Homologs in group_1627

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10720 FBDBKF_10720 100.0 Morganella morganii S1 feoB Fe(2+) transporter permease subunit FeoB
EHELCC_15055 EHELCC_15055 100.0 Morganella morganii S2 feoB Fe(2+) transporter permease subunit FeoB
LHKJJB_14460 LHKJJB_14460 100.0 Morganella morganii S3 feoB Fe(2+) transporter permease subunit FeoB
HKOGLL_13080 HKOGLL_13080 100.0 Morganella morganii S5 feoB Fe(2+) transporter permease subunit FeoB
F4V73_RS14435 F4V73_RS14435 91.8 Morganella psychrotolerans feoB Fe(2+) transporter permease subunit FeoB
PMI_RS14440 PMI_RS14440 80.0 Proteus mirabilis HI4320 feoB Fe(2+) transporter permease subunit FeoB

Distribution of the homologs in the orthogroup group_1627

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1627

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P74884 0.0 1098 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q83ST5 0.0 1098 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella typhi
Q5PLZ1 0.0 1098 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57IW8 0.0 1097 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella choleraesuis (strain SC-B67)
P33650 0.0 1097 71 3 775 1 feoB Fe(2+) transporter FeoB Escherichia coli (strain K12)
Q8FCT7 0.0 1096 71 3 775 3 feoB Fe(2+) transporter FeoB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XED4 0.0 1095 71 3 775 3 feoB Fe(2+) transporter FeoB Escherichia coli O157:H7
Q83PW3 0.0 1092 71 3 775 3 feoB Fe(2+) transporter FeoB Shigella flexneri
Q8GNS3 0.0 664 46 8 744 1 feoB Fe(2+) transporter FeoB Legionella pneumophila
Q5X1N2 0.0 664 46 8 744 3 feoB Fe(2+) transporter FeoB Legionella pneumophila (strain Paris)
Q5ZS62 0.0 664 46 8 744 3 feoB Fe(2+) transporter FeoB Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WTE1 0.0 659 45 8 744 3 feoB Fe(2+) transporter FeoB Legionella pneumophila (strain Lens)
Q8NUR5 1.51e-142 437 36 17 720 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MW2)
Q6G6C4 1.51e-142 437 36 17 720 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MSSA476)
Q6GDP8 7.78e-142 435 36 17 721 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MRSA252)
Q5HD01 3.64e-141 433 36 17 724 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain COL)
Q7A3F2 5.71e-141 433 36 17 724 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain N315)
Q99R86 5.71e-141 433 36 17 724 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q57986 3.17e-131 408 32 13 724 1 MJ0566 Fe(2+) transporter FeoB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7MV19 1.51e-130 411 34 23 796 3 feoB1 Fe(2+) transport protein A/Fe(2+) transporter FeoB fusion protein Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q9PMQ9 4.48e-96 314 29 18 722 2 feoB Fe(2+) transporter FeoB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5XPH7 1.7e-92 307 32 14 619 3 feoB Fe(2+) transporter FeoB Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
Q72SI0 1.22e-90 302 29 18 750 3 feoB Fe(2+) transporter FeoB Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F332 2.92e-89 298 29 18 750 3 feoB Fe(2+) transporter FeoB Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
O25396 1.19e-88 295 28 18 754 3 feoB Fe(2+) transporter FeoB Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZLF3 9.9e-88 293 27 14 758 3 feoB Fe(2+) transporter FeoB Helicobacter pylori (strain J99 / ATCC 700824)
Q7MVL1 2.86e-78 270 33 13 563 3 feoB2 Fe(2+) transporter FeoB homolog Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
P73182 1.06e-64 230 28 18 714 3 feoB Fe(2+) transporter FeoB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8CXI2 4.08e-09 62 30 4 162 3 era GTPase Era Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
C1AB49 2.01e-07 55 29 8 167 3 engB Probable GTP-binding protein EngB Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q89A14 3.11e-07 57 37 3 98 3 der GTPase Der Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q1GSF4 9.2e-07 55 26 4 158 3 obg GTPase Obg Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A8YV35 1.09e-06 55 34 10 163 3 der GTPase Der Lactobacillus helveticus (strain DPC 4571)
Q21W32 1.18e-06 55 32 5 124 3 der GTPase Der Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1K3Z3 2.13e-06 54 28 4 144 3 der GTPase Der Azoarcus sp. (strain BH72)
