sequence

MRITLRQLEVFTEVQKSGSTTQASQQLALSQSAVSASLTDLENQLNVQLFDRVGKRLVTNEHGRLLYPKAIALLEQAGEIEQLFKTDAGALRFAASTTIGNYMLPEMLGAYRAVHENTPVELFIANTEEVIKAVLEFRADMGLIEGVCHSPELITEPWLEDELVIFCSPDNPLSQKSNVTPDDLKNVAWVLRERGSGTREVLDQILFNRLPGFRVEMELGNSEAVKHAVRFGRGVSCLSRRVIAEQLSNGLLSEVKIAGLTLNRTLFRIYHRQKHISNALNTFLTYCR

Flanking regions ( +/- flanking 50bp)

AATGTTAATATGATGATAATAATCGGGATAAAATAAGGGAGCGCTTTGCCATGCGCATCACACTGAGACAGCTCGAAGTCTTTACAGAAGTTCAGAAGTCCGGTTCGACGACACAAGCTTCCCAGCAGCTGGCGCTTTCACAGTCCGCCGTGAGTGCCTCTCTGACGGATCTGGAAAATCAGCTGAATGTTCAGCTGTTTGACCGGGTCGGTAAACGGCTGGTGACCAATGAACACGGACGGCTGCTGTATCCGAAAGCCATTGCCCTGCTCGAGCAGGCCGGTGAAATTGAACAGCTGTTTAAAACCGATGCGGGGGCATTGCGTTTTGCGGCCAGTACCACCATCGGCAACTATATGCTGCCGGAAATGCTGGGGGCATACCGTGCAGTGCATGAAAATACACCGGTTGAATTATTTATCGCTAATACTGAGGAAGTGATTAAAGCCGTGCTGGAGTTCCGCGCGGATATGGGGCTTATCGAAGGGGTCTGCCATTCCCCGGAACTGATTACCGAGCCGTGGCTGGAAGATGAGCTGGTGATTTTCTGCAGCCCGGATAATCCGCTCAGTCAGAAAAGCAATGTGACTCCTGATGATCTGAAAAATGTGGCCTGGGTTCTGCGTGAACGCGGTTCGGGTACGCGGGAAGTGCTGGATCAGATCCTCTTTAACCGTCTGCCGGGTTTCCGCGTGGAAATGGAGCTGGGGAATTCCGAGGCCGTCAAACACGCGGTACGCTTCGGGCGCGGGGTCAGTTGTCTGTCGCGGCGGGTGATTGCCGAACAGCTGAGTAACGGGCTGTTGTCAGAGGTGAAGATTGCCGGGCTTACCCTCAACCGCACACTTTTCCGGATTTATCACCGTCAGAAACATATCTCCAACGCCCTCAATACCTTCCTGACCTATTGCCGCTGACGCGGCATCTGTTTCTTCTGCCGCCGGTTTCCGGCGGGCAGCTGAGGTAT