Homologs in group_1610

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10575 FBDBKF_10575 100.0 Morganella morganii S1 rbsK Sugar or nucleoside kinase, ribokinase family
EHELCC_14910 EHELCC_14910 100.0 Morganella morganii S2 rbsK Sugar or nucleoside kinase, ribokinase family
LHKJJB_14605 LHKJJB_14605 100.0 Morganella morganii S3 rbsK Sugar or nucleoside kinase, ribokinase family
HKOGLL_13225 HKOGLL_13225 100.0 Morganella morganii S5 rbsK Sugar or nucleoside kinase, ribokinase family
F4V73_RS14285 F4V73_RS14285 92.2 Morganella psychrotolerans - sugar kinase
PMI_RS10575 PMI_RS10575 43.9 Proteus mirabilis HI4320 - sugar kinase

Distribution of the homologs in the orthogroup group_1610

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1610

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P44482 1.75e-117 344 53 2 306 3 kdgK 2-dehydro-3-deoxygluconokinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45416 1.58e-87 268 45 4 311 1 kdgK 2-dehydro-3-deoxygluconokinase Dickeya dadantii (strain 3937)
E0J5J4 3.03e-86 264 44 5 309 1 kdgK 2-dehydro-3-deoxygluconokinase Escherichia coli (strain ATCC 9637 / CCM 2024 / DSM 1116 / LMG 11080 / NBRC 13500 / NCIMB 8666 / NRRL B-766 / W)
P37647 6.34e-86 263 44 5 309 1 kdgK 2-dehydro-3-deoxygluconokinase Escherichia coli (strain K12)
Q15UF1 1.1e-51 176 31 2 311 1 Patl_1969 2-dehydro-3-deoxygluconokinase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P26420 1.09e-22 99 30 8 277 1 scrK Fructokinase Klebsiella pneumoniae
P26984 1.88e-21 95 27 6 273 3 scrK Fructokinase Salmonella typhimurium
P22824 8.88e-21 94 25 5 271 3 scrK Fructokinase Vibrio alginolyticus
Q0J8G4 3.55e-20 92 26 9 306 1 FRK2 Fructokinase-2 Oryza sativa subsp. japonica
A2YQL4 3.55e-20 92 26 9 306 1 FRK2 Fructokinase-2 Oryza sativa subsp. indica
Q0JGZ6 3.78e-20 92 27 9 299 1 FRK1 Fructokinase-1 Oryza sativa subsp. japonica
A2WXV8 4.89e-20 92 27 9 299 1 FRK1 Fructokinase-1 Oryza sativa subsp. indica
P40713 1.2e-19 90 25 9 315 3 cscK Fructokinase Escherichia coli
Q53W83 2.19e-19 90 29 9 279 1 kdgK 2-dehydro-3-deoxygluconokinase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q6XZ78 2.69e-18 87 26 9 299 1 FRK2 Fructokinase-2 Zea mays
Q8ZKR2 3.52e-18 86 27 7 325 1 STM4066 Aminoimidazole riboside kinase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O82616 9.37e-18 85 26 9 284 2 At4g10260 Probable fructokinase-5 Arabidopsis thaliana
Q6XZ79 1.22e-17 85 27 6 247 1 FRK1 Fructokinase-1 Zea mays
O29891 4.8e-17 82 26 7 256 3 AF_0356 Uncharacterized sugar kinase AF_0356 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5YBJ5 7.14e-17 83 26 7 298 3 iolC 5-dehydro-2-deoxygluconokinase Lacticaseibacillus casei
Q704D0 1.07e-16 82 26 9 306 1 kdgK 2-dehydro-3-deoxygluconokinase Thermoproteus tenax
Q9FLH8 5.75e-16 80 26 9 297 1 At5g51830 Probable fructokinase-7 Arabidopsis thaliana
D9TT10 9.57e-16 80 21 7 306 1 pfkB ATP-dependent 6-phosphofructokinase Thermoanaerobacterium thermosaccharolyticum (strain ATCC 7956 / DSM 571 / NCIMB 9385 / NCA 3814 / NCTC 13789 / WDCM 00135 / 2032)
P50845 1.08e-15 79 26 7 270 2 kdgK 2-dehydro-3-deoxygluconokinase Bacillus subtilis (strain 168)
Q97U29 1.61e-15 79 25 14 308 1 kdgK 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A7ZAH9 1.82e-14 76 25 11 303 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P42414 2.7e-14 75 24 10 302 1 iolC 5-dehydro-2-deoxygluconokinase Bacillus subtilis (strain 168)
Q9C524 3.19e-14 76 26 7 249 2 At1g66430 Probable fructokinase-6, chloroplastic Arabidopsis thaliana
P44331 1.05e-13 73 26 10 288 3 rbsK Ribokinase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A9CES5 1.1e-13 73 26 6 241 1 Atu3166 Tagatose kinase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9M1B9 1.29e-13 73 25 10 303 2 At3g59480 Probable fructokinase-4 Arabidopsis thaliana
A4IPB3 1.44e-13 73 24 9 303 3 iolC 5-dehydro-2-deoxygluconokinase Geobacillus thermodenitrificans (strain NG80-2)
Q65D02 6.58e-13 71 23 9 302 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q5WKY9 1.02e-12 71 25 9 298 3 iolC 5-dehydro-2-deoxygluconokinase Shouchella clausii (strain KSM-K16)
P77493 4.22e-12 69 22 6 295 1 ydjH Uncharacterized sugar kinase YdjH Escherichia coli (strain K12)
P37829 1.43e-11 67 24 10 301 2 None Fructokinase Solanum tuberosum
Q42896 1.51e-11 67 24 9 298 2 FRK2 Fructokinase-2 Solanum lycopersicum
Q9LNE3 2.33e-11 67 23 8 284 2 At1g06030 Probable fructokinase-2 Arabidopsis thaliana
O49923 4.4e-11 66 24 12 296 2 ADK Adenosine kinase Physcomitrium patens
B8DCT6 5.16e-11 66 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Listeria monocytogenes serotype 4a (strain HCC23)
Q9LNE4 6.81e-11 65 23 11 316 2 At1g06020 Probable fructokinase-3 Arabidopsis thaliana
Q723S9 8.78e-11 65 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Listeria monocytogenes serotype 4b (strain F2365)
C1KZA1 8.78e-11 65 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8XP78 1.19e-10 65 24 8 276 3 iolC 5-dehydro-2-deoxygluconokinase Clostridium perfringens (strain 13 / Type A)
Q0TUZ4 1.19e-10 65 24 8 276 3 iolC 5-dehydro-2-deoxygluconokinase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q96XN9 1.42e-10 64 25 14 292 1 kdgK 2-dehydro-3-deoxygluconokinase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q7XJ81 1.5e-10 64 23 9 274 2 FRK2 Fructokinase-2 Solanum habrochaites
Q9SID0 1.56e-10 64 25 10 277 2 At2g31390 Probable fructokinase-1 Arabidopsis thaliana
Q92EQ5 1.81e-10 64 24 12 306 3 iolC 5-dehydro-2-deoxygluconokinase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5KYR3 1.88e-10 64 23 10 303 3 iolC 5-dehydro-2-deoxygluconokinase Geobacillus kaustophilus (strain HTA426)
Q4V1F7 4.29e-10 63 24 9 278 3 iolC2 5-dehydro-2-deoxygluconokinase 2 Bacillus cereus (strain ZK / E33L)
Q8Y9Y2 5.21e-10 63 23 10 302 3 iolC 5-dehydro-2-deoxygluconokinase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q601P9 5.62e-10 63 22 13 325 3 iolC 5-dehydro-2-deoxygluconokinase Mesomycoplasma hyopneumoniae (strain 232)
Q4A8D9 6.95e-10 62 22 13 325 3 iolC 5-dehydro-2-deoxygluconokinase Mesomycoplasma hyopneumoniae (strain 7448)
Q81QB7 1.35e-09 62 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus anthracis
C3LHY4 1.35e-09 62 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PAZ0 1.35e-09 62 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus anthracis (strain A0248)
Q6HIK4 1.36e-09 62 24 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus thuringiensis subsp. konkukian (strain 97-27)
O24767 1.49e-09 61 22 10 322 1 gsk Guanosine-inosine kinase Exiguobacterium acetylicum
Q63B75 1.95e-09 61 24 11 305 3 iolC1 5-dehydro-2-deoxygluconokinase 1 Bacillus cereus (strain ZK / E33L)
P42720 2.02e-09 61 25 8 248 3 frk Fructokinase Rhizobium leguminosarum bv. trifolii
A6M229 2.58e-09 61 23 12 316 3 iolC 5-dehydro-2-deoxygluconokinase Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C1EVJ1 4.03e-09 60 23 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus cereus (strain 03BB102)
A0REB4 4.03e-09 60 23 11 305 3 iolC 5-dehydro-2-deoxygluconokinase Bacillus thuringiensis (strain Al Hakam)
B2TJ78 5.27e-09 60 23 12 316 3 iolC 5-dehydro-2-deoxygluconokinase Clostridium botulinum (strain Eklund 17B / Type B)
B2V4J8 5.83e-09 60 23 9 289 3 iolC 5-dehydro-2-deoxygluconokinase Clostridium botulinum (strain Alaska E43 / Type E3)
Q4AAB0 1.01e-08 59 22 13 325 3 iolC 5-dehydro-2-deoxygluconokinase Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
O59128 2.13e-08 58 25 13 279 1 PH1459 Putative sugar kinase PH1459 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
O34768 3.48e-08 57 24 6 249 3 ydjE Uncharacterized sugar kinase YdjE Bacillus subtilis (strain 168)
O60116 4.34e-08 57 24 10 286 3 rbk1 Ribokinase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D4GSE6 8.15e-08 56 25 10 284 1 kdgK1 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q9SF85 8.86e-08 56 25 13 304 1 ADK1 Adenosine kinase 1 Arabidopsis thaliana
A1A6H3 1.17e-07 56 38 2 88 1 RBSK Ribokinase Arabidopsis thaliana
P24261 1.64e-07 54 26 5 188 3 scrK Fructokinase (Fragment) Salmonella thompson
Q9LZG0 4.35e-07 54 24 10 271 1 ADK2 Adenosine kinase 2 Arabidopsis thaliana
P83534 1.49e-06 53 26 14 282 1 rbsK/rbiA Bifunctional ribokinase/ribose-5-phosphate isomerase A Fructilactobacillus sanfranciscensis (strain ATCC 27651 / DSM 20451 / JCM 5668 / CCUG 30143 / KCTC 3205 / NCIMB 702811 / NRRL B-3934 / L-12)
P78825 1.5e-06 52 21 7 284 2 ado1 Adenosine kinase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q57849 4.82e-06 50 21 10 280 1 MJ0406 Nucleoside kinase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
E9AD19 5.98e-06 50 25 12 282 1 LMJF_27_0420 Ribokinase Leishmania major
Q5JDG9 8.26e-06 50 25 14 298 1 TK2029 ADP-dependent ribose-1-phosphate kinase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q6LK43 1.13e-05 50 21 7 274 3 iolC 5-dehydro-2-deoxygluconokinase Photobacterium profundum (strain SS9)
O27587 1.57e-05 49 22 11 279 3 MTH_1544 Nucleoside kinase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q64640 3.21e-05 48 29 2 121 1 Adk Adenosine kinase Rattus norvegicus
D4GR05 3.42e-05 48 26 11 285 1 kdgK2 2-dehydro-3-deoxygalactonokinase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P47143 6.54e-05 47 44 0 52 1 ADO1 Adenosine kinase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P55263 7.81e-05 47 28 2 121 1 ADK Adenosine kinase Homo sapiens
P9WID5 9.48e-05 47 24 10 289 1 adoK Adenosine kinase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WID4 9.48e-05 47 24 10 289 3 adoK Adenosine kinase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4N0 9.48e-05 47 24 10 289 1 adoK Adenosine kinase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
P83736 9.48e-05 47 24 10 289 1 adoK Adenosine kinase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q55480 0.000114 47 23 9 282 3 slr0537 Uncharacterized sugar kinase slr0537 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P32143 0.000139 46 21 6 256 1 yihV Sulfofructose kinase Escherichia coli (strain K12)
Q8X839 0.000143 46 25 12 280 3 frlD Fructoselysine 6-kinase Escherichia coli O157:H7
P55262 0.000145 46 28 2 121 1 ADK Adenosine kinase Cricetulus griseus
P55264 0.00015 46 28 3 121 1 Adk Adenosine kinase Mus musculus
Q83JB1 0.00026 45 25 12 278 3 frlD Fructoselysine 6-kinase Shigella flexneri
P45543 0.000282 45 25 12 278 1 frlD Fructoselysine 6-kinase Escherichia coli (strain K12)
O93919 0.000529 45 42 0 45 2 ADK Adenosine kinase Schizophyllum commune
Q54MB5 0.000584 44 35 2 64 3 adk Adenosine kinase Dictyostelium discoideum
Q5JEK6 0.000841 43 28 4 163 1 TK1843 Cytidine kinase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_14740
Feature type CDS
Gene rbsK
Product Sugar or nucleoside kinase, ribokinase family
Location 75484 - 76446 (strand: 1)
Length 963 (nucleotides) / 320 (amino acids)

Contig

Accession ZDB_530
Length 141725 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1610
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00294 pfkB family carbohydrate kinase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0524 Carbohydrate transport and metabolism (G) G Sugar or nucleoside kinase, ribokinase family

Kegg Ortholog Annotation(s)

Protein Sequence

MTVKRIGLIGECMIELNGAPFGEMVQRYGGDALNSAVYLARAAGDAVEVNFISAMGTDPLSKGMISRWQAEGVNTAHVLIDPHHQPGLYLIQLDEQGERTFLYWRNDSAARYLVRHPEYPALLAQMAQMDAIYLSGISLAILPPQDRLQLLDDLKTLSQQGKTILFDSNYRPALWADENETRDCYQAMYALTDMALVTDDDEARLWGDSDRNATFARLAKAGVKQAIIKAGAQGCDYRDLRTDAPAINIATTPAEQVVDTTSAGDAFNAGFLAGWLTGADIERAARMGHRLAGVVIQHKGAIIPQAATRPVTDTLLNNTF

Flanking regions ( +/- flanking 50bp)

ATCTGTTTCAATAATGCACAGCGTTATTTTTCCGCTGCAAAAGGTGAATAATGACAGTGAAACGCATTGGTCTGATCGGCGAGTGCATGATTGAACTCAACGGCGCGCCGTTCGGGGAGATGGTTCAGCGCTACGGCGGTGATGCCCTGAACAGTGCGGTTTATCTGGCCCGTGCGGCCGGAGACGCCGTTGAGGTGAATTTTATCTCTGCCATGGGAACCGACCCGCTCAGTAAAGGCATGATCAGCCGCTGGCAGGCGGAAGGGGTCAACACTGCGCATGTACTGATCGATCCGCATCATCAGCCGGGGTTATACCTTATCCAGCTGGATGAGCAGGGCGAGCGCACGTTCCTTTACTGGCGCAATGATTCGGCGGCGCGCTATCTTGTCCGCCATCCGGAATACCCGGCACTGCTGGCACAGATGGCGCAGATGGATGCCATTTATCTCAGCGGGATCAGCCTTGCCATTCTGCCGCCGCAAGACCGGCTGCAATTGCTGGATGACCTGAAAACACTGTCACAGCAGGGCAAAACTATCCTGTTCGACAGTAACTACCGCCCGGCACTGTGGGCGGATGAAAATGAAACCCGTGACTGTTATCAGGCAATGTATGCACTGACTGACATGGCGCTGGTCACTGATGATGATGAAGCACGTCTGTGGGGCGACAGCGACCGCAATGCCACCTTTGCCCGTCTGGCAAAAGCCGGGGTGAAGCAGGCGATTATCAAAGCGGGTGCTCAGGGGTGTGACTACCGTGATTTGCGCACTGACGCACCGGCCATCAATATTGCCACCACCCCGGCTGAACAGGTGGTTGATACCACCTCTGCCGGTGATGCCTTTAACGCAGGGTTCCTGGCGGGCTGGCTGACCGGCGCGGATATTGAACGCGCTGCCCGGATGGGCCACCGGCTTGCGGGTGTGGTGATTCAGCACAAAGGGGCGATTATCCCGCAGGCGGCGACCCGCCCGGTCACTGATACTTTACTGAATAACACGTTTTAACGGGAAAAGAGGAGAACGAGATGTCCGAATTACAGGCAATGATTACCCGT