A6VV10 2.16e-06 54 35 3 94 3 der GTPase Der Marinomonas sp. (strain MWYL1)
Q5FKF4 2.29e-06 54 32 9 166 3 der GTPase Der Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q21KS9 3.69e-06 53 37 3 93 3 der GTPase Der Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q55526 4.17e-06 53 26 6 166 3 era GTPase Era Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
C5CXH0 4.2e-06 53 31 4 120 3 der GTPase Der Variovorax paradoxus (strain S110)
A1B9C8 4.43e-06 53 24 3 165 3 obg GTPase Obg Paracoccus denitrificans (strain Pd 1222)
A7MH00 5.22e-06 52 25 6 172 3 era GTPase Era Cronobacter sakazakii (strain ATCC BAA-894)
Q04AY6 6.44e-06 53 29 7 161 3 der GTPase Der Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8KH12 6.44e-06 53 29 7 161 3 der GTPase Der Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q7VL76 6.95e-06 52 25 7 167 3 era GTPase Era Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A5WGA8 9.26e-06 52 30 8 162 3 der GTPase Der Psychrobacter sp. (strain PRwf-1)
Q6G0H5 1.02e-05 52 30 8 169 3 der GTPase Der Bartonella quintana (strain Toulouse)
B4SRK9 1.03e-05 51 30 5 127 3 era GTPase Era Stenotrophomonas maltophilia (strain R551-3)
B9J7W1 1.08e-05 52 28 6 166 3 der GTPase Der Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
B5XNH1 1.11e-05 51 23 6 172 3 era GTPase Era Klebsiella pneumoniae (strain 342)
B1JDV4 1.12e-05 52 28 7 167 3 der GTPase Der Pseudomonas putida (strain W619)
B0KPJ1 1.14e-05 52 28 7 167 3 der GTPase Der Pseudomonas putida (strain GB-1)
Q8E3T9 1.16e-05 52 31 8 166 3 der GTPase Der Streptococcus agalactiae serotype III (strain NEM316)
Q6G5J7 1.16e-05 52 29 7 167 3 der GTPase Der Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
A1JKK4 1.18e-05 51 25 7 168 3 era GTPase Era Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q2NCX8 1.3e-05 52 28 4 130 3 obg GTPase Obg Erythrobacter litoralis (strain HTCC2594)
Q1IEH7 1.33e-05 52 28 7 167 3 der GTPase Der Pseudomonas entomophila (strain L48)
Q980M3 1.37e-05 51 32 8 180 1 hflX GTPase HflX Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
B7VJU2 1.37e-05 52 28 5 129 3 der GTPase Der Vibrio atlanticus (strain LGP32)
B2FPX8 1.44e-05 51 30 4 121 3 era GTPase Era Stenotrophomonas maltophilia (strain K279a)
Q8YYD8 1.64e-05 51 25 5 167 3 era GTPase Era Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P43728 1.65e-05 51 26 7 165 3 era GTPase Era Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFI7 1.65e-05 51 26 7 165 3 era GTPase Era Haemophilus influenzae (strain PittGG)
B3GX86 1.7e-05 51 25 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZR0 1.7e-05 51 25 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B9L101 1.76e-05 51 25 10 220 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A5VYT9 1.92e-05 51 28 7 167 3 der GTPase Der Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0BUA7 1.96e-05 50 25 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B7I5H1 1.97e-05 51 34 5 123 3 der GTPase Der Acinetobacter baumannii (strain AB0057)
Q2G983 2e-05 51 25 3 163 3 obg GTPase Obg Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A3CPT0 2.01e-05 51 28 7 178 3 der GTPase Der Streptococcus sanguinis (strain SK36)
B1HVB2 2.04e-05 51 24 9 213 3 obg GTPase Obg Lysinibacillus sphaericus (strain C3-41)
Q5QYB3 2.13e-05 51 31 3 94 3 der GTPase Der Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1TM31 2.17e-05 51 32 4 120 3 der GTPase Der Paracidovorax citrulli (strain AAC00-1)
Q58803 2.27e-05 51 24 6 169 3 MJ1408 Uncharacterized protein MJ1408 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A9IQH4 2.28e-05 51 27 5 164 3 der GTPase Der Bartonella tribocorum (strain CIP 105476 / IBS 506)
B8IEL9 2.34e-05 50 25 4 170 3 obg GTPase Obg Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B9FI63 2.4e-05 51 30 5 134 2 Os05g0567300 GTPase ERA-like, chloroplastic Oryza sativa subsp. japonica
A6TCI0 2.43e-05 50 23 6 172 3 era GTPase Era Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9CPH8 2.47e-05 50 26 8 175 3 era GTPase Era Pasteurella multocida (strain Pm70)
Q0I4Z4 2.5e-05 50 26 7 165 3 era GTPase Era Histophilus somni (strain 129Pt)
P38860 2.55e-05 51 27 7 176 1 MTG2 GTPase MTG2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A5IZG5 2.78e-05 51 31 4 128 3 der GTPase Der Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
Q9V288 2.84e-05 49 28 9 183 3 engB Probable GTP-binding protein EngB Pyrococcus abyssi (strain GE5 / Orsay)
B0USS2 2.98e-05 50 26 7 165 3 era GTPase Era Histophilus somni (strain 2336)
A4WDD7 3.01e-05 50 24 6 172 3 era GTPase Era Enterobacter sp. (strain 638)
A8MHK8 3.02e-05 50 26 10 228 3 obg GTPase Obg Alkaliphilus oremlandii (strain OhILAs)
A5VD74 3.06e-05 50 25 4 167 3 obg GTPase Obg Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q88PJ3 3.07e-05 51 28 7 167 3 der GTPase Der Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q74JL6 3.08e-05 50 30 6 162 3 der GTPase Der Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A6UDV6 3.09e-05 50 23 5 170 3 obg GTPase Obg Sinorhizobium medicae (strain WSM419)
B9DTQ3 3.3e-05 50 29 7 177 3 der GTPase Der Streptococcus uberis (strain ATCC BAA-854 / 0140J)
F4HSD4 3.31e-05 50 25 5 171 2 ATOBGM Probable GTP-binding protein OBGM, mitochondrial Arabidopsis thaliana
B5X2B8 3.4e-05 50 29 2 129 2 eral1 GTPase Era, mitochondrial Salmo salar
Q1LU74 4.03e-05 50 27 5 161 3 der GTPase Der Baumannia cicadellinicola subsp. Homalodisca coagulata
Q92UK6 4.05e-05 50 29 5 164 3 der GTPase Der Rhizobium meliloti (strain 1021)
Q2VZU2 4.06e-05 50 23 3 182 3 obg GTPase Obg Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
C6C0G0 4.06e-05 50 30 4 136 3 der GTPase Der Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A6WW65 4.16e-05 50 33 2 95 3 der GTPase Der Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A6WW65 0.001 46 27 6 171 3 der GTPase Der Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q1IWI7 4.18e-05 50 31 5 122 3 der GTPase Der Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q04A20 4.19e-05 50 28 4 121 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9W6 4.19e-05 50 28 4 121 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A6LEP5 4.26e-05 50 29 4 125 3 der GTPase Der Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B9MS56 4.32e-05 50 30 7 191 3 era GTPase Era Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
B2A6B7 4.41e-05 50 23 8 232 3 obg GTPase Obg Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q2SDW8 4.43e-05 50 31 4 122 3 der GTPase Der Hahella chejuensis (strain KCTC 2396)
Q0AB37 4.47e-05 50 29 5 157 3 der GTPase Der Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B5Z140 4.96e-05 49 23 6 172 3 era GTPase Era Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58070 4.96e-05 49 23 6 172 3 era GTPase Era Escherichia coli O157:H7
B7K414 5.01e-05 49 28 6 169 3 era GTPase Era Rippkaea orientalis (strain PCC 8801 / RF-1)
A1SU43 5.07e-05 50 33 3 92 3 der GTPase Der Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
B3E422 5.43e-05 49 24 7 209 3 era GTPase Era Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
K7UTH7 5.5e-05 50 29 4 131 2 ERA1 GTPase ERA1, chloroplastic Zea mays
C3LT16 5.57e-05 50 28 5 129 3 der GTPase Der Vibrio cholerae serotype O1 (strain M66-2)
Q9KTW7 5.57e-05 50 28 5 129 3 der GTPase Der Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3E6 5.57e-05 50 28 5 129 3 der GTPase Der Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q5SHE9 5.69e-05 50 25 6 167 1 obg GTPase Obg Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A6KXK1 5.92e-05 50 31 4 122 3 der GTPase Der Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q3AEZ3 6e-05 49 26 5 163 3 era GTPase Era Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8DY73 6.17e-05 50 30 8 166 3 der GTPase Der Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZR6 6.17e-05 50 30 8 166 3 der GTPase Der Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1AVU3 6.59e-05 49 30 5 128 3 obg GTPase Obg Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B3WEL1 6.86e-05 49 24 3 160 3 era GTPase Era Lacticaseibacillus casei (strain BL23)
B0CK66 7.42e-05 49 34 2 94 3 der GTPase Der Brucella suis (strain ATCC 23445 / NCTC 10510)
B0CK66 0.000689 46 26 6 171 3 der GTPase Der Brucella suis (strain ATCC 23445 / NCTC 10510)
A8AVL8 7.6e-05 49 28 7 178 3 der GTPase Der Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B8F3C8 7.85e-05 48 27 7 158 3 era GTPase Era Glaesserella parasuis serovar 5 (strain SH0165)
Q1QD14 7.86e-05 49 31 8 162 3 der GTPase Der Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A8YVM7 8.1e-05 48 24 5 165 3 era GTPase Era Lactobacillus helveticus (strain DPC 4571)
Q038T2 8.13e-05 48 24 3 160 3 era GTPase Era Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q4FTW3 8.56e-05 49 31 8 162 3 der GTPase Der Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4WZ45 8.56e-05 49 24 4 165 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
B1JRC8 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667V2 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKX7 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pestis (strain Pestoides F)
Q1CKE3 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Nepal516)
A9R403 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD71 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pestis
B2KA46 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C554 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFU0 9.35e-05 48 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B0V4V6 9.6e-05 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain AYE)
A3M215 9.6e-05 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I3F0 9.6e-05 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain ACICU)
B7H065 9.6e-05 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain AB307-0294)
B0U3D9 9.71e-05 48 32 4 125 3 era GTPase Era Xylella fastidiosa (strain M12)
B0VKR4 0.000103 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain SDF)
Q9PB97 0.000105 48 32 4 125 3 era GTPase Era Xylella fastidiosa (strain 9a5c)
Q87C05 0.00011 48 32 4 125 3 era GTPase Era Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I605 0.00011 48 32 4 125 3 era GTPase Era Xylella fastidiosa (strain M23)
C4XIQ6 0.000113 49 29 6 164 3 der GTPase Der Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A1VNF8 0.000117 48 30 4 120 3 der GTPase Der Polaromonas naphthalenivorans (strain CJ2)
P06616 0.000121 48 23 6 172 1 era GTPase Era Escherichia coli (strain K12)
B1IVR1 0.000121 48 23 6 172 3 era GTPase Era Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A376 0.000121 48 23 6 172 3 era GTPase Era Escherichia coli O9:H4 (strain HS)
B1XB40 0.000121 48 23 6 172 3 era GTPase Era Escherichia coli (strain K12 / DH10B)
C4ZYI9 0.000121 48 23 6 172 3 era GTPase Era Escherichia coli (strain K12 / MC4100 / BW2952)
B9JZQ5 0.000123 48 29 6 166 3 der GTPase Der Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A2RGB0 0.000125 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M5 (strain Manfredo)
B8I736 0.000126 48 27 7 167 3 era GTPase Era Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
B5ZYX3 0.000126 48 28 5 164 3 der GTPase Der Rhizobium leguminosarum bv. trifolii (strain WSM2304)
B4RV85 0.00013 48 32 3 92 3 der1 GTPase Der Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B3PVJ6 0.000131 48 28 5 164 3 der GTPase Der Rhizobium etli (strain CIAT 652)
Q2K5L2 0.000132 48 28 5 164 3 der GTPase Der Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q0T1T9 0.000132 48 23 6 172 3 era GTPase Era Shigella flexneri serotype 5b (strain 8401)
Q47WC5 0.000133 48 31 3 94 3 der GTPase Der Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
P0DA91 0.000136 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA90 0.000136 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q83QI5 0.000137 48 23 6 172 3 era GTPase Era Shigella flexneri
B5XJW0 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JNC4 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDF1 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M12 (strain MGAS2096)
P64065 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDR3 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P64064 0.000139 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M1
Q1J8C9 0.000142 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JIH4 0.000142 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q72HR4 0.000143 48 25 6 167 3 obg GTPase Obg Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
C1CSX0 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain Taiwan19F-14)
C1CM45 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain P1031)
C1CFT0 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain JJA)
P64063 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IRW4 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain CGSP14)
P64062 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZMH4 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I766 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain Hungary19A-6)
C1C8U6 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae (strain 70585)
B5E756 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 19F (strain G54)
Q04J64 0.000144 48 28 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q3YYV0 0.000148 48 23 6 172 3 era GTPase Era Shigella sonnei (strain Ss046)
Q31XS1 0.000148 48 23 6 172 3 era GTPase Era Shigella boydii serotype 4 (strain Sb227)
B2TXX9 0.000148 48 23 6 172 3 era GTPase Era Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R8G7 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli (strain UTI89 / UPEC)
B1LP79 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli (strain SMS-3-5 / SECEC)
B6I5E0 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli (strain SE11)
B7N6F4 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FF17 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TES2 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE96 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O1:K1 / APEC
B7M8H9 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O8 (strain IAI1)
B7MYJ7 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O81 (strain ED1a)
B7NRL9 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LDF9 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli (strain 55989 / EAEC)
B7MIQ1 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH06 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQ10 0.000148 48 23 6 172 3 era GTPase Era Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32CV5 0.000152 48 23 6 172 3 era GTPase Era Shigella dysenteriae serotype 1 (strain Sd197)
B7LUZ8 0.000152 48 23 6 172 3 era GTPase Era Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B3PDM5 0.000163 48 32 3 92 3 der GTPase Der Cellvibrio japonicus (strain Ueda107)
A9MGX7 0.000164 48 25 7 168 3 era GTPase Era Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q64NV3 0.000169 48 28 4 122 3 der GTPase Der Bacteroides fragilis (strain YCH46)
Q5L8K8 0.000169 48 28 4 122 3 der GTPase Der Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5NR23 0.00017 48 25 4 159 3 obg GTPase Obg Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q03Y33 0.000171 48 29 9 171 3 era GTPase Era Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
A5VNV9 0.000178 48 32 2 94 3 der GTPase Der Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5VNV9 0.0006 47 26 6 171 3 der GTPase Der Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YFH2 0.000178 48 32 2 94 3 der GTPase Der Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YFH2 0.000396 47 26 6 171 3 der GTPase Der Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RH89 0.000178 48 32 2 94 3 der GTPase Der Brucella melitensis biotype 2 (strain ATCC 23457)
C0RH89 0.000396 47 26 6 171 3 der GTPase Der Brucella melitensis biotype 2 (strain ATCC 23457)
Q8G2E8 0.000185 48 32 2 94 3 der GTPase Der Brucella suis biovar 1 (strain 1330)
Q8G2E8 0.000695 46 26 6 171 3 der GTPase Der Brucella suis biovar 1 (strain 1330)
A9M8F4 0.000185 48 32 2 94 3 der GTPase Der Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A9M8F4 0.000695 46 26 6 171 3 der GTPase Der Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57EY6 0.000185 48 32 2 94 3 der GTPase Der Brucella abortus biovar 1 (strain 9-941)
Q57EY6 0.000626 47 26 6 171 3 der GTPase Der Brucella abortus biovar 1 (strain 9-941)
Q2YM98 0.000185 48 32 2 94 3 der GTPase Der Brucella abortus (strain 2308)
Q2YM98 0.000626 47 26 6 171 3 der GTPase Der Brucella abortus (strain 2308)
B2S9M3 0.000185 48 32 2 94 3 der GTPase Der Brucella abortus (strain S19)
B2S9M3 0.000626 47 26 6 171 3 der GTPase Der Brucella abortus (strain S19)
C4K4J2 0.0002 48 32 3 92 3 der GTPase Der Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
C3MG60 0.000204 48 28 5 164 3 der GTPase Der Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q5U528 0.000212 48 26 5 140 2 gtpbp10 GTP-binding protein 10 Xenopus laevis
Q8Z4K5 0.000217 47 23 6 172 3 era GTPase Era Salmonella typhi
Q6LU45 0.000225 48 31 4 94 3 der GTPase Der Photobacterium profundum (strain SS9)
Q9ZE30 0.000242 47 30 6 132 3 era GTPase Era Rickettsia prowazekii (strain Madrid E)
Q2GA15 0.000259 48 29 12 181 3 der GTPase Der Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q8DF02 0.000259 48 33 4 117 3 der GTPase Der Vibrio vulnificus (strain CMCP6)
B8F4X7 0.000259 48 32 3 92 3 der GTPase Der Glaesserella parasuis serovar 5 (strain SH0165)
O57939 0.000261 46 29 9 185 1 engB Probable GTP-binding protein EngB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q7VM29 0.000268 48 32 3 92 3 der GTPase Der Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q7MNE7 0.000273 48 33 4 117 3 der GTPase Der Vibrio vulnificus (strain YJ016)
B0TAF1 0.000302 47 24 5 163 3 era GTPase Era Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B4TS13 0.000308 47 23 6 172 3 era GTPase Era Salmonella schwarzengrund (strain CVM19633)
B5BAT1 0.000308 47 23 6 172 3 era GTPase Era Salmonella paratyphi A (strain AKU_12601)
C0PYG8 0.000308 47 23 6 172 3 era GTPase Era Salmonella paratyphi C (strain RKS4594)
Q5PIG4 0.000308 47 23 6 172 3 era GTPase Era Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RD48 0.000308 47 23 6 172 3 era GTPase Era Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTU7 0.000308 47 23 6 172 3 era GTPase Era Salmonella enteritidis PT4 (strain P125109)
B5FRC4 0.000308 47 23 6 172 3 era GTPase Era Salmonella dublin (strain CT_02021853)
Q57LD1 0.000308 47 23 6 172 3 era GTPase Era Salmonella choleraesuis (strain SC-B67)
B5F1G0 0.000308 47 23 6 172 3 era GTPase Era Salmonella agona (strain SL483)
C6E2H7 0.00031 47 23 8 177 3 era GTPase Era Geobacter sp. (strain M21)
A9N1T2 0.000313 47 23 6 172 3 era GTPase Era Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5P7B7 0.000315 47 25 5 158 3 der GTPase Der Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A8Z608 0.000316 47 27 4 123 3 der GTPase Der Karelsulcia muelleri (strain GWSS)
A7IIE4 0.000331 47 25 5 174 3 der GTPase Der Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A3DHY8 0.00034 47 29 10 164 3 mnmE tRNA modification GTPase MnmE Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q3B1B4 0.000341 47 28 5 159 3 mnmE tRNA modification GTPase MnmE Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q0C441 0.000353 47 30 4 121 3 der GTPase Der Hyphomonas neptunium (strain ATCC 15444)
A4SGR9 0.000356 47 23 8 210 3 mnmE tRNA modification GTPase MnmE Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q65GM7 0.00037 47 26 9 183 3 obg GTPase Obg Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8VZ74 0.000372 47 27 5 169 2 At5g66470 GTPase ERA-like, chloroplastic Arabidopsis thaliana
Q8Y0I0 0.000382 47 27 2 122 3 era GTPase Era Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q48V63 0.000385 47 28 6 159 3 der GTPase Der Streptococcus pyogenes serotype M28 (strain MGAS6180)
A8AD18 0.000398 47 23 6 172 3 era GTPase Era Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
C5BLV6 0.000433 47 32 4 121 3 der GTPase Der Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q5FJT7 0.000443 46 27 4 121 3 era GTPase Era Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q0APC5 0.000443 47 35 3 95 3 era GTPase Era Maricaulis maris (strain MCS10)
Q3K7C0 0.000443 47 33 3 93 3 der GTPase Der Pseudomonas fluorescens (strain Pf0-1)
Q3MHG6 0.000452 47 23 10 239 2 GTPBP10 GTP-binding protein 10 Bos taurus
Q7A0Q3 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 0.000469 47 25 8 174 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 0.000469 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q9HME0 0.00047 45 24 7 185 3 engB Probable GTP-binding protein EngB Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R871 0.00047 45 24 7 185 3 engB Probable GTP-binding protein EngB Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q8A135 0.000495 47 29 4 122 3 der GTPase Der Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q87LP0 0.000495 46 22 7 167 3 era GTPase Era Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A8MG70 0.000497 46 29 4 127 3 era GTPase Era Alkaliphilus oremlandii (strain OhILAs)
A5G692 0.000502 47 28 4 132 3 der GTPase Der Geotalea uraniireducens (strain Rf4)
A4VX53 0.000525 47 28 6 163 3 der GTPase Der Streptococcus suis (strain 05ZYH33)
A4W3F7 0.000525 47 28 6 163 3 der GTPase Der Streptococcus suis (strain 98HAH33)
Q5HFB9 0.000539 47 25 8 174 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q4K6V3 0.000541 47 33 3 93 3 der GTPase Der Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B8GTN1 0.000542 47 26 7 173 3 der GTPase Der Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B0S6U7 0.000577 47 28 2 141 2 eral1 GTPase Era, mitochondrial Danio rerio
A3DBS5 0.000587 47 25 6 184 3 obg GTPase Obg Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q986D9 0.000592 47 25 6 165 3 der GTPase Der Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B9M914 0.000608 47 25 4 151 3 der GTPase Der Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q1B629 0.000617 47 24 6 173 3 obg GTPase Obg Mycobacterium sp. (strain MCS)
A1UJ07 0.000617 47 24 6 173 3 obg GTPase Obg Mycobacterium sp. (strain KMS)
A3Q2F3 0.000617 47 24 6 173 3 obg GTPase Obg Mycobacterium sp. (strain JLS)
A1APR8 0.000629 46 24 7 190 3 era GTPase Era Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q9UT06 0.000629 46 30 7 170 3 SPAP8A3.11c Uncharacterized GTP-binding protein P8A3.11c, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1WUL5 0.00064 46 26 4 166 3 der GTPase Der Halorhodospira halophila (strain DSM 244 / SL1)
B9LNM9 0.000644 45 25 5 174 3 engB Probable GTP-binding protein EngB Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
Q68XY6 0.00066 46 29 6 132 3 era GTPase Era Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7NS92 0.000665 46 27 6 164 3 der GTPase Der Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q1MDD6 0.00068 46 28 5 164 3 der GTPase Der Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q0AF71 0.000693 46 26 4 126 3 era GTPase Era Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B8CXZ0 0.000694 46 25 7 167 3 obg GTPase Obg Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q13X32 0.000715 46 26 5 157 3 der GTPase Der Paraburkholderia xenovorans (strain LB400)
A8M0Y9 0.000742 46 23 4 166 3 obg GTPase Obg Salinispora arenicola (strain CNS-205)
Q9RS19 0.000745 46 29 6 126 3 der GTPase Der Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
O67800 0.000747 46 25 10 206 1 era GTPase Era Aquifex aeolicus (strain VF5)
Q48LZ0 0.00075 46 32 3 92 3 der GTPase Der Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZX19 0.000763 46 32 3 92 3 der GTPase Der Pseudomonas syringae pv. syringae (strain B728a)
Q886Y6 0.000769 46 32 3 92 3 der GTPase Der Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4XKV8 0.000799 45 31 5 145 3 era GTPase Era Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q89MZ0 0.000816 46 34 2 94 3 der GTPase Der Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q83C83 0.000818 46 29 6 157 1 der GTPase Der Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV6 0.000818 46 29 6 157 3 der GTPase Der Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU3 0.000818 46 29 6 157 3 der GTPase Der Coxiella burnetii (strain Dugway 5J108-111)
B6J7Q3 0.000818 46 29 6 157 3 der GTPase Der Coxiella burnetii (strain CbuK_Q154)
Q3IU04 0.000834 45 25 6 154 3 engB Probable GTP-binding protein EngB Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B5ZUE3 0.000839 46 23 5 165 3 obg GTPase Obg Rhizobium leguminosarum bv. trifolii (strain WSM2304)
Q3SL66 0.00084 46 28 5 160 3 der GTPase Der Thiobacillus denitrificans (strain ATCC 25259)
Q6MTJ6 0.000859 46 31 5 127 3 der GTPase Der Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
A0M5C6 0.000899 45 25 4 165 3 obg GTPase Obg Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q1GHZ2 0.001 46 26 9 188 3 der GTPase Der Ruegeria sp. (strain TM1040)
O25505 0.001 46 24 4 124 3 der GTPase Der Helicobacter pylori (strain ATCC 700392 / 26695)
Q8JIF5 0.001 46 28 2 135 1 ERAL1 GTPase Era, mitochondrial Gallus gallus
Q4JWT6 0.001 46 25 7 180 3 obg GTPase Obg Corynebacterium jeikeium (strain K411)
B1JSA4 0.001 46 32 3 92 3 der GTPase Der Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A4TMT3 0.001 46 32 3 92 3 der GTPase Der Yersinia pestis (strain Pestoides F)
Q1CK87 0.001 46 32 3 92 3 der GTPase Der Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Z8 0.001 46 32 3 92 3 der GTPase Der Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT9 0.001 46 32 3 92 3 der GTPase Der Yersinia pestis
Q1C5J2 0.001 46 32 3 92 3 der GTPase Der Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFZ3 0.001 46 32 3 92 3 der GTPase Der Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4VNW7 0.001 46 29 4 145 3 der GTPase Der Stutzerimonas stutzeri (strain A1501)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_14885
Feature type CDS
Gene feoB
Product Fe(2+) transporter permease subunit FeoB
Location 110074 - 112392 (strand: -1)
Length 2319 (nucleotides) / 772 (amino acids)

Contig

Accession ZDB_530
Length 141725 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1627
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02421 Ferrous iron transport protein B
PF07664 Ferrous iron transport protein B C terminus
PF07670 Nucleoside recognition
PF17910 FeoB cytosolic helical domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0370 Inorganic ion transport and metabolism (P) P Fe2+ transporter FeoB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04759 ferrous iron transport protein B - -

Protein Sequence

MKALTLGLIGNPNSGKTTLFNQLTGSKQRVGNWAGVTVERKIGYFTTPEHKIELVDLPGTYSLTTISEQTSLDEQIACHFILSGEADMLINVVDASNLERNLYLTLQLLELGVPCIIALNMLDIADKANINIDVRALSERLGCPVIPLVSTRASGICELKAAIDKHTMTPHEVLVNYPAALLDSMNTLAQSIPAEEFSATQRRWLALQSLEGDIYSQARAGFTPEHVQSVRDAMQAQQQEEPELVIADARYQTIADICETTIDNSHSEPNKLTAAMDKIVLNRWLGVPVFLFVMYLMFVLAINIGGALQPLFEGGSEAIFINGTQWLGMTLGFPDWLTIFLAQGVGGGINTVLPLVPQIGMMYLFLSFLEDSGYMARAAFVMDRLMQALGLPGKSFVPLIVGFGCNVPSIMGARTLDAPRERLITVLMAPFMSCGARLAIFAVFAAAFFGKNGASIVFSLYILGIVVAILTGLLLKHTIMRGEASPFVMELPVYHVPHMKTLFMQTWQRLKGFVVRAGKVIIVASMVIGALNSFSFSGKPADSINDSALASVSKVVTPLLSPIGVTNDNWQATVGLITGAMAKEVVVGTLNTLYTAESITNEPFDPESFDLWGELGDAVNETLDSLAETFTFAALSNPIEASKGDGEMDGGTMGTMAAKFGSDVAAYSYLIFVLLYVPCVSVMGAIARETSRGWMTFSILWGLNVAYSLAALFYQAATFSTHPGSSSVIIAVVVIFNLILFALLRRTRSRVNLSFRRDAHSRCGGCSGNECH

Flanking regions ( +/- flanking 50bp)

CCTCTGCCGCCGGCAGAGGGGTTTGTATTTATTGATTGGCATACGACACTATGAAAGCACTCACCCTGGGACTCATCGGTAATCCCAATTCAGGGAAGACCACGCTGTTTAACCAGTTAACCGGATCCAAACAACGCGTCGGCAACTGGGCCGGTGTGACCGTGGAACGGAAAATCGGTTACTTCACCACGCCGGAACACAAAATTGAGCTGGTGGATTTGCCCGGCACCTATTCACTGACCACCATCTCTGAACAGACATCCTTAGACGAACAGATTGCCTGCCACTTTATCCTCAGCGGTGAAGCGGACATGCTGATTAACGTTGTCGACGCATCCAATCTCGAGCGTAACCTGTATCTGACGCTGCAGCTGCTGGAACTGGGTGTTCCCTGTATTATTGCCCTCAATATGCTGGATATCGCCGATAAAGCGAATATCAATATTGATGTCAGAGCGCTGTCAGAACGCCTCGGCTGCCCGGTGATCCCGCTGGTTTCCACCCGCGCGTCCGGTATCTGTGAGCTGAAAGCCGCGATCGACAAACACACAATGACACCGCATGAAGTGCTGGTGAACTATCCGGCTGCGCTGCTCGACAGCATGAACACTCTCGCACAGTCGATTCCTGCGGAAGAGTTCAGCGCCACACAGCGCCGCTGGCTGGCACTGCAAAGCCTGGAGGGGGATATCTACAGCCAGGCACGCGCCGGTTTCACCCCGGAGCATGTGCAGTCTGTCCGTGACGCGATGCAGGCACAGCAGCAGGAAGAGCCGGAATTGGTAATTGCCGATGCCCGTTACCAGACCATCGCGGATATCTGCGAAACAACCATTGATAACAGCCATTCCGAGCCGAATAAACTGACCGCAGCGATGGACAAAATTGTCCTCAACCGCTGGCTGGGCGTGCCGGTATTCCTGTTTGTGATGTATCTGATGTTCGTGCTCGCCATCAATATCGGCGGGGCATTGCAGCCGCTGTTTGAAGGCGGTTCGGAAGCTATTTTCATTAACGGCACACAATGGCTGGGGATGACACTCGGCTTCCCGGACTGGCTGACCATATTCCTCGCCCAGGGGGTCGGCGGCGGTATCAACACCGTGCTGCCGCTGGTACCGCAAATCGGGATGATGTACCTGTTCCTCTCTTTCCTGGAAGATTCCGGTTATATGGCCCGCGCGGCATTTGTGATGGACAGACTGATGCAGGCACTCGGACTGCCGGGTAAATCCTTCGTGCCGCTGATTGTCGGTTTCGGCTGTAACGTGCCGTCCATTATGGGTGCCAGAACCCTGGATGCACCGCGTGAACGTCTTATCACCGTCCTGATGGCACCGTTTATGTCCTGCGGCGCGCGGCTGGCTATCTTCGCGGTTTTCGCGGCTGCCTTCTTCGGCAAAAACGGCGCGAGCATCGTGTTCTCCCTGTATATCCTCGGGATTGTGGTGGCTATCCTTACCGGTCTGCTGCTCAAACACACTATTATGCGCGGCGAAGCATCACCGTTTGTGATGGAACTGCCGGTGTACCACGTACCGCATATGAAAACCCTGTTTATGCAGACCTGGCAGCGCCTGAAAGGCTTTGTGGTGCGTGCGGGTAAAGTCATTATTGTCGCCAGTATGGTAATCGGCGCACTGAACAGCTTCAGTTTCTCCGGTAAACCGGCGGACAGCATTAATGATTCCGCACTGGCCTCAGTCAGTAAAGTGGTCACTCCGCTGCTCAGCCCGATTGGTGTCACCAATGATAACTGGCAGGCGACTGTCGGCCTGATCACCGGTGCGATGGCAAAAGAAGTTGTGGTCGGGACACTGAATACCCTCTACACCGCTGAAAGTATCACCAACGAACCGTTTGATCCGGAATCCTTTGATTTATGGGGTGAACTGGGTGATGCGGTAAATGAAACCCTGGATTCCCTGGCGGAAACCTTCACGTTCGCGGCATTATCCAACCCGATTGAAGCCAGCAAAGGCGACGGCGAGATGGACGGCGGTACCATGGGCACGATGGCCGCGAAATTCGGCTCTGATGTTGCTGCTTACAGCTATCTGATCTTTGTGCTGCTGTATGTGCCGTGTGTCTCTGTGATGGGGGCTATCGCCCGTGAAACCAGCCGCGGCTGGATGACCTTCTCCATCCTGTGGGGTCTGAACGTGGCTTACTCACTGGCCGCCCTGTTCTACCAGGCCGCCACATTCAGTACCCATCCGGGGAGCAGTTCAGTGATTATCGCTGTAGTGGTGATTTTCAACCTGATCCTGTTTGCACTGCTGCGCCGCACACGCAGCCGGGTGAATCTCAGCTTCCGCCGTGATGCGCACAGCCGCTGTGGCGGCTGCTCCGGCAACGAGTGTCACTGATAAAAGGACACGGACATGATCAGCCTGATCGCAGTACGTGACGCCATTGC