Homologs in group_2801

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09145 FBDBKF_09145 100.0 Morganella morganii S1 hisS Histidyl-tRNA synthetase
EHELCC_10265 EHELCC_10265 100.0 Morganella morganii S2 hisS Histidyl-tRNA synthetase
LHKJJB_10745 LHKJJB_10745 100.0 Morganella morganii S3 hisS Histidyl-tRNA synthetase
HKOGLL_13805 HKOGLL_13805 100.0 Morganella morganii S5 hisS Histidyl-tRNA synthetase
F4V73_RS10805 F4V73_RS10805 86.4 Morganella psychrotolerans - ATP phosphoribosyltransferase regulatory subunit

Distribution of the homologs in the orthogroup group_2801

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2801

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B0USG9 1.6e-52 189 28 5 389 3 hisS Histidine--tRNA ligase Histophilus somni (strain 2336)
Q0I2E8 2.07e-51 186 28 5 389 3 hisS Histidine--tRNA ligase Histophilus somni (strain 129Pt)
Q65R83 1.35e-50 184 30 6 390 3 hisS Histidine--tRNA ligase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B6J7Q5 5.46e-49 179 30 6 386 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuK_Q154)
Q6D277 1.44e-48 178 28 5 391 3 hisS Histidine--tRNA ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B6IZN1 2.7e-48 177 30 6 386 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain CbuG_Q212)
Q83C80 3.08e-48 177 30 6 386 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NDV9 3.08e-48 177 30 6 386 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KFU6 3.08e-48 177 30 6 386 3 hisS Histidine--tRNA ligase Coxiella burnetii (strain Dugway 5J108-111)
C6DBH3 3.43e-48 177 28 5 391 3 hisS Histidine--tRNA ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A1JKS3 1.2e-47 176 28 5 391 3 hisS Histidine--tRNA ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q4QNH3 2.15e-47 175 28 5 375 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain 86-028NP)
A6VV07 3.42e-47 174 31 8 392 3 hisS Histidine--tRNA ligase Marinomonas sp. (strain MWYL1)
C5BET0 3.9e-47 174 30 5 377 3 hisS Histidine--tRNA ligase Edwardsiella ictaluri (strain 93-146)
P57988 7.06e-47 174 28 5 375 3 hisS Histidine--tRNA ligase Pasteurella multocida (strain Pm70)
Q7VME1 1.2e-46 173 28 5 375 3 hisS Histidine--tRNA ligase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q3K7B7 1.71e-46 173 28 7 381 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain Pf0-1)
B3GY63 2.51e-46 172 27 6 402 3 hisS Histidine--tRNA ligase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q0VNE1 2.53e-46 172 30 8 380 3 hisS Histidine--tRNA ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A6VQX5 3.01e-46 172 27 7 396 3 hisS Histidine--tRNA ligase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B8GTN4 3.36e-46 172 30 9 381 3 hisS Histidine--tRNA ligase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
A5UAB7 5.23e-46 171 28 5 375 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittEE)
P43823 6.14e-46 171 28 5 375 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A8GHW4 6.21e-46 171 27 5 391 3 hisS Histidine--tRNA ligase Serratia proteamaculans (strain 568)
Q2NS41 6.8e-46 171 29 6 393 3 hisS Histidine--tRNA ligase Sodalis glossinidius (strain morsitans)
B1JS06 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A0 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TMT6 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pestis (strain Pestoides F)
Q1CK90 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R801 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCT6 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pestis
B2K9P9 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C5I9 1.16e-45 170 28 5 391 3 hisS Histidine--tRNA ligase Yersinia pestis bv. Antiqua (strain Antiqua)
Q886Y9 1.18e-45 171 29 7 381 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A5UGH2 1.3e-45 170 28 5 375 3 hisS Histidine--tRNA ligase Haemophilus influenzae (strain PittGG)
A7FFZ0 2.18e-45 169 27 5 391 3 hisS Histidine--tRNA ligase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q603B8 3.28e-45 169 28 6 377 3 hisS Histidine--tRNA ligase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P57375 3.93e-45 169 26 5 382 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q4ZX22 4.2e-45 169 29 7 381 3 hisS Histidine--tRNA ligase Pseudomonas syringae pv. syringae (strain B728a)
Q5WWH1 6.44e-45 168 29 6 382 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Lens)
A9M402 1.45e-44 167 31 8 395 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C (strain 053442)
Q5ZV96 1.81e-44 167 29 6 382 3 hisS Histidine--tRNA ligase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X519 1.9e-44 167 29 6 382 3 hisS Histidine--tRNA ligase Legionella pneumophila (strain Paris)
Q0BK72 2.33e-44 167 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain OSU18)
Q1H0V0 2.87e-44 166 28 7 388 3 hisS Histidine--tRNA ligase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q48LZ3 3.87e-44 166 29 7 381 3 hisS Histidine--tRNA ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q1QTK7 4.15e-44 166 29 6 378 3 hisS Histidine--tRNA ligase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A0Q8F1 4.65e-44 166 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. novicida (strain U112)
Q5QYB0 5.06e-44 166 28 6 377 3 hisS Histidine--tRNA ligase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q2A1H0 5.35e-44 166 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain LVS)
A7NEI6 6.09e-44 166 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SEW9 1e-43 165 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. mediasiatica (strain FSC147)
B5XNL6 1.02e-43 165 28 5 378 3 hisS Histidine--tRNA ligase Klebsiella pneumoniae (strain 342)
B8CKR2 1.17e-43 165 27 6 400 3 hisS Histidine--tRNA ligase Shewanella piezotolerans (strain WP3 / JCM 13877)
B2VE90 1.25e-43 165 27 6 395 3 hisS Histidine--tRNA ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B4RV88 1.36e-43 165 29 5 386 3 hisS Histidine--tRNA ligase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q87S15 2.19e-43 164 29 8 392 3 hisS Histidine--tRNA ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
C3K1L3 2.24e-43 164 28 8 384 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain SBW25)
