Homologs in group_2767

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_07775 FBDBKF_07775 100.0 Morganella morganii S1 - AAA domain-containing protein
EHELCC_13605 EHELCC_13605 100.0 Morganella morganii S2 - AAA domain-containing protein
LHKJJB_08800 LHKJJB_08800 100.0 Morganella morganii S3 - AAA domain-containing protein
HKOGLL_08350 HKOGLL_08350 100.0 Morganella morganii S5 - AAA domain-containing protein
F4V73_RS13270 F4V73_RS13270 92.0 Morganella psychrotolerans - sigma 54-interacting transcriptional regulator

Distribution of the homologs in the orthogroup group_2767

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2767

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q46802 0.0 784 64 4 608 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P26047 1.15e-81 272 42 4 342 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q06065 5.95e-81 265 44 7 343 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
Q01265 1.71e-77 251 47 3 263 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
Q9APD9 2.25e-75 250 43 7 340 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
P25852 5e-75 249 42 6 337 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14375 1.48e-74 248 43 5 337 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
Q9KT84 1.53e-74 248 42 6 340 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8Z333 4.47e-74 247 41 5 337 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
Q8X613 4.52e-74 247 43 5 337 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P0C5S5 5.17e-74 247 42 6 341 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 5.17e-74 247 42 6 341 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 9.51e-74 246 42 6 340 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P71229 1.21e-73 252 49 2 255 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
Q9KN48 1.62e-73 248 41 7 372 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O87455 2.7e-73 247 42 8 344 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P0AFB8 5.46e-73 245 43 7 338 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 5.46e-73 245 43 7 338 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
O31551 7.92e-73 248 38 6 355 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
Q3K999 8.32e-73 241 51 2 226 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
Q7MM78 7.37e-72 241 42 6 340 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 7.37e-72 241 42 6 340 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
P03029 1.13e-71 241 42 4 337 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
O85057 2.96e-71 242 33 9 470 1 None Limonene hydroxylase Geobacillus stearothermophilus
P41789 5.12e-71 239 43 6 337 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
G3XCV0 5.69e-71 240 40 9 385 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10577 1.97e-70 238 40 6 347 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
P17899 5.97e-70 236 43 5 331 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q845S7 1.34e-69 233 50 2 228 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
P0AFU5 1.56e-69 235 53 1 213 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 1.56e-69 235 53 1 213 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
Q43965 5.86e-69 236 37 5 361 1 mopR Phenol regulator MopR Acinetobacter guillouiae
P12627 8.15e-69 235 39 6 342 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P45671 1.48e-68 233 41 8 343 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
P54529 1.6e-68 238 35 6 386 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P0CL46 2.31e-68 238 47 3 262 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAA4 2.66e-68 238 47 3 262 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
A6TCX4 2.79e-68 234 44 2 280 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q88RJ6 3.75e-68 231 42 5 323 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q00934 5.39e-68 231 38 7 339 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P06519 7.2e-68 234 38 4 341 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P27713 7.59e-68 233 50 1 230 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
P12626 1.61e-67 232 39 5 342 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
P19323 3.44e-67 235 38 8 376 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
B5XVA2 1.05e-66 229 45 1 248 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P28787 2.93e-66 227 39 6 340 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P54929 3.6e-66 231 50 2 230 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 3.78e-66 231 46 6 287 1 nifA Nif-specific regulatory protein Azospirillum brasilense
Q9I4N3 4.18e-66 226 42 7 332 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AQ2 5.25e-66 226 37 6 377 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q04848 7.3e-66 226 39 9 345 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P28614 2.76e-65 229 41 6 322 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P29267 3.72e-65 224 40 9 337 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P05407 6.58e-65 226 41 4 300 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P23747 1.13e-64 222 37 5 353 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6D8R9 1.88e-64 223 37 5 343 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P09570 2e-64 223 48 4 249 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
A8GG93 2.82e-64 223 44 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
P10576 4.76e-64 221 37 8 346 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
Q5E3W8 7.16e-64 222 47 1 226 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P03027 7.72e-64 222 48 2 233 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P09133 9.74e-64 224 46 4 271 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P56266 1.03e-63 221 48 2 233 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
Q9K4U8 1.15e-63 221 46 1 226 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P13632 2.24e-63 219 47 1 227 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
A8ANR6 2.86e-63 220 39 7 343 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5FSZ0 3.14e-63 220 39 5 345 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
P54930 4.43e-63 220 48 2 230 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
C0PWN2 5.2e-63 219 39 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5F363 1.02e-62 218 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
A4WDR5 1.04e-62 218 39 6 343 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
Q9HU19 1.21e-62 217 39 5 341 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7LW25 1.63e-62 218 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B1LQ27 2.34e-62 218 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B4T3B0 2.83e-62 217 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q8ZMJ8 3.21e-62 217 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 3.21e-62 217 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
A9MFX7 3.24e-62 217 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B4TF23 3.34e-62 217 39 6 342 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B6I695 3.37e-62 217 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
Q0TEH1 4.49e-62 217 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P38022 4.66e-62 216 36 5 347 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
A7ZQD8 4.73e-62 217 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P10046 4.87e-62 215 37 5 343 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
B7M9E6 5.09e-62 216 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q8Z4C6 5.49e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 5.49e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 5.49e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 5.49e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
Q5PF20 5.96e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RDG4 5.96e-62 216 38 6 348 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7MZ04 7.01e-62 216 38 6 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
P74839 7.23e-62 217 40 6 286 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q3YYF5 7.69e-62 216 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
Q1R7Z1 7.69e-62 216 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 7.69e-62 216 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 7.69e-62 216 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
P24426 9.72e-62 211 46 2 228 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
B7UHC1 1.01e-61 216 38 6 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B1IUX0 1.02e-61 216 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q31X73 1.05e-61 216 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
Q8FEN6 1.1e-61 216 38 6 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77743 1.17e-61 216 41 5 279 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
B7NSI9 1.17e-61 216 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A8A3I6 1.22e-61 216 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
B7N6T9 1.3e-61 215 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7LEC0 1.6e-61 215 39 5 338 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
P59402 3.4e-61 214 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 3.4e-61 214 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q32CL9 3.73e-61 214 39 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B5Z370 4.22e-61 214 38 6 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 4.22e-61 214 38 6 344 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
P37013 4.26e-61 214 38 5 341 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 4.26e-61 214 38 5 341 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 4.26e-61 214 38 5 341 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
Q53206 4.63e-61 216 43 3 260 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A4STH5 7.05e-61 214 46 1 234 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q7MFY9 1.05e-60 213 44 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
Q8D4F9 1.21e-60 213 44 3 259 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
A0KEJ0 2.92e-60 212 46 1 226 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
P09828 6.21e-60 211 47 3 234 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P54931 1.1e-59 212 47 3 231 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q04849 2.69e-58 205 36 5 338 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
D5ARW9 3.19e-58 208 47 2 229 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 3.4e-58 208 47 2 229 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
P37344 5.01e-58 201 44 2 230 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P36219 5.99e-57 197 38 6 326 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
Q9K4V0 1.67e-56 202 45 1 226 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
O25408 3.77e-56 197 43 1 227 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P37931 9.48e-56 194 37 6 320 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P31908 7.73e-54 194 37 6 334 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9ZIB7 9.53e-53 192 30 6 391 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P26316 1.37e-51 182 35 6 316 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P37930 8.29e-51 181 34 7 318 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P0A2D7 1.39e-50 186 29 13 459 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 1.39e-50 186 29 13 459 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P07604 5.21e-49 181 31 6 336 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P03028 1.52e-48 181 45 3 229 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
O54426 2.86e-48 179 28 12 457 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
Q9ZCY9 1.03e-44 169 30 8 342 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q68WH4 1.23e-44 168 30 8 342 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UL27 2.08e-44 168 30 8 342 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RJS1 2.11e-44 168 30 7 342 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
P26408 3.89e-44 167 35 7 314 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
Q92HC2 4.03e-41 159 30 8 342 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P76016 5.27e-40 158 25 16 535 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P44694 3.89e-39 149 27 3 340 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54156 8.37e-39 149 36 6 249 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
P38035 7.86e-37 147 36 5 241 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P45512 7.97e-36 146 24 14 533 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P09432 2.5e-32 133 30 10 345 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 2.82e-23 107 27 9 347 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P06184 6.44e-17 87 25 7 342 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
D0ZLR9 6.01e-14 79 32 7 180 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P23914 1.39e-13 77 26 10 313 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P42425 2.04e-06 54 32 6 140 1 lon2 Lon protease 2 Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_14050
Feature type CDS
Gene -
Product AAA domain-containing protein
Location 71056 - 72906 (strand: 1)
Length 1851 (nucleotides) / 616 (amino acids)

Contig

Accession ZDB_529
Length 159829 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2767
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF02954 Bacterial regulatory protein, Fis family
PF13188 PAS domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K21405 sigma-54 dependent transcriptional regulator, acetoin dehydrogenase operon transcriptional activator AcoR - -

Protein Sequence

MITEKSPSVLMQIQPTIVHFSKMLASVLQLDVEIVDDKLTRIAGTGLFNQHLGHRLTNNSQLLRYVLDTKKEKIVTHSCFDPLCLNCADKDNCKEKAFIGTPIIFQDRCIGVISLVAVTSEQQERIRDNIHDFSDYVQHISNIFVAKLLDEQEGRNAAQKVLLSLIEFMDQGVLILDEANHLKFANPHALKILNVPHEKISGKTIAIRPLTYFKSLNRGHLQHIVSWEGESNIIIGQLHVVNGCQMFLMAFHQSHAAIDMNEVRRDENGLLIEHLVGESEPIRQLKHLISRVAPSPSSILVTGESGTGKEVVARAIHKLSNRSEKPFIAINCAAIPEQLLESELFGYVKGAFTGASANGKQGLIQAADKGTLFLDEIGDMPLIVQAKLLRAIESREVQPIGSSRTIPVDIRIVSATNQNLEQFVSEGKFREDLYYRLNVIPIALPPLRERHGDVELLVHHFLNVHTRRLGLVYPGISDEVMAVINAWPWPGNLRELSNLVEYLVNVVPPGEVIDISLLPPNFARHAAQMISGTAAPVQNTGDIHRSEITIPVRSVPAAAADEDPALHGETMLEEMEKQMIREALQRYDNKRQAAEELGIGIATLYRKIKKYELSAG

Flanking regions ( +/- flanking 50bp)

ATGAACTTTCTTTTCGATATGTCGTTTTAAGAGCATAGGAAGTCGTAAGCATGATCACTGAAAAATCACCATCTGTGCTGATGCAGATACAGCCGACGATTGTTCACTTCAGCAAAATGCTCGCCAGTGTGTTACAGCTTGATGTTGAAATCGTTGATGACAAACTGACAAGGATTGCCGGAACAGGGCTGTTTAACCAGCACCTCGGACATCGTCTGACCAATAATTCCCAGTTGCTCCGCTATGTGCTGGATACCAAAAAAGAAAAGATAGTCACGCACTCCTGTTTTGATCCGCTCTGCCTCAATTGCGCGGATAAAGATAACTGTAAGGAGAAAGCGTTTATCGGTACACCGATCATCTTCCAGGATCGCTGTATCGGGGTTATCAGCCTGGTGGCTGTCACCTCTGAACAGCAGGAGCGGATCCGGGATAACATCCATGACTTCTCGGATTATGTGCAGCATATTTCCAATATTTTTGTGGCTAAGCTGCTGGATGAACAGGAAGGCCGTAATGCCGCGCAGAAGGTATTACTGAGCCTGATAGAGTTTATGGATCAGGGCGTTCTGATCCTGGATGAGGCAAACCACCTGAAATTTGCCAATCCGCATGCTCTGAAGATCCTCAATGTCCCGCATGAAAAGATTTCCGGCAAAACCATTGCCATCCGTCCGCTGACCTATTTCAAGAGTCTGAACCGCGGGCATTTACAGCATATTGTCTCCTGGGAAGGGGAGAGCAATATTATTATCGGGCAGCTTCATGTGGTTAACGGCTGTCAGATGTTCCTGATGGCGTTTCATCAGTCCCACGCGGCGATTGATATGAATGAAGTGCGCCGTGATGAAAACGGATTGCTGATTGAACACCTGGTCGGGGAATCCGAACCTATCCGTCAGCTGAAACACCTGATTTCCCGCGTGGCACCGAGCCCGTCGAGTATTCTCGTCACCGGCGAGAGCGGTACCGGTAAAGAAGTGGTGGCGCGGGCTATCCATAAGCTGAGTAACCGCAGTGAAAAGCCGTTTATCGCCATCAACTGTGCGGCGATACCGGAGCAGTTACTGGAAAGTGAATTATTCGGTTATGTGAAAGGCGCGTTCACCGGCGCATCCGCCAACGGAAAACAGGGCCTGATTCAGGCGGCGGATAAAGGCACGCTGTTCCTGGATGAAATCGGCGATATGCCGCTGATTGTTCAGGCTAAATTATTACGTGCGATAGAATCACGCGAAGTGCAGCCGATTGGCTCAAGCCGGACCATCCCGGTCGATATCCGGATTGTGTCCGCAACCAACCAGAATCTGGAACAGTTTGTCAGTGAAGGCAAATTCCGCGAGGATCTCTATTACCGCCTCAATGTTATCCCGATTGCCCTGCCGCCGCTGCGTGAGCGTCACGGCGATGTGGAGCTGCTGGTGCACCATTTCCTCAATGTGCATACCAGGCGCCTCGGTCTGGTGTATCCGGGCATTTCGGATGAGGTGATGGCGGTCATTAATGCATGGCCGTGGCCGGGTAACCTGCGTGAGCTGAGTAACCTGGTGGAATATCTGGTGAACGTGGTGCCGCCGGGTGAGGTGATTGATATCTCACTGCTGCCGCCGAACTTTGCCAGACATGCGGCGCAGATGATAAGCGGCACTGCCGCACCGGTTCAGAATACCGGGGATATTCACCGCAGCGAAATTACCATTCCGGTCAGAAGCGTACCTGCGGCAGCAGCGGATGAGGATCCGGCACTGCACGGGGAAACCATGCTGGAAGAGATGGAAAAACAGATGATCCGCGAAGCACTGCAGCGCTATGACAACAAACGTCAGGCAGCAGAGGAGCTGGGGATCGGTATTGCCACTCTGTACCGGAAGATTAAGAAGTACGAGTTATCCGCCGGGTAGCAGAAAGCGGAAGAAAATGTGTGTGTGCCGAAGCCGCACGGATGTTACCG