Homologs in group_1669

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10720 FBDBKF_10720 91.8 Morganella morganii S1 feoB Fe(2+) transporter permease subunit FeoB
EHELCC_15055 EHELCC_15055 91.8 Morganella morganii S2 feoB Fe(2+) transporter permease subunit FeoB
NLDBIP_14885 NLDBIP_14885 91.8 Morganella morganii S4 feoB Fe(2+) transporter permease subunit FeoB
LHKJJB_14460 LHKJJB_14460 91.8 Morganella morganii S3 feoB Fe(2+) transporter permease subunit FeoB
HKOGLL_13080 HKOGLL_13080 91.8 Morganella morganii S5 feoB Fe(2+) transporter permease subunit FeoB
PMI_RS14440 PMI_RS14440 79.8 Proteus mirabilis HI4320 feoB Fe(2+) transporter permease subunit FeoB

Distribution of the homologs in the orthogroup group_1669

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1669

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8FCT7 0.0 1104 71 3 775 3 feoB Fe(2+) transporter FeoB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P74884 0.0 1104 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33650 0.0 1104 71 3 775 1 feoB Fe(2+) transporter FeoB Escherichia coli (strain K12)
Q57IW8 0.0 1103 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella choleraesuis (strain SC-B67)
Q8XED4 0.0 1103 71 3 775 3 feoB Fe(2+) transporter FeoB Escherichia coli O157:H7
Q83ST5 0.0 1102 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella typhi
Q5PLZ1 0.0 1102 71 4 775 3 feoB Fe(2+) transporter FeoB Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q83PW3 0.0 1102 71 3 775 3 feoB Fe(2+) transporter FeoB Shigella flexneri
Q8GNS3 0.0 661 46 7 750 1 feoB Fe(2+) transporter FeoB Legionella pneumophila
Q5X1N2 0.0 660 46 7 750 3 feoB Fe(2+) transporter FeoB Legionella pneumophila (strain Paris)
Q5ZS62 0.0 660 46 7 750 3 feoB Fe(2+) transporter FeoB Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5WTE1 0.0 656 46 7 750 3 feoB Fe(2+) transporter FeoB Legionella pneumophila (strain Lens)
Q8NUR5 5.74e-144 441 36 18 723 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MW2)
Q6G6C4 5.74e-144 441 36 18 723 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MSSA476)
Q6GDP8 4.09e-143 438 36 17 722 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain MRSA252)
Q7A3F2 2.61e-142 436 36 18 725 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain N315)
Q99R86 2.61e-142 436 36 18 725 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HD01 3.16e-142 436 36 18 725 3 feoB Fe(2+) transporter FeoB Staphylococcus aureus (strain COL)
Q57986 9.86e-133 412 32 13 721 1 MJ0566 Fe(2+) transporter FeoB Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q7MV19 1.88e-129 409 33 21 787 3 feoB1 Fe(2+) transport protein A/Fe(2+) transporter FeoB fusion protein Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q9PMQ9 4.39e-96 314 29 15 728 2 feoB Fe(2+) transporter FeoB Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q72SI0 3.37e-92 306 30 21 752 3 feoB Fe(2+) transporter FeoB Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F332 1.13e-91 305 30 21 752 3 feoB Fe(2+) transporter FeoB Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q5XPH7 1.55e-91 304 31 19 742 3 feoB Fe(2+) transporter FeoB Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
O25396 1.96e-89 297 28 19 753 3 feoB Fe(2+) transporter FeoB Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZLF3 4.93e-86 288 27 19 757 3 feoB Fe(2+) transporter FeoB Helicobacter pylori (strain J99 / ATCC 700824)
Q7MVL1 8.04e-79 271 33 13 563 3 feoB2 Fe(2+) transporter FeoB homolog Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
P73182 3.06e-72 250 28 17 729 3 feoB Fe(2+) transporter FeoB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8CXI2 1.47e-09 63 31 4 158 3 era GTPase Era Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q6G5J7 3.25e-08 60 28 9 214 3 der GTPase Der Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q2G983 1.76e-07 57 28 3 163 3 obg GTPase Obg Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
C1AB49 2.29e-07 55 28 8 167 3 engB Probable GTP-binding protein EngB Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q89A14 2.78e-07 57 37 3 98 3 der GTPase Der Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A8YV35 6.26e-07 56 34 10 163 3 der GTPase Der Lactobacillus helveticus (strain DPC 4571)
Q1GSF4 7.92e-07 55 27 3 159 3 obg GTPase Obg Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q04AY6 1.14e-06 55 31 8 169 3 der GTPase Der Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8KH12 1.14e-06 55 31 8 169 3 der GTPase Der Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q5FKF4 1.2e-06 55 33 9 166 3 der GTPase Der Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q58803 1.21e-06 55 25 6 173 3 MJ1408 Uncharacterized protein MJ1408 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q21W32 1.39e-06 55 32 5 124 3 der GTPase Der Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q980M3 1.43e-06 54 33 8 175 1 hflX GTPase HflX Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q5SHE9 1.63e-06 55 27 6 167 1 obg GTPase Obg Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q7VL76 1.72e-06 54 26 7 167 3 era GTPase Era Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A1K3Z3 1.76e-06 55 27 6 190 3 der GTPase Der Azoarcus sp. (strain BH72)
Q72HR4 1.78e-06 54 27 6 167 3 obg GTPase Obg Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A1JKK4 2.01e-06 53 26 7 168 3 era GTPase Era Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8YVM7 2.25e-06 53 24 5 165 3 era GTPase Era Lactobacillus helveticus (strain DPC 4571)
A6VV10 2.55e-06 54 35 3 94 3 der GTPase Der Marinomonas sp. (strain MWYL1)
A1B9C8 3.58e-06 53 24 3 161 3 obg GTPase Obg Paracoccus denitrificans (strain Pd 1222)
Q21KS9 3.92e-06 53 37 3 93 3 der GTPase Der Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B3GX86 4.48e-06 53 26 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZR0 4.48e-06 53 26 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 5b (strain L20)
P43728 4.51e-06 52 27 7 165 3 era GTPase Era Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UFI7 4.51e-06 52 27 7 165 3 era GTPase Era Haemophilus influenzae (strain PittGG)
B5XNH1 5.17e-06 52 24 6 172 3 era GTPase Era Klebsiella pneumoniae (strain 342)
C5CXH0 5.36e-06 53 31 4 120 3 der GTPase Der Variovorax paradoxus (strain S110)
B0BUA7 5.5e-06 52 26 7 167 3 era GTPase Era Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A7MH00 5.76e-06 52 25 6 172 3 era GTPase Era Cronobacter sakazakii (strain ATCC BAA-894)
Q2NCX8 5.93e-06 52 27 4 166 3 obg GTPase Obg Erythrobacter litoralis (strain HTCC2594)
Q1LU74 6.66e-06 53 27 5 161 3 der GTPase Der Baumannia cicadellinicola subsp. Homalodisca coagulata
Q55526 7.11e-06 52 27 6 166 3 era GTPase Era Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B8I736 7.47e-06 52 28 7 167 3 era GTPase Era Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q74JL6 7.87e-06 52 29 9 210 3 der GTPase Der Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q0I4Z4 8.12e-06 52 27 7 165 3 era GTPase Era Histophilus somni (strain 129Pt)
B0USS2 8.31e-06 52 27 7 165 3 era GTPase Era Histophilus somni (strain 2336)
Q6G0H5 8.48e-06 52 29 8 169 3 der GTPase Der Bartonella quintana (strain Toulouse)
Q8YYD8 9.21e-06 52 30 4 132 3 era GTPase Era Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2VZU2 9.31e-06 52 23 3 182 3 obg GTPase Obg Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8E3T9 1.08e-05 52 29 9 181 3 der GTPase Der Streptococcus agalactiae serotype III (strain NEM316)
B8IEL9 1.21e-05 52 25 4 170 3 obg GTPase Obg Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
A6TCI0 1.23e-05 51 23 6 172 3 era GTPase Era Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9V288 1.25e-05 50 28 9 180 3 engB Probable GTP-binding protein EngB Pyrococcus abyssi (strain GE5 / Orsay)
B3WEL1 1.33e-05 51 25 3 160 3 era GTPase Era Lacticaseibacillus casei (strain BL23)
B4SRK9 1.5e-05 51 30 5 126 3 era GTPase Era Stenotrophomonas maltophilia (strain R551-3)
Q038T2 1.75e-05 51 25 3 160 3 era GTPase Era Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B7VJU2 1.84e-05 51 28 5 126 3 der GTPase Der Vibrio atlanticus (strain LGP32)
Q5FJT7 1.88e-05 50 24 5 165 3 era GTPase Era Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B2FPX8 1.95e-05 50 30 4 121 3 era GTPase Era Stenotrophomonas maltophilia (strain K279a)
A8MHK8 2.01e-05 51 26 9 226 3 obg GTPase Obg Alkaliphilus oremlandii (strain OhILAs)
A9IQH4 2.06e-05 51 27 6 168 3 der GTPase Der Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q5QYB3 2.11e-05 51 31 3 94 3 der GTPase Der Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
O57939 2.14e-05 50 30 9 182 1 engB Probable GTP-binding protein EngB Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A5IZG5 2.18e-05 51 32 4 128 3 der GTPase Der Mycoplasmopsis agalactiae (strain NCTC 10123 / CIP 59.7 / PG2)
B9FI63 2.2e-05 51 27 6 165 2 Os05g0567300 GTPase ERA-like, chloroplastic Oryza sativa subsp. japonica
Q9CPH8 2.26e-05 50 27 7 165 3 era GTPase Era Pasteurella multocida (strain Pm70)
B7I5H1 2.3e-05 51 34 5 123 3 der GTPase Der Acinetobacter baumannii (strain AB0057)
B7I5H1 9.6e-05 49 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain AB0057)
B1JRC8 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667V2 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TKX7 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pestis (strain Pestoides F)
Q1CKE3 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Nepal516)
A9R403 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Angola)
Q8ZD71 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pestis
B2KA46 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C554 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFU0 2.46e-05 50 24 6 166 3 era GTPase Era Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A6LEP5 2.46e-05 51 30 4 125 3 der GTPase Der Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A4WDD7 2.8e-05 50 24 6 172 3 era GTPase Era Enterobacter sp. (strain 638)
B9L101 2.85e-05 51 25 9 220 3 obg GTPase Obg Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
A1TM31 2.91e-05 51 32 4 120 3 der GTPase Der Paracidovorax citrulli (strain AAC00-1)
B7K414 2.94e-05 50 28 6 169 3 era GTPase Era Rippkaea orientalis (strain PCC 8801 / RF-1)
B9J7W1 3.04e-05 51 28 7 170 3 der GTPase Der Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q1IWI7 3.31e-05 50 31 5 122 3 der GTPase Der Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B5X2B8 3.46e-05 50 28 3 151 2 eral1 GTPase Era, mitochondrial Salmo salar
A6WW65 3.59e-05 50 33 2 95 3 der GTPase Der Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A6WW65 0.001 46 26 6 171 3 der GTPase Der Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
A5WGA8 3.64e-05 50 31 4 125 3 der GTPase Der Psychrobacter sp. (strain PRwf-1)
Q92UK6 3.85e-05 50 29 6 168 3 der GTPase Der Rhizobium meliloti (strain 1021)
B0TAF1 4.33e-05 49 25 5 160 3 era GTPase Era Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q04A20 4.7e-05 49 28 4 121 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1G9W6 4.7e-05 49 28 4 121 3 era GTPase Era Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P38860 4.86e-05 50 28 9 178 1 MTG2 GTPase MTG2, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
K7UTH7 4.87e-05 50 26 5 162 2 ERA1 GTPase ERA1, chloroplastic Zea mays
A1SU43 4.99e-05 50 33 3 92 3 der GTPase Der Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q1AVU3 5.35e-05 50 31 5 128 3 obg GTPase Obg Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
F4HSD4 5.42e-05 50 26 5 168 2 ATOBGM Probable GTP-binding protein OBGM, mitochondrial Arabidopsis thaliana
Q2SDW8 5.69e-05 50 31 4 122 3 der GTPase Der Hahella chejuensis (strain KCTC 2396)
B0KPJ1 5.71e-05 50 26 6 165 3 der GTPase Der Pseudomonas putida (strain GB-1)
B8F3C8 5.74e-05 49 27 7 165 3 era GTPase Era Glaesserella parasuis serovar 5 (strain SH0165)
Q3B1B4 5.8e-05 50 29 5 158 3 mnmE tRNA modification GTPase MnmE Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
C3LT16 5.81e-05 50 29 6 141 3 der GTPase Der Vibrio cholerae serotype O1 (strain M66-2)
Q9KTW7 5.81e-05 50 29 6 141 3 der GTPase Der Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3E6 5.81e-05 50 29 6 141 3 der GTPase Der Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8DY73 5.91e-05 50 29 9 181 3 der GTPase Der Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZR6 5.91e-05 50 29 9 181 3 der GTPase Der Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
A6UDV6 5.94e-05 49 23 5 170 3 obg GTPase Obg Sinorhizobium medicae (strain WSM419)
B0U3D9 5.94e-05 49 33 4 125 3 era GTPase Era Xylella fastidiosa (strain M12)
Q9PB97 6e-05 49 33 4 125 3 era GTPase Era Xylella fastidiosa (strain 9a5c)
Q9HME0 6e-05 48 25 7 185 3 engB Probable GTP-binding protein EngB Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R871 6e-05 48 25 7 185 3 engB Probable GTP-binding protein EngB Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q4FTW3 6.21e-05 50 33 4 125 3 der GTPase Der Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q87C05 6.33e-05 49 33 4 125 3 era GTPase Era Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I605 6.33e-05 49 33 4 125 3 era GTPase Era Xylella fastidiosa (strain M23)
A5VYT9 6.33e-05 50 26 6 165 3 der GTPase Der Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0CK66 6.47e-05 50 34 2 94 3 der GTPase Der Brucella suis (strain ATCC 23445 / NCTC 10510)
B0CK66 0.000683 46 26 6 171 3 der GTPase Der Brucella suis (strain ATCC 23445 / NCTC 10510)
B5Z140 6.48e-05 49 23 6 172 3 era GTPase Era Escherichia coli O157:H7 (strain EC4115 / EHEC)
P58070 6.48e-05 49 23 6 172 3 era GTPase Era Escherichia coli O157:H7
A6KXK1 6.63e-05 49 31 4 122 3 der GTPase Der Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q1QD14 6.78e-05 50 33 4 125 3 der GTPase Der Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
B1HVB2 7.57e-05 49 23 9 213 3 obg GTPase Obg Lysinibacillus sphaericus (strain C3-41)
Q0AB37 7.92e-05 49 29 5 157 3 der GTPase Der Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B9DTQ3 8.51e-05 49 29 6 163 3 der GTPase Der Streptococcus uberis (strain ATCC BAA-854 / 0140J)
P06616 8.78e-05 48 23 6 172 1 era GTPase Era Escherichia coli (strain K12)
B1IVR1 8.78e-05 48 23 6 172 3 era GTPase Era Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A376 8.78e-05 48 23 6 172 3 era GTPase Era Escherichia coli O9:H4 (strain HS)
B1XB40 8.78e-05 48 23 6 172 3 era GTPase Era Escherichia coli (strain K12 / DH10B)
C4ZYI9 8.78e-05 48 23 6 172 3 era GTPase Era Escherichia coli (strain K12 / MC4100 / BW2952)
B1JDV4 8.87e-05 49 26 6 165 3 der GTPase Der Pseudomonas putida (strain W619)
Q0T1T9 9.01e-05 48 23 6 172 3 era GTPase Era Shigella flexneri serotype 5b (strain 8401)
Q3IU04 9.03e-05 47 24 7 186 3 engB Probable GTP-binding protein EngB Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
A3CPT0 9.44e-05 49 28 6 163 3 der GTPase Der Streptococcus sanguinis (strain SK36)
Q83QI5 9.68e-05 48 23 6 172 3 era GTPase Era Shigella flexneri
A8AVL8 9.86e-05 49 28 6 163 3 der GTPase Der Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C6C0G0 0.000101 49 31 4 132 3 der GTPase Der Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B0V4V6 0.000111 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain AYE)
B0V4V6 0.000122 48 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain AYE)
A3M215 0.000111 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
A3M215 0.000122 48 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I3F0 0.000111 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain ACICU)
B2I3F0 0.000122 48 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain ACICU)
B7H065 0.000111 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain AB307-0294)
B7H065 0.000122 48 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain AB307-0294)
Q47WC5 0.000112 49 31 3 94 3 der GTPase Der Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B0VKR4 0.000114 49 33 4 121 3 der GTPase Der Acinetobacter baumannii (strain SDF)
B0VKR4 0.000126 48 26 8 217 3 der GTPase Der Acinetobacter baumannii (strain SDF)
Q1IEH7 0.000116 49 26 6 165 3 der GTPase Der Pseudomonas entomophila (strain L48)
Q3YYV0 0.000118 48 23 6 172 3 era GTPase Era Shigella sonnei (strain Ss046)
Q31XS1 0.000118 48 23 6 172 3 era GTPase Era Shigella boydii serotype 4 (strain Sb227)
B2TXX9 0.000118 48 23 6 172 3 era GTPase Era Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1R8G7 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli (strain UTI89 / UPEC)
B1LP79 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli (strain SMS-3-5 / SECEC)
B6I5E0 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli (strain SE11)
B7N6F4 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FF17 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TES2 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE96 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O1:K1 / APEC
B7M8H9 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O8 (strain IAI1)
B7MYJ7 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O81 (strain ED1a)
B7NRL9 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LDF9 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli (strain 55989 / EAEC)
B7MIQ1 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH06 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQ10 0.000118 48 23 6 172 3 era GTPase Era Escherichia coli O139:H28 (strain E24377A / ETEC)
B4RV85 0.000119 49 32 3 92 3 der1 GTPase Der Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q32CV5 0.00012 48 23 6 172 3 era GTPase Era Shigella dysenteriae serotype 1 (strain Sd197)
B7LUZ8 0.000124 48 23 6 172 3 era GTPase Era Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q054P6 0.000125 48 26 6 197 3 obg GTPase Obg Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04Q90 0.000125 48 26 6 197 3 obg GTPase Obg Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
A4VW74 0.000129 48 23 5 159 3 era GTPase Era Streptococcus suis (strain 05ZYH33)
A4W2H9 0.000129 48 23 5 159 3 era GTPase Era Streptococcus suis (strain 98HAH33)
Q87LP0 0.000136 48 22 7 167 3 era GTPase Era Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1VNF8 0.000143 48 30 4 120 3 der GTPase Der Polaromonas naphthalenivorans (strain CJ2)
C3MG60 0.000152 48 29 6 168 3 der GTPase Der Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q3AEZ3 0.000153 48 27 5 159 3 era GTPase Era Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q88PJ3 0.000155 48 26 6 165 3 der GTPase Der Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5VNV9 0.000156 48 32 2 94 3 der GTPase Der Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A5VNV9 0.000632 47 26 6 171 3 der GTPase Der Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B3PDM5 0.000158 48 32 3 92 3 der GTPase Der Cellvibrio japonicus (strain Ueda107)
A2RGB0 0.000163 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M5 (strain Manfredo)
Q8G2E8 0.000166 48 32 2 94 3 der GTPase Der Brucella suis biovar 1 (strain 1330)
Q8G2E8 0.000719 46 26 6 171 3 der GTPase Der Brucella suis biovar 1 (strain 1330)
Q8YFH2 0.000166 48 32 2 94 3 der GTPase Der Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YFH2 0.000403 47 26 6 171 3 der GTPase Der Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RH89 0.000166 48 32 2 94 3 der GTPase Der Brucella melitensis biotype 2 (strain ATCC 23457)
C0RH89 0.000403 47 26 6 171 3 der GTPase Der Brucella melitensis biotype 2 (strain ATCC 23457)
A9M8F4 0.000166 48 32 2 94 3 der GTPase Der Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
A9M8F4 0.000719 46 26 6 171 3 der GTPase Der Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57EY6 0.000166 48 32 2 94 3 der GTPase Der Brucella abortus biovar 1 (strain 9-941)
Q57EY6 0.000632 47 26 6 171 3 der GTPase Der Brucella abortus biovar 1 (strain 9-941)
Q2YM98 0.000166 48 32 2 94 3 der GTPase Der Brucella abortus (strain 2308)
Q2YM98 0.000632 47 26 6 171 3 der GTPase Der Brucella abortus (strain 2308)
B2S9M3 0.000166 48 32 2 94 3 der GTPase Der Brucella abortus (strain S19)
B2S9M3 0.000632 47 26 6 171 3 der GTPase Der Brucella abortus (strain S19)
A9MGX7 0.00017 48 25 7 168 3 era GTPase Era Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P0DA91 0.000172 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DA90 0.000172 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B6IZN3 0.000174 48 28 4 138 3 der GTPase Der Coxiella burnetii (strain CbuG_Q212)
B5XJW0 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M49 (strain NZ131)
Q1JNC4 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JDF1 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M12 (strain MGAS2096)
P64065 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5XDR3 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P64064 0.000179 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M1
Q64NV3 0.00018 48 28 4 122 3 der GTPase Der Bacteroides fragilis (strain YCH46)
Q5L8K8 0.00018 48 28 4 122 3 der GTPase Der Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
O67800 0.000182 47 27 9 185 1 era GTPase Era Aquifex aeolicus (strain VF5)
Q83C83 0.000185 48 28 4 138 1 der GTPase Der Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV6 0.000185 48 28 4 138 3 der GTPase Der Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU3 0.000185 48 28 4 138 3 der GTPase Der Coxiella burnetii (strain Dugway 5J108-111)
B6J7Q3 0.000185 48 28 4 138 3 der GTPase Der Coxiella burnetii (strain CbuK_Q154)
B9JZQ5 0.000188 48 29 7 170 3 der GTPase Der Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q1J8C9 0.000189 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JIH4 0.000189 48 28 6 163 3 der GTPase Der Streptococcus pyogenes serotype M2 (strain MGAS10270)
A6TQJ6 0.000191 48 28 7 167 3 obg GTPase Obg Alkaliphilus metalliredigens (strain QYMF)
C1CSX0 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain Taiwan19F-14)
C1CM45 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain P1031)
C1CFT0 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain JJA)
P64063 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B2IRW4 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain CGSP14)
P64062 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
B8ZMH4 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I766 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain Hungary19A-6)
C1C8U6 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae (strain 70585)
B5E756 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 19F (strain G54)
Q04J64 0.000194 48 27 6 163 3 der GTPase Der Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A4SGR9 0.000194 48 24 5 163 3 mnmE tRNA modification GTPase MnmE Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q6LU45 0.000208 48 31 4 94 3 der GTPase Der Photobacterium profundum (strain SS9)
Q2GA15 0.000218 48 27 11 181 3 der GTPase Der Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q5P7B7 0.000219 48 25 5 158 3 der GTPase Der Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8Z4K5 0.00024 47 23 6 172 3 era GTPase Era Salmonella typhi
C4K4J2 0.000244 48 32 3 92 3 der GTPase Der Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q8DF02 0.000255 48 33 4 117 3 der GTPase Der Vibrio vulnificus (strain CMCP6)
Q03Y33 0.000255 47 29 9 164 3 era GTPase Era Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q8VZ74 0.000261 47 27 5 166 2 At5g66470 GTPase ERA-like, chloroplastic Arabidopsis thaliana
Q7MNE7 0.000264 48 33 4 117 3 der GTPase Der Vibrio vulnificus (strain YJ016)
B5EJF7 0.000266 48 26 8 198 3 der GTPase Der Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JC34 0.000266 48 26 8 198 3 der GTPase Der Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A3DHY8 0.000272 48 29 10 164 3 mnmE tRNA modification GTPase MnmE Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9ZE30 0.000274 47 30 6 132 3 era GTPase Era Rickettsia prowazekii (strain Madrid E)
Q7VM29 0.000285 48 32 3 92 3 der GTPase Der Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A8Z608 0.000285 47 23 13 272 3 der GTPase Der Karelsulcia muelleri (strain GWSS)
B1VGL9 0.000295 47 24 6 189 3 obg GTPase Obg Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B8F4X7 0.000298 47 32 3 92 3 der GTPase Der Glaesserella parasuis serovar 5 (strain SH0165)
C6E2H7 0.000302 47 24 8 177 3 era GTPase Era Geobacter sp. (strain M21)
B3E422 0.000303 47 25 7 209 3 era GTPase Era Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B9LNM9 0.000304 46 26 4 151 3 engB Probable GTP-binding protein EngB Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
A9N1T2 0.000319 47 23 6 172 3 era GTPase Era Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TS13 0.000333 47 23 6 172 3 era GTPase Era Salmonella schwarzengrund (strain CVM19633)
B5BAT1 0.000333 47 23 6 172 3 era GTPase Era Salmonella paratyphi A (strain AKU_12601)
C0PYG8 0.000333 47 23 6 172 3 era GTPase Era Salmonella paratyphi C (strain RKS4594)
Q5PIG4 0.000333 47 23 6 172 3 era GTPase Era Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RD48 0.000333 47 23 6 172 3 era GTPase Era Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QTU7 0.000333 47 23 6 172 3 era GTPase Era Salmonella enteritidis PT4 (strain P125109)
B5FRC4 0.000333 47 23 6 172 3 era GTPase Era Salmonella dublin (strain CT_02021853)
Q57LD1 0.000333 47 23 6 172 3 era GTPase Era Salmonella choleraesuis (strain SC-B67)
B5F1G0 0.000333 47 23 6 172 3 era GTPase Era Salmonella agona (strain SL483)
Q48V63 0.000335 47 28 6 159 3 der GTPase Der Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q0C441 0.000344 47 30 4 121 3 der GTPase Der Hyphomonas neptunium (strain ATCC 15444)
Q5U528 0.000348 47 26 5 140 2 gtpbp10 GTP-binding protein 10 Xenopus laevis
Q5NR23 0.000349 47 25 4 160 3 obg GTPase Obg Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A5VD74 0.00035 47 25 4 167 3 obg GTPase Obg Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
C0ZCB6 0.00035 47 27 7 166 3 der GTPase Der Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
B0S6U7 0.000365 47 29 2 141 2 eral1 GTPase Era, mitochondrial Danio rerio
B0UMS4 0.000366 47 26 6 173 3 obg GTPase Obg Methylobacterium sp. (strain 4-46)
A5G692 0.000405 47 28 4 132 3 der GTPase Der Geotalea uraniireducens (strain Rf4)
B5ZYX3 0.000409 47 27 7 187 3 der GTPase Der Rhizobium leguminosarum bv. trifolii (strain WSM2304)
A8AD18 0.00042 47 23 6 172 3 era GTPase Era Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0APC5 0.000443 47 35 3 95 3 era GTPase Era Maricaulis maris (strain MCS10)
C1F9K2 0.000444 47 24 6 171 3 obg GTPase Obg Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q1B629 0.000444 47 23 5 173 3 obg GTPase Obg Mycobacterium sp. (strain MCS)
A1UJ07 0.000444 47 23 5 173 3 obg GTPase Obg Mycobacterium sp. (strain KMS)
A3Q2F3 0.000444 47 23 5 173 3 obg GTPase Obg Mycobacterium sp. (strain JLS)
Q13X32 0.000452 47 26 5 157 3 der GTPase Der Paraburkholderia xenovorans (strain LB400)
B9MS56 0.000457 46 32 5 136 3 era GTPase Era Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
C4XIQ6 0.000475 47 28 6 164 3 der GTPase Der Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q3K7C0 0.000483 47 33 3 93 3 der GTPase Der Pseudomonas fluorescens (strain Pf0-1)
C5BLV6 0.000493 47 32 4 121 3 der GTPase Der Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q4ZX19 0.000504 47 26 6 158 3 der GTPase Der Pseudomonas syringae pv. syringae (strain B728a)
Q48LZ0 0.000509 47 26 6 158 3 der GTPase Der Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q9HXJ8 0.000524 47 25 8 214 3 der GTPase Der Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A6V0W4 0.000524 47 25 8 214 3 der GTPase Der Pseudomonas aeruginosa (strain PA7)
B3PVJ6 0.000534 47 27 7 187 3 der GTPase Der Rhizobium etli (strain CIAT 652)
Q886Y6 0.000549 47 26 6 158 3 der GTPase Der Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A4WZ45 0.000557 46 24 4 165 3 obg GTPase Obg Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
Q8Y0I0 0.00056 46 27 2 122 3 era GTPase Era Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q4K6V3 0.000564 47 33 3 93 3 der GTPase Der Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8A135 0.000574 47 29 4 122 3 der GTPase Der Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A9VYM4 0.000585 46 23 3 165 3 obg GTPase Obg Methylorubrum extorquens (strain PA1)
B7KSH0 0.000585 46 23 3 165 3 obg GTPase Obg Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q9RS19 0.0006 47 30 6 126 3 der GTPase Der Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A0Q125 0.0006 47 28 4 130 3 der GTPase Der Clostridium novyi (strain NT)
Q9UT06 0.000629 46 43 2 60 3 SPAP8A3.11c Uncharacterized GTP-binding protein P8A3.11c, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B8GTN1 0.000639 46 28 7 178 3 der GTPase Der Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A1WUL5 0.00064 46 27 4 166 3 der GTPase Der Halorhodospira halophila (strain DSM 244 / SL1)
A4VX53 0.000664 46 27 6 163 3 der GTPase Der Streptococcus suis (strain 05ZYH33)
A4W3F7 0.000664 46 27 6 163 3 der GTPase Der Streptococcus suis (strain 98HAH33)
B7UWJ2 0.000667 46 25 8 214 3 der GTPase Der Pseudomonas aeruginosa (strain LESB58)
Q2K5L2 0.00068 46 27 7 187 3 der GTPase Der Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q47BS0 0.000688 46 31 4 122 3 der GTPase Der Dechloromonas aromatica (strain RCB)
Q1GHZ2 0.000739 46 26 12 224 3 der GTPase Der Ruegeria sp. (strain TM1040)
B2THQ9 0.000745 46 27 3 129 3 der GTPase Der Clostridium botulinum (strain Eklund 17B / Type B)
Q56057 0.00076 45 23 6 172 3 era GTPase Era Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T1F7 0.00076 45 23 6 172 3 era GTPase Era Salmonella newport (strain SL254)
B4TE14 0.00076 45 23 6 172 3 era GTPase Era Salmonella heidelberg (strain SL476)
A7IIE4 0.000773 46 24 6 174 3 der GTPase Der Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A4XKV8 0.000778 45 31 5 145 3 era GTPase Era Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q68XY6 0.000817 45 29 6 132 3 era GTPase Era Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A5E965 0.000837 46 26 9 211 3 obg GTPase Obg Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q7A0Q3 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain MW2)
A8Z2H2 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8S5 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain MSSA476)
Q7A584 0.000838 46 24 7 173 1 obg GTPase Obg Staphylococcus aureus (strain N315)
Q99TK9 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHI6 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain Newman)
A5ITG8 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain JH9)
Q2FXT1 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG83 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain USA300)
A6U2B2 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain JH1)
A7X361 0.000838 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q0SS66 0.000841 46 27 3 129 3 der GTPase Der Clostridium perfringens (strain SM101 / Type A)
Q8XJK1 0.000841 46 27 3 129 3 der GTPase Der Clostridium perfringens (strain 13 / Type A)
Q0TPJ9 0.000841 46 27 3 129 3 der GTPase Der Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q89MZ0 0.000845 46 34 2 94 3 der GTPase Der Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5HFB9 0.000883 46 24 7 173 3 obg GTPase Obg Staphylococcus aureus (strain COL)
Q7MT48 0.000892 46 31 5 124 3 der GTPase Der Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A4XY28 0.001 46 26 8 202 3 der GTPase Der Pseudomonas mendocina (strain ymp)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS14435
Feature type CDS
Gene feoB
Product Fe(2+) transporter permease subunit FeoB
Location 113798 - 116116 (strand: -1)
Length 2319 (nucleotides) / 772 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000004
Length 258164 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1669
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02421 Ferrous iron transport protein B
PF07664 Ferrous iron transport protein B C terminus
PF07670 Nucleoside recognition
PF17910 FeoB cytosolic helical domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0370 Inorganic ion transport and metabolism (P) P Fe2+ transporter FeoB

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04759 ferrous iron transport protein B - -

Protein Sequence

MKALTLGLIGNPNSGKTTLFNQLTGSKQRVGNWAGVTVERKIGYFTTPEHKIELVDLPGTYSLTTISEQTSLDEQIACHFILSGEADMLINVVDASNLERNLYLTLQLLELGVPCIVALNMLDIADKSNIKIDIDALSERLGCPVIPLVSTRATGISELKAAVDKHNMKPHVALVSYPAALLDSVKTLAESISTHDFSATQRRWLALQSLEGDIYSQARAGFTPEHVQSVRDAMQAQQQEEPELVIADARYQTIAGICGQAIDNSNSEPNQLTASMDKIVLNRWLGVPVFLFVMYLMFVLAINIGGALQPLFEGGSEAIFIHGTQWLGITLGFPDWLTIFLAQGVGGGINTVLPLVPQIGMMYLFLSFLEDSGYMARAAFVMDRLMQALGLPGKSFVPLIVGFGCNVPSIMGARTLDAPRERLITVLMAPFMSCGARLAIFAVFAAAFFGKNGASIVFSLYILGIVVAILTGLLLKHTIMRGEASPFVMELPVYHVPHMKTLFMQTWQRLKGFVVRAGKVIIIASMFIGALNSFSFSGKPADSINDSALASVSKVLTPLLSPIGVHEDNWQATVGLITGAMAKEVVVGTLNTLYTAESITNEPFNADEFDLWGELGDAVGETVDSLKETFTLAALSNPIEASKGPGDMDGGTMGTMAAKFGSGVSAYSYLIFVLLYVPCVSVMGAIARETSRGWMTFSILWGLNVAYSLSALFYQIATFSAHPGSSALIIGITLVFNLILFAILRRTRSRVNLNFRRNMHGQCGGCSGGECH

Flanking regions ( +/- flanking 50bp)

TTCCCTCCGCCCCCGGAGGGTCTGTTTTTTATTGATTGGCATACGACACTATGAAAGCACTCACCCTGGGACTTATCGGTAATCCCAATTCAGGGAAGACCACGCTGTTTAACCAGCTGACCGGTTCAAAGCAGCGCGTCGGCAACTGGGCCGGCGTGACGGTAGAACGGAAAATTGGTTACTTCACCACGCCGGAACATAAAATTGAGCTGGTGGATTTACCCGGAACTTACTCGCTGACCACGATTTCTGAACAAACCTCTCTGGATGAACAGATTGCCTGCCACTTTATCCTCAGTGGTGAAGCGGACATGCTGATTAATGTTGTCGATGCATCCAATCTTGAACGAAATCTGTACCTTACACTTCAGTTATTAGAGCTGGGTGTGCCGTGTATCGTCGCACTTAACATGCTGGATATTGCCGACAAATCGAATATCAAAATTGATATAGATGCACTGTCTGAGCGCCTCGGCTGCCCGGTCATTCCGCTGGTATCCACCCGCGCGACCGGTATCAGTGAACTGAAAGCCGCTGTCGACAAACACAATATGAAGCCACATGTAGCGCTGGTCAGTTATCCGGCGGCACTGCTGGACAGTGTCAAAACACTGGCAGAATCTATCTCCACCCATGATTTCAGCGCAACCCAGCGCCGCTGGCTGGCATTGCAGAGCCTCGAAGGGGATATCTACAGCCAGGCGCGCGCCGGTTTTACCCCGGAGCATGTTCAGTCTGTCCGTGATGCCATGCAGGCACAGCAACAGGAAGAGCCTGAGCTGGTGATCGCCGATGCCCGTTATCAGACCATTGCCGGTATTTGCGGGCAGGCAATTGATAACTCGAATTCTGAACCAAACCAACTCACCGCCTCGATGGATAAAATTGTCCTCAACCGCTGGCTGGGCGTGCCGGTTTTCCTGTTTGTGATGTATCTGATGTTTGTACTCGCCATCAATATCGGCGGGGCATTACAGCCGCTGTTTGAAGGCGGCTCCGAAGCGATATTTATCCACGGAACACAGTGGCTGGGCATCACCCTCGGCTTCCCTGACTGGCTGACCATTTTCCTCGCCCAGGGTGTCGGCGGCGGTATCAATACTGTTCTGCCGCTCGTGCCGCAAATCGGGATGATGTATCTGTTCCTTTCCTTCCTGGAAGACTCCGGCTATATGGCGCGCGCTGCCTTTGTGATGGACAGGCTGATGCAGGCGCTCGGGTTGCCGGGCAAATCCTTTGTGCCGCTGATTGTCGGCTTCGGCTGTAATGTGCCGTCCATTATGGGTGCAAGAACCCTGGATGCGCCGCGTGAACGTCTGATCACGGTTCTGATGGCACCGTTTATGTCCTGCGGGGCGCGGCTGGCTATCTTTGCTGTCTTTGCCGCCGCCTTCTTCGGCAAAAACGGCGCAAGCATTGTATTTTCTCTGTATATCCTCGGCATTGTGGTTGCTATTCTTACCGGGCTGTTACTCAAACACACCATCATGCGCGGGGAAGCCTCTCCGTTTGTGATGGAGCTGCCGGTCTACCATGTGCCGCACATGAAAACCCTGTTTATGCAAACCTGGCAGCGCCTGAAAGGCTTTGTCGTGCGTGCGGGTAAAGTGATTATTATCGCCAGTATGTTTATCGGCGCACTCAACAGCTTCAGTTTCTCCGGTAAACCGGCGGACAGTATCAATGACTCCGCGCTGGCGTCTGTCAGTAAAGTGCTGACACCGCTGCTCAGCCCTATCGGTGTCCATGAAGATAACTGGCAGGCAACTGTCGGGCTTATCACAGGGGCGATGGCAAAAGAAGTGGTTGTCGGGACACTGAACACACTGTATACCGCTGAAAGCATCACCAATGAACCGTTTAATGCCGATGAGTTTGATCTGTGGGGTGAACTGGGTGATGCTGTTGGTGAAACAGTGGATTCCCTGAAAGAAACCTTCACGTTAGCGGCATTATCCAACCCGATTGAAGCCAGCAAAGGTCCCGGTGATATGGATGGCGGTACAATGGGAACCATGGCAGCGAAATTCGGCTCCGGTGTCTCCGCCTACAGCTATCTGATTTTTGTTCTGCTGTATGTGCCTTGCGTCTCTGTTATGGGTGCGATTGCCCGCGAAACCAGCCGTGGCTGGATGACATTCTCCATCCTGTGGGGTCTGAACGTCGCCTATTCACTCTCCGCCCTGTTCTACCAGATAGCAACCTTCAGTGCGCATCCGGGCAGCAGCGCCCTGATTATCGGTATTACACTGGTATTCAACCTGATACTGTTCGCCATACTGCGCCGGACACGCAGCAGGGTTAACCTGAACTTCCGCCGGAACATGCACGGCCAGTGTGGCGGCTGCTCCGGTGGTGAATGCCACTAACTGAGAGAGTGCGAAAATGATAAGTCTGATCGCCGTGCGTGATGCTATCG