Q88PJ6 2.26e-43 164 28 7 381 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KPI8 2.26e-43 164 28 7 381 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain GB-1)
A5VYT6 2.26e-43 164 28 7 381 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0TWR5 3.05e-43 164 29 7 373 3 hisS Histidine--tRNA ligase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
A4IW12 3.07e-43 164 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NIL5 3.07e-43 164 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14K18 3.07e-43 164 28 9 405 3 hisS Histidine--tRNA ligase Francisella tularensis subsp. tularensis (strain FSC 198)
A8FT71 3.11e-43 164 28 6 380 3 hisS Histidine--tRNA ligase Shewanella sediminis (strain HAW-EB3)
Q4K6V0 3.44e-43 164 28 7 381 3 hisS Histidine--tRNA ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A1KT95 4.97e-43 163 30 9 398 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B1JDV7 7.33e-43 163 28 6 379 3 hisS Histidine--tRNA ligase Pseudomonas putida (strain W619)
A7MZE2 1.48e-42 162 28 7 374 3 hisS Histidine--tRNA ligase Vibrio campbellii (strain ATCC BAA-1116)
C1DD44 1.59e-42 162 29 7 374 3 hisS Histidine--tRNA ligase Laribacter hongkongensis (strain HLHK9)
B7VJT9 1.64e-42 162 28 9 401 3 hisS Histidine--tRNA ligase Vibrio atlanticus (strain LGP32)
Q8K9P3 1.96e-42 161 27 4 373 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9JUZ9 2.12e-42 161 30 8 395 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P59482 1.17e-41 159 28 5 364 3 hisS Histidine--tRNA ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q7NS89 1.24e-41 159 28 7 387 3 hisS Histidine--tRNA ligase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
B1KKJ3 1.26e-41 159 28 6 380 3 hisS Histidine--tRNA ligase Shewanella woodyi (strain ATCC 51908 / MS32)
Q31I05 1.29e-41 159 28 10 380 3 hisS Histidine--tRNA ligase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A1RHQ4 1.35e-41 159 27 5 377 3 hisS Histidine--tRNA ligase Shewanella sp. (strain W3-18-1)
A4Y8T9 1.35e-41 159 27 5 377 3 hisS Histidine--tRNA ligase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A4WD92 1.35e-41 159 26 5 392 3 hisS Histidine--tRNA ligase Enterobacter sp. (strain 638)
A5WGQ0 1.67e-41 159 30 11 398 3 hisS Histidine--tRNA ligase Psychrobacter sp. (strain PRwf-1)
A9MHL6 1.76e-41 159 26 5 378 3 hisS Histidine--tRNA ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P62373 2.3e-41 158 29 7 376 3 hisS Histidine--tRNA ligase Photobacterium profundum (strain SS9)
B4T0P8 2.51e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella newport (strain SL254)
B5R581 2.51e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella enteritidis PT4 (strain P125109)
B5FR62 2.51e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella dublin (strain CT_02021853)
Q5F9G8 2.66e-41 158 30 8 385 3 hisS Histidine--tRNA ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q9JZX9 2.74e-41 158 29 6 392 3 hisS Histidine--tRNA ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
B5BAY6 3.42e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain AKU_12601)
Q5PNI1 3.42e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z4P4 3.59e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella typhi
O52765 3.63e-41 158 26 5 378 1 hisS Histidine--tRNA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PYN1 3.63e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella paratyphi C (strain RKS4594)
A9N202 3.63e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B6I586 3.89e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain SE11)
B7UGW0 3.89e-41 158 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4TR94 4.47e-41 157 26 5 378 3 hisS Histidine--tRNA ligase Salmonella schwarzengrund (strain CVM19633)
B5F197 4.47e-41 157 26 5 378 3 hisS Histidine--tRNA ligase Salmonella agona (strain SL483)
Q47BR7 5.23e-41 157 30 9 381 3 hisS Histidine--tRNA ligase Dechloromonas aromatica (strain RCB)
C1DE56 5.55e-41 157 29 8 384 3 hisS Histidine--tRNA ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
B4TD92 5.66e-41 157 26 5 378 3 hisS Histidine--tRNA ligase Salmonella heidelberg (strain SL476)
Q6FEM2 6.12e-41 157 29 12 405 3 hisS Histidine--tRNA ligase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q15R57 7.39e-41 157 26 6 399 3 hisS Histidine--tRNA ligase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q3ICZ6 9.38e-41 157 28 9 385 3 hisS Histidine--tRNA ligase Pseudoalteromonas translucida (strain TAC 125)
Q9HXJ5 1.14e-40 157 28 7 382 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RV6 1.14e-40 157 28 7 382 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UWI9 1.16e-40 157 28 7 382 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain LESB58)
A1S862 1.21e-40 156 28 5 373 3 hisS Histidine--tRNA ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q1R8L9 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain UTI89 / UPEC)
B1LNG9 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain SMS-3-5 / SECEC)
P60906 1.49e-40 156 26 5 378 1 hisS Histidine--tRNA ligase Escherichia coli (strain K12)
B1IWE7 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60907 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEX1 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AE52 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O1:K1 / APEC
A8A320 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O9:H4 (strain HS)
B1XAY9 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / DH10B)
C4ZX89 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7L8 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O8 (strain IAI1)
B7MYE9 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O81 (strain ED1a)
B7NRG4 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z0Y3 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60908 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O157:H7
B7MHZ9 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZPV7 1.49e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
B5RCZ1 1.52e-40 156 26 6 389 3 hisS Histidine--tRNA ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B7LCQ4 1.55e-40 156 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli (strain 55989 / EAEC)
A8H246 1.82e-40 156 27 6 400 3 hisS Histidine--tRNA ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B7N6A2 2.11e-40 155 26 5 378 3 hisS Histidine--tRNA ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32D48 2.13e-40 155 26 5 378 3 hisS Histidine--tRNA ligase Shigella dysenteriae serotype 1 (strain Sd197)
A4SP01 4.13e-40 155 27 7 388 3 hisS Histidine--tRNA ligase Aeromonas salmonicida (strain A449)
B0TLI5 4.21e-40 155 26 6 400 3 hisS Histidine--tRNA ligase Shewanella halifaxensis (strain HAW-EB4)
A4VNX0 5.81e-40 154 29 7 385 3 hisS Histidine--tRNA ligase Stutzerimonas stutzeri (strain A1501)
Q3YZ38 6.01e-40 154 26 5 378 3 hisS Histidine--tRNA ligase Shigella sonnei (strain Ss046)
Q57LI7 6.31e-40 154 26 5 378 3 hisS Histidine--tRNA ligase Salmonella choleraesuis (strain SC-B67)
Q1QD17 8.01e-40 154 28 10 404 3 hisS Histidine--tRNA ligase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q7VRR8 8.77e-40 154 28 7 386 3 hisS Histidine--tRNA ligase Blochmanniella floridana
B5FAX3 1.14e-39 154 27 9 393 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain MJ11)
Q5E771 1.14e-39 154 27 9 393 3 hisS Histidine--tRNA ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
C3LT13 1.21e-39 154 27 8 389 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain M66-2)
Q9KTX0 1.21e-39 154 27 8 389 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3G1 1.21e-39 154 27 8 389 3 hisS Histidine--tRNA ligase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B2I3E6 1.56e-39 153 29 10 399 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ACICU)
A3M212 1.59e-39 153 29 10 399 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
Q8EC33 1.92e-39 153 27 5 377 3 hisS Histidine--tRNA ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q1IEI0 3.39e-39 152 26 5 372 3 hisS Histidine--tRNA ligase Pseudomonas entomophila (strain L48)
Q7MNF0 3.83e-39 152 27 8 392 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain YJ016)
Q8DEZ9 3.83e-39 152 27 8 392 3 hisS Histidine--tRNA ligase Vibrio vulnificus (strain CMCP6)
A9KXK7 3.94e-39 152 26 6 380 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS195)
C4LC38 4.3e-39 152 26 8 410 3 hisS Histidine--tRNA ligase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q12PT3 4.35e-39 152 27 5 373 3 hisS Histidine--tRNA ligase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
B2TXT9 4.48e-39 152 26 5 378 3 hisS Histidine--tRNA ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A0KUJ6 4.61e-39 152 27 5 377 3 hisS Histidine--tRNA ligase Shewanella sp. (strain ANA-3)
Q0HKV8 4.94e-39 152 27 5 377 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-4)
A6WQP6 5.34e-39 152 26 6 380 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS185)
A3D6V8 5.34e-39 152 26 6 380 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E9S8 5.34e-39 152 26 6 380 3 hisS Histidine--tRNA ligase Shewanella baltica (strain OS223)
A4XY31 6.95e-39 152 29 6 373 3 hisS Histidine--tRNA ligase Pseudomonas mendocina (strain ymp)
Q31XX6 8.24e-39 151 26 5 378 3 hisS Histidine--tRNA ligase Shigella boydii serotype 4 (strain Sb227)
A0KJ45 1.05e-38 151 27 7 388 3 hisS Histidine--tRNA ligase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4FTW6 1.37e-38 151 29 12 413 3 hisS Histidine--tRNA ligase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q0HX56 1.46e-38 150 27 5 377 3 hisS Histidine--tRNA ligase Shewanella sp. (strain MR-7)
Q83K44 1.59e-38 150 26 5 378 3 hisS Histidine--tRNA ligase Shigella flexneri
B7LKC4 3.64e-38 149 26 5 379 3 hisS Histidine--tRNA ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6V0W1 4.09e-38 149 27 8 405 3 hisS Histidine--tRNA ligase Pseudomonas aeruginosa (strain PA7)
Q8D1Y2 7.05e-38 149 27 6 390 3 hisS Histidine--tRNA ligase Wigglesworthia glossinidia brevipalpis
A5GQA2 7.49e-38 148 29 9 386 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain RCC307)
Q492E1 7.7e-38 149 27 8 413 3 hisS Histidine--tRNA ligase Blochmanniella pennsylvanica (strain BPEN)
B7K2B6 1.15e-37 148 26 7 382 3 hisS Histidine--tRNA ligase Rippkaea orientalis (strain PCC 8801 / RF-1)
A1WXZ0 1.2e-37 148 27 8 387 3 hisS Histidine--tRNA ligase Halorhodospira halophila (strain DSM 244 / SL1)
Q99XK9 1.56e-37 148 27 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M1
A2RGY1 1.65e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M5 (strain Manfredo)
B4EZT2 1.87e-37 147 25 6 394 3 hisS Histidine--tRNA ligase Proteus mirabilis (strain HI4320)
B8HMM0 1.9e-37 147 27 7 380 3 hisS Histidine--tRNA ligase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B5XJ83 1.97e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M49 (strain NZ131)
P0DG41 2.02e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DG40 2.02e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q8NZ19 2.06e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9E5 2.64e-37 147 28 7 394 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q48QS7 2.69e-37 147 28 7 393 3 hisS Histidine--tRNA ligase Streptococcus pyogenes serotype M28 (strain MGAS6180)
B2JIV0 2.77e-37 147 29 11 405 3 hisS Histidine--tRNA ligase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
A3NA53 4.64e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 668)
Q3JRQ5 5.11e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1710b)
A1V4K0 5.11e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain SAVP1)
Q62JW5 5.11e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain ATCC 23344)
A2S2A3 5.11e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10229)
A3MK74 5.11e-37 147 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia mallei (strain NCTC 10247)
A4VT07 5.47e-37 146 26 7 393 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 05ZYH33)
A4VZ92 5.47e-37 146 26 7 393 3 hisS Histidine--tRNA ligase Streptococcus suis (strain 98HAH33)
A1W578 5.78e-37 146 27 9 386 3 hisS Histidine--tRNA ligase Acidovorax sp. (strain JS42)
A1K3Z0 6.64e-37 146 30 10 398 3 hisS Histidine--tRNA ligase Azoarcus sp. (strain BH72)
Q2SWE3 7.46e-37 146 28 8 379 1 hisS Histidine--tRNA ligase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A3QCG3 8.13e-37 145 27 6 373 3 hisS Histidine--tRNA ligase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q63UT2 8.47e-37 146 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain K96243)
A3NVX0 8.47e-37 146 28 9 387 3 hisS Histidine--tRNA ligase Burkholderia pseudomallei (strain 1106a)
Q085U5 1.02e-36 145 26 5 373 3 hisS Histidine--tRNA ligase Shewanella frigidimarina (strain NCIMB 400)
A1AWV6 1.55e-36 145 26 7 375 3 hisS Histidine--tRNA ligase Ruthia magnifica subsp. Calyptogena magnifica
B9MFX7 1.84e-36 145 27 9 386 3 hisS Histidine--tRNA ligase Acidovorax ebreus (strain TPSY)
Q47WC1 2.08e-36 144 26 7 379 3 hisS Histidine--tRNA ligase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q8Y029 3.38e-36 144 28 8 385 3 hisS Histidine--tRNA ligase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1BGX3 4.49e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain AU 1054)
Q0BEW8 4.49e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A0K7T5 4.49e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain HI2424)
B1YR43 4.49e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia ambifaria (strain MC40-6)
B1JT91 4.76e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia orbicola (strain MC0-3)
B4EAW8 4.76e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q03F51 5.42e-36 143 26 8 392 3 hisS Histidine--tRNA ligase Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q39FR0 6.31e-36 144 29 8 384 3 hisS Histidine--tRNA ligase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9AGZ7 1.28e-35 142 28 8 384 3 hisS Histidine--tRNA ligase Burkholderia multivorans (strain ATCC 17616 / 249)
Q8DHP7 1.52e-35 142 28 8 369 3 hisS Histidine--tRNA ligase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q46ZI4 1.53e-35 142 28 10 412 3 hisS Histidine--tRNA ligase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q7VCG1 1.75e-35 142 30 9 379 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B7I5G8 1.77e-35 142 27 11 408 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB0057)
B0V5G6 1.78e-35 142 27 11 408 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AYE)
B7H068 1.78e-35 142 27 11 408 3 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain AB307-0294)
B3R1K1 1.97e-35 142 28 9 406 3 hisS Histidine--tRNA ligase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
A4JEN9 2.22e-35 142 28 8 384 3 hisS Histidine--tRNA ligase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A8AZV0 2.38e-35 141 27 7 391 3 hisS Histidine--tRNA ligase Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B2SXS9 2.44e-35 142 28 10 384 3 hisS Histidine--tRNA ligase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
C1CNA0 2.53e-35 141 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain P1031)
A5CWE8 2.57e-35 141 26 6 373 3 hisS Histidine--tRNA ligase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q5P7B4 3.44e-35 141 28 10 390 3 hisS Histidine--tRNA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3SL69 4.16e-35 140 27 9 392 3 hisS Histidine--tRNA ligase Thiobacillus denitrificans (strain ATCC 25259)
Q97NC9 4.32e-35 141 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1CAV1 4.57e-35 140 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain 70585)
Q8CWW2 5.19e-35 140 27 7 393 3 hisS Histidine--tRNA ligase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C1CU26 5.5e-35 140 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Taiwan19F-14)
Q0AE43 6.29e-35 140 29 8 381 3 hisS Histidine--tRNA ligase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q31KX6 7.03e-35 140 27 8 369 3 hisS Histidine--tRNA ligase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q7V263 8.17e-35 140 29 9 380 3 hisS Histidine--tRNA ligase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
B5E3C8 9e-35 140 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 19F (strain G54)
B2GBY6 1.19e-34 139 29 7 325 3 hisS Histidine--tRNA ligase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B1WVZ0 1.2e-34 140 26 7 382 3 hisS Histidine--tRNA ligase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q8DN46 1.47e-34 139 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
B8ZPP6 1.47e-34 139 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I9T7 1.47e-34 139 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain Hungary19A-6)
Q04I50 1.47e-34 139 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
A3CR40 1.56e-34 139 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus sanguinis (strain SK36)
B0VKR7 1.6e-34 139 31 7 306 1 hisS Histidine--tRNA ligase Acinetobacter baumannii (strain SDF)
B1XJ88 1.77e-34 139 26 7 379 3 hisS Histidine--tRNA ligase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q0A986 2.71e-34 139 27 7 377 3 hisS Histidine--tRNA ligase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0JRF1 2.75e-34 138 27 10 393 3 hisS Histidine--tRNA ligase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q0K963 2.85e-34 139 27 9 406 3 hisS Histidine--tRNA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
C1CH52 2.98e-34 138 26 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain JJA)
Q7N705 3.22e-34 138 24 6 392 3 hisS Histidine--tRNA ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q82XU9 3.49e-34 138 27 8 387 3 hisS Histidine--tRNA ligase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2IN41 3.9e-34 138 27 7 391 3 hisS Histidine--tRNA ligase Streptococcus pneumoniae (strain CGSP14)
Q13X29 8.61e-34 137 28 11 401 3 hisS Histidine--tRNA ligase Paraburkholderia xenovorans (strain LB400)
B8CXE6 9.54e-34 137 27 8 375 3 hisS Histidine--tRNA ligase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q46LS5 1.21e-33 137 29 9 377 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL2A)
Q9CE78 1.59e-33 136 26 7 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q2JRX6 1.79e-33 136 27 7 391 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain JA-3-3Ab)
A2C182 2.02e-33 136 29 9 377 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain NATL1A)
Q03IB2 4.12e-33 135 27 7 379 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q55653 4.63e-33 135 27 8 369 3 hisS Histidine--tRNA ligase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5M281 5.82e-33 135 27 7 379 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LXM9 5.82e-33 135 27 7 379 3 hisS Histidine--tRNA ligase Streptococcus thermophilus (strain CNRZ 1066)
A2BVT6 9.67e-33 134 29 10 386 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9515)
Q3B0D3 1.12e-32 134 28 10 384 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9902)
Q3JYL6 1.43e-32 134 27 7 397 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q833I1 1.44e-32 134 28 8 336 3 hisS Histidine--tRNA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
Q5N0Z5 1.83e-32 133 27 8 369 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A9B9Z7 5.91e-32 132 28 9 376 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9211)
Q8KFT6 6.22e-32 132 28 9 387 3 hisS Histidine--tRNA ligase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B3ELN3 6.49e-32 132 29 10 341 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain BS1)
P67486 8.82e-32 131 26 7 397 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P67485 8.82e-32 131 26 7 397 3 hisS Histidine--tRNA ligase Streptococcus agalactiae serotype III (strain NEM316)
Q7U9Q6 1.41e-31 130 28 9 384 3 hisS Histidine--tRNA ligase Parasynechococcus marenigrum (strain WH8102)
B9DW81 1.45e-31 130 27 7 394 3 hisS Histidine--tRNA ligase Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q02WI8 2.09e-31 130 25 7 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain SK11)
A2RN96 2.7e-31 130 25 7 390 3 hisS Histidine--tRNA ligase Lactococcus lactis subsp. cremoris (strain MG1363)
A3PBZ7 2.85e-31 130 28 9 386 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9301)
P60912 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MW2)
P60911 8.15e-31 128 28 8 382 1 hisS Histidine--tRNA ligase Staphylococcus aureus
A8Z2F8 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300 / TCH1516)
Q6G8T8 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MSSA476)
Q6GG72 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain MRSA252)
P60910 8.15e-31 128 28 8 382 1 hisS Histidine--tRNA ligase Staphylococcus aureus (strain N315)
P60909 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QHH3 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Newman)
Q5HFD2 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain COL)
Q2YT99 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5ITF5 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH9)
Q2FXU4 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FG96 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain USA300)
A6U299 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain JH1)
A7X345 8.15e-31 128 28 8 382 3 hisS Histidine--tRNA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q1WTV0 1.83e-30 127 25 7 378 3 hisS Histidine--tRNA ligase Ligilactobacillus salivarius (strain UCC118)
B3CLR6 1.99e-30 127 26 9 387 3 hisS Histidine--tRNA ligase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q03SE4 2e-30 127 27 7 326 3 hisS Histidine--tRNA ligase Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q88VQ7 3.96e-30 126 25 10 408 3 hisS Histidine--tRNA ligase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
B3QQI7 4.62e-30 126 27 9 387 3 hisS Histidine--tRNA ligase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q2KY92 1.32e-29 125 28 10 386 3 hisS Histidine--tRNA ligase Bordetella avium (strain 197N)
B4U0K6 2.26e-29 124 27 9 393 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
B9DNF9 2.3e-29 124 27 12 394 3 hisS Histidine--tRNA ligase Staphylococcus carnosus (strain TM300)
Q8CS98 2.58e-29 124 26 8 406 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HNS1 2.58e-29 124 26 8 406 3 hisS Histidine--tRNA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
C0MB21 3.84e-29 124 27 9 393 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. equi (strain 4047)
P30053 4.72e-29 123 27 9 394 1 hisS Histidine--tRNA ligase Streptococcus dysgalactiae subsp. equisimilis
B7KFP0 8.46e-29 122 25 8 387 3 hisS Histidine--tRNA ligase Gloeothece citriformis (strain PCC 7424)
Q1GAG8 1.02e-28 122 24 7 386 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
A4SE02 1.06e-28 122 26 9 380 3 hisS Histidine--tRNA ligase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
C0MGD4 1.07e-28 122 27 9 393 3 hisS Histidine--tRNA ligase Streptococcus equi subsp. zooepidemicus (strain H70)
A2BQA4 1.07e-28 122 27 8 382 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain AS9601)
Q04AV4 1.21e-28 122 24 7 386 3 hisS Histidine--tRNA ligase Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8Y708 1.28e-28 122 24 8 415 3 hisS Histidine--tRNA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92BJ3 1.43e-28 122 25 8 403 3 hisS Histidine--tRNA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5WHP4 1.55e-28 122 27 8 388 3 hisS1 Histidine--tRNA ligase 1 Shouchella clausii (strain KSM-K16)
B1HV72 1.96e-28 121 27 8 403 3 hisS Histidine--tRNA ligase Lysinibacillus sphaericus (strain C3-41)
B4SCE2 2.86e-28 121 29 8 348 3 hisS Histidine--tRNA ligase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
P60913 3.14e-28 120 24 8 371 3 hisS Histidine--tRNA ligase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B0CDA0 4.82e-28 120 25 9 391 3 hisS Histidine--tRNA ligase Acaryochloris marina (strain MBIC 11017)
Q4L6X6 4.86e-28 120 25 9 407 3 hisS Histidine--tRNA ligase Staphylococcus haemolyticus (strain JCSC1435)
Q49Y69 5.73e-28 120 26 8 382 3 hisS Histidine--tRNA ligase Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q71ZF0 6.87e-28 120 24 8 409 3 hisS Histidine--tRNA ligase Listeria monocytogenes serotype 4b (strain F2365)
C0R4G6 8.59e-28 119 27 6 333 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Drosophila simulans (strain wRi)
A7Z751 1.05e-27 119 24 9 409 3 hisS Histidine--tRNA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q3B1Z1 2.24e-27 118 28 7 346 3 hisS Histidine--tRNA ligase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
P51348 3.32e-27 118 26 8 336 3 hisS Histidine--tRNA ligase, chloroplastic Porphyra purpurea
Q38XB7 3.66e-27 118 25 11 400 3 hisS Histidine--tRNA ligase Latilactobacillus sakei subsp. sakei (strain 23K)
Q31BR1 3.73e-27 117 28 9 378 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9312)
Q0IDK4 4.16e-27 117 27 9 366 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain CC9311)
B9E707 4.48e-27 117 26 8 383 3 hisS Histidine--tRNA ligase Macrococcus caseolyticus (strain JCSC5402)
A7GT85 4.66e-27 117 23 9 392 3 hisS Histidine--tRNA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q7VWL1 4.79e-27 117 26 9 388 3 hisS Histidine--tRNA ligase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
C4L534 4.91e-27 117 25 7 378 3 hisS Histidine--tRNA ligase Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q3AQK2 5.01e-27 117 29 7 303 3 hisS Histidine--tRNA ligase Chlorobium chlorochromatii (strain CaD3)
Q5GSM4 6.38e-27 117 25 6 335 3 hisS Histidine--tRNA ligase Wolbachia sp. subsp. Brugia malayi (strain TRS)
B4S4H1 6.68e-27 117 27 11 418 3 hisS Histidine--tRNA ligase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
P62351 1.03e-26 116 26 6 334 3 hisS Histidine--tRNA ligase Wolbachia pipientis wMel
P62370 1.12e-26 116 23 7 388 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q817X7 1.62e-26 115 23 7 388 3 hisS-2 Histidine--tRNA ligase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q7W6P7 1.93e-26 115 26 9 388 3 hisS Histidine--tRNA ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WHN1 1.93e-26 115 26 9 388 3 hisS Histidine--tRNA ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q6HDC2 2.44e-26 115 23 7 388 3 hisS2 Histidine--tRNA ligase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q634E2 2.44e-26 115 23 7 388 3 hisS2 Histidine--tRNA ligase 2 Bacillus cereus (strain ZK / E33L)
Q81LI6 2.44e-26 115 23 7 388 3 hisS-2 Histidine--tRNA ligase 2 Bacillus anthracis
B9KHM7 3.39e-26 115 25 12 397 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain Florida)
B5YDT1 4.52e-26 114 24 8 374 3 hisS Histidine--tRNA ligase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q5PBP9 4.83e-26 114 25 12 397 3 hisS Histidine--tRNA ligase Anaplasma marginale (strain St. Maries)
Q3A5R6 5.21e-26 114 25 9 397 3 hisS Histidine--tRNA ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8JBF6 6.16e-26 114 27 8 376 3 hisS Histidine--tRNA ligase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
C5D510 8.98e-26 114 24 8 393 3 hisS Histidine--tRNA ligase Geobacillus sp. (strain WCH70)
B8E1C1 9.28e-26 113 26 7 345 3 hisS Histidine--tRNA ligase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A8YUZ9 1.11e-25 113 24 10 397 3 hisS Histidine--tRNA ligase Lactobacillus helveticus (strain DPC 4571)
B4UEL3 1.89e-25 112 26 8 376 3 hisS Histidine--tRNA ligase Anaeromyxobacter sp. (strain K)
A7HN13 2.3e-25 112 26 11 384 3 hisS Histidine--tRNA ligase Fervidobacterium nodosum (strain ATCC 35602 / DSM 5306 / Rt17-B1)
A1BDE6 2.97e-25 112 25 9 387 3 hisS Histidine--tRNA ligase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
B3QS95 3.34e-25 112 25 9 382 3 hisS Histidine--tRNA ligase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q5FG57 3.36e-25 112 26 7 330 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Gardel)
Q7V4P3 3.99e-25 112 25 11 406 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9313)
Q3YRB1 4.47e-25 111 25 12 412 3 hisS Histidine--tRNA ligase Ehrlichia canis (strain Jake)
Q1AWC4 4.62e-25 111 24 8 391 3 hisS Histidine--tRNA ligase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5HAI0 6.27e-25 111 26 7 330 3 hisS Histidine--tRNA ligase Ehrlichia ruminantium (strain Welgevonden)
B7GFR0 1.13e-24 110 25 8 385 3 hisS Histidine--tRNA ligase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A9NGF8 1.54e-24 110 26 7 380 3 hisS Histidine--tRNA ligase Acholeplasma laidlawii (strain PG-8A)
O32039 1.59e-24 110 24 8 383 3 hisS Histidine--tRNA ligase Bacillus subtilis (strain 168)
B9MPF7 1.76e-24 110 23 6 372 3 hisS Histidine--tRNA ligase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q5KWS8 1.9e-24 110 24 8 413 3 hisS Histidine--tRNA ligase Geobacillus kaustophilus (strain HTA426)
A2CCR1 2.17e-24 109 26 9 384 3 hisS Histidine--tRNA ligase Prochlorococcus marinus (strain MIT 9303)
Q9KDG2 2.47e-24 109 27 7 342 3 hisS Histidine--tRNA ligase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5FKI5 6.71e-24 108 24 9 380 3 hisS Histidine--tRNA ligase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
A5GIA4 8.69e-24 108 27 9 387 3 hisS Histidine--tRNA ligase Synechococcus sp. (strain WH7803)
B3EB83 8.92e-24 107 25 10 381 3 hisS Histidine--tRNA ligase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A4IR95 1.29e-23 107 23 7 385 3 hisS Histidine--tRNA ligase Geobacillus thermodenitrificans (strain NG80-2)
P60918 4.27e-23 105 25 9 331 3 hisS Histidine--tRNA ligase Onion yellows phytoplasma (strain OY-M)
B1I363 4.54e-23 105 25 9 406 3 hisS Histidine--tRNA ligase Desulforudis audaxviator (strain MP104C)
Q1XDD9 6.02e-23 105 26 9 411 3 hisS Histidine--tRNA ligase, chloroplastic Neopyropia yezoensis
Q1RJ50 6.62e-23 105 25 11 387 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain RML369-C)
A8GVU9 6.62e-23 105 25 11 387 3 hisS Histidine--tRNA ligase Rickettsia bellii (strain OSU 85-389)
Q2RWE3 1.08e-22 104 26 10 390 3 hisS Histidine--tRNA ligase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RHW0 1.21e-22 104 26 9 351 3 hisS Histidine--tRNA ligase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2GHH1 1.39e-22 103 27 11 365 3 hisS Histidine--tRNA ligase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q65GR3 2.12e-22 103 24 10 397 3 hisS Histidine--tRNA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O66522 2.53e-22 103 26 7 312 3 hisS Histidine--tRNA ligase Aquifex aeolicus (strain VF5)
B3EFA6 2.92e-22 103 27 7 313 3 hisS Histidine--tRNA ligase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
B2A2F9 4.62e-22 102 23 8 389 3 hisS Histidine--tRNA ligase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q038S0 5e-22 102 26 7 308 3 hisS Histidine--tRNA ligase Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WEM3 5e-22 102 26 7 308 3 hisS Histidine--tRNA ligase Lacticaseibacillus casei (strain BL23)
A5D3E2 6.51e-22 102 23 10 427 3 hisS Histidine--tRNA ligase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q6B910 8e-22 102 24 11 392 3 hisS Histidine--tRNA ligase, chloroplastic Gracilaria tenuistipitata var. liui
A9F907 8.06e-22 102 25 10 375 3 hisS Histidine--tRNA ligase Sorangium cellulosum (strain So ce56)
Q6ME90 1.7e-21 100 26 9 396 3 hisS Histidine--tRNA ligase Protochlamydia amoebophila (strain UWE25)
A8F593 2.05e-21 100 23 10 385 3 hisS Histidine--tRNA ligase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A3DF35 2.13e-21 100 23 7 377 3 hisS Histidine--tRNA ligase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8RGJ5 2.89e-21 100 25 9 374 3 hisS Histidine--tRNA ligase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q39UD2 3.64e-21 99 25 11 388 3 hisS Histidine--tRNA ligase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q2NIN2 3.71e-21 100 25 8 312 3 hisS Histidine--tRNA ligase Aster yellows witches'-broom phytoplasma (strain AYWB)
P56194 3.94e-21 99 26 9 331 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P62374 3.94e-21 99 26 9 331 1 hisS Histidine--tRNA ligase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q2GLK4 5.14e-21 99 23 8 375 3 hisS Histidine--tRNA ligase Anaplasma phagocytophilum (strain HZ)
Q9PQK6 5.73e-21 99 25 11 398 3 hisS Histidine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 700970)
B1AIS5 5.73e-21 99 25 11 398 3 hisS Histidine--tRNA ligase Ureaplasma parvum serovar 3 (strain ATCC 27815 / 27 / NCTC 11736)
B5YHK1 5.79e-21 99 28 10 325 3 hisS Histidine--tRNA ligase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A9HJ49 5.92e-21 99 27 4 274 3 hisS Histidine--tRNA ligase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q5YTH9 6.12e-21 99 27 10 349 3 hisS Histidine--tRNA ligase Nocardia farcinica (strain IFM 10152)
A8EZE6 6.92e-21 99 26 6 299 3 hisS Histidine--tRNA ligase Rickettsia canadensis (strain McKiel)
Q68X64 7.09e-21 99 25 9 389 3 hisS Histidine--tRNA ligase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
P60916 7.78e-21 99 22 7 377 3 hisS Histidine--tRNA ligase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q9ZDL9 9.35e-21 98 26 8 347 3 hisS Histidine--tRNA ligase Rickettsia prowazekii (strain Madrid E)
B3QZS0 1.34e-20 98 24 11 403 3 hisS Histidine--tRNA ligase Phytoplasma mali (strain AT)
A0PZW9 1.64e-20 97 23 5 318 3 hisS Histidine--tRNA ligase Clostridium novyi (strain NT)
Q8EPR9 1.82e-20 97 24 8 413 3 hisS Histidine--tRNA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q043X4 2.03e-20 97 22 7 377 3 hisS Histidine--tRNA ligase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q4UM71 2.04e-20 97 25 12 386 3 hisS Histidine--tRNA ligase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B3CTK8 4.36e-20 96 26 9 327 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Ikeda)
Q24US1 5e-20 96 24 6 336 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain Y51)
B8FQR7 5e-20 96 24 6 336 3 hisS Histidine--tRNA ligase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A6LL06 6.63e-20 96 25 8 342 3 hisS Histidine--tRNA ligase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
A5IN85 8.4e-20 95 24 9 384 3 hisS Histidine--tRNA ligase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
C4LIW5 1.03e-19 95 27 13 330 3 hisS Histidine--tRNA ligase Corynebacterium kroppenstedtii (strain DSM 44385 / JCM 11950 / CIP 105744 / CCUG 35717)
C1FKE6 1.07e-19 95 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Kyoto / Type A2)
A4XHB0 1.32e-19 95 23 8 374 3 hisS Histidine--tRNA ligase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
B0BWZ9 1.4e-19 95 27 9 308 3 hisS Histidine--tRNA ligase Rickettsia rickettsii (strain Iowa)
B1IMD8 1.46e-19 95 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Okra / Type B1)
Q92IK8 1.52e-19 95 26 8 308 3 hisS Histidine--tRNA ligase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A7GHS3 1.98e-19 94 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5I6D6 2e-19 94 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FY04 2e-19 94 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain ATCC 19397 / Type A)
A8GMY5 2.25e-19 94 27 8 301 3 hisS Histidine--tRNA ligase Rickettsia akari (strain Hartford)
C3KTB7 2.75e-19 94 22 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain 657 / Type Ba4)
B1VA46 2.77e-19 94 25 6 302 3 hisS Histidine--tRNA ligase Phytoplasma australiense
Q9X0H5 3.35e-19 94 23 8 382 3 hisS Histidine--tRNA ligase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B1L829 3.48e-19 94 23 8 382 3 hisS Histidine--tRNA ligase Thermotoga sp. (strain RQ2)
B7IHK5 4.61e-19 93 25 9 343 3 hisS Histidine--tRNA ligase Thermosipho africanus (strain TCF52B)
C3PN13 4.66e-19 93 26 8 308 3 hisS Histidine--tRNA ligase Rickettsia africae (strain ESF-5)
A5CEP8 6.56e-19 93 26 11 343 3 hisS Histidine--tRNA ligase Orientia tsutsugamushi (strain Boryong)
C4K1W2 6.95e-19 92 25 11 386 3 hisS Histidine--tRNA ligase Rickettsia peacockii (strain Rustic)
B1L097 7.07e-19 92 21 6 372 3 hisS Histidine--tRNA ligase Clostridium botulinum (strain Loch Maree / Type A3)
A1ANS7 9.21e-19 92 25 7 324 3 hisS Histidine--tRNA ligase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q8EWB8 9.58e-19 92 23 9 379 3 hisS Histidine--tRNA ligase Malacoplasma penetrans (strain HF-2)
P60915 1.02e-18 92 23 8 385 3 hisS Histidine--tRNA ligase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q252T8 1.06e-18 92 25 13 404 3 hisS Histidine--tRNA ligase Chlamydia felis (strain Fe/C-56)
Q9PJJ9 1.41e-18 92 24 10 399 3 hisS Histidine--tRNA ligase Chlamydia muridarum (strain MoPn / Nigg)
Q2GCZ0 1.44e-18 92 23 8 376 3 hisS Histidine--tRNA ligase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
P60917 1.61e-18 92 24 9 399 3 hisS Histidine--tRNA ligase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0PPE8 1.66e-18 92 25 7 337 3 hisS Histidine--tRNA ligase Mycobacterium ulcerans (strain Agy99)
Q3ZWB6 1.77e-18 91 25 8 309 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain CBDB1)
A5FSR7 1.77e-18 91 25 8 309 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B2HN79 1.9e-18 91 25 8 344 3 hisS Histidine--tRNA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
B8FKS7 1.95e-18 91 23 8 373 3 hisS Histidine--tRNA ligase Desulfatibacillum aliphaticivorans
Q0S1B6 2.04e-18 91 26 8 319 3 hisS Histidine--tRNA ligase Rhodococcus jostii (strain RHA1)
A6Q9Z9 2.17e-18 91 24 9 374 3 hisS Histidine--tRNA ligase Sulfurovum sp. (strain NBC37-1)
P9WFV5 2.25e-18 91 26 7 329 1 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFV4 2.25e-18 91 26 7 329 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U5T0 2.25e-18 91 26 7 329 3 hisS Histidine--tRNA ligase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AF49 2.25e-18 91 26 7 329 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KLS8 2.25e-18 91 26 7 329 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P67484 2.25e-18 91 26 7 329 3 hisS Histidine--tRNA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q5FUR8 2.39e-18 91 26 6 278 3 hisS Histidine--tRNA ligase Gluconobacter oxydans (strain 621H)
C1B4E1 3.01e-18 91 26 8 319 3 hisS Histidine--tRNA ligase Rhodococcus opacus (strain B4)
A4J2J1 3.07e-18 90 25 6 310 3 hisS Histidine--tRNA ligase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
C0ZZ58 3.23e-18 90 26 7 315 3 hisS Histidine--tRNA ligase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
Q6AQS3 3.3e-18 91 23 8 372 3 hisS Histidine--tRNA ligase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q3AA16 3.88e-18 90 24 10 394 3 hisS Histidine--tRNA ligase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A1T898 4.29e-18 90 24 10 388 3 hisS Histidine--tRNA ligase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
C1CV35 5.69e-18 90 24 13 402 3 hisS Histidine--tRNA ligase Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q1ISE2 6.37e-18 90 23 11 394 3 hisS Histidine--tRNA ligase Koribacter versatilis (strain Ellin345)
Q67LN9 1.27e-17 89 24 12 398 3 hisS Histidine--tRNA ligase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
O84547 1.37e-17 89 23 8 396 3 hisS Histidine--tRNA ligase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLF4 1.37e-17 89 23 8 396 3 hisS Histidine--tRNA ligase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
Q824R3 1.5e-17 89 23 7 394 3 hisS Histidine--tRNA ligase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
B0B9Z6 2.66e-17 88 23 9 396 3 hisS Histidine--tRNA ligase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B8B7 2.66e-17 88 23 9 396 3 hisS Histidine--tRNA ligase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
A9KIA5 2.68e-17 88 24 8 349 3 hisS Histidine--tRNA ligase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
C4XT36 2.72e-17 88 24 12 393 3 hisS Histidine--tRNA ligase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A0RPD3 4.03e-17 87 26 6 253 3 hisS Histidine--tRNA ligase Campylobacter fetus subsp. fetus (strain 82-40)
B1H0I8 4.68e-17 87 26 9 306 3 hisS Histidine--tRNA ligase Endomicrobium trichonymphae
Q601R3 5.24e-17 87 26 7 309 3 hisS Histidine--tRNA ligase Mesomycoplasma hyopneumoniae (strain 232)
Q4AA96 5.73e-17 87 26 7 309 3 hisS Histidine--tRNA ligase Mesomycoplasma hyopneumoniae (strain J / ATCC 25934 / NCTC 10110)
Q4A8C3 8.44e-17 86 26 7 309 3 hisS Histidine--tRNA ligase Mesomycoplasma hyopneumoniae (strain 7448)
Q3ZAI8 9.08e-17 86 24 8 309 3 hisS Histidine--tRNA ligase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
B0TF88 1.21e-16 86 24 10 391 3 hisS Histidine--tRNA ligase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
P62372 1.25e-16 86 21 9 398 3 hisS Histidine--tRNA ligase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
P46696 1.44e-16 85 24 10 394 3 hisS Histidine--tRNA ligase Mycobacterium leprae (strain TN)
Q1IZB5 1.48e-16 85 22 10 410 3 hisS Histidine--tRNA ligase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
C6BVJ9 1.49e-16 85 24 10 347 3 hisS Histidine--tRNA ligase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A5FX98 2.24e-16 85 28 3 238 3 hisS Histidine--tRNA ligase Acidiphilium cryptum (strain JF-5)
Q9Z7P1 2.52e-16 85 23 8 391 3 hisS Histidine--tRNA ligase Chlamydia pneumoniae
Q183H5 2.55e-16 85 20 8 398 3 hisS Histidine--tRNA ligase Clostridioides difficile (strain 630)
A7ZDK1 2.95e-16 84 26 6 251 3 hisS Histidine--tRNA ligase Campylobacter concisus (strain 13826)
A8ZUR6 3.15e-16 85 25 6 303 3 hisS Histidine--tRNA ligase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
P47281 4.85e-16 84 25 10 313 3 hisS Histidine--tRNA ligase Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
B0K0N4 4.9e-16 84 20 7 380 3 hisS Histidine--tRNA ligase Thermoanaerobacter sp. (strain X514)
Q9RUN5 6.82e-16 84 24 12 413 3 hisS Histidine--tRNA ligase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B1VDK9 8.77e-16 83 25 8 329 3 hisS Histidine--tRNA ligase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B0K977 1.03e-15 83 20 7 388 3 hisS Histidine--tRNA ligase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5L735 1.34e-15 83 23 8 400 3 hisS Histidine--tRNA ligase Chlamydia abortus (strain DSM 27085 / S26/3)
Q0SRP7 1.53e-15 82 23 6 282 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain SM101 / Type A)
Q8XJ27 1.53e-15 82 23 6 282 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain 13 / Type A)
Q0TP27 1.57e-15 82 23 6 282 3 hisS Histidine--tRNA ligase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
C0QFI0 1.76e-15 82 24 9 376 3 hisS Histidine--tRNA ligase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q4JVE8 1.87e-15 82 25 10 333 3 hisS Histidine--tRNA ligase Corynebacterium jeikeium (strain K411)
B5ZB96 1.94e-15 82 24 10 351 3 hisS Histidine--tRNA ligase Ureaplasma urealyticum serovar 10 (strain ATCC 33699 / Western)
Q827T0 2.37e-15 82 24 10 356 3 hisS Histidine--tRNA ligase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A4FBB7 2.53e-15 82 25 9 331 3 hisS Histidine--tRNA ligase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q30RH3 2.77e-15 82 25 6 298 3 hisS Histidine--tRNA ligase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q6F199 3.29e-15 82 21 14 446 3 hisS Histidine--tRNA ligase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
P75069 3.68e-15 81 22 9 405 1 hisS Histidine--tRNA ligase Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_10610
Feature type CDS
Gene hisS
Product Histidyl-tRNA synthetase
Location 66976 - 68877 (strand: 1)
Length 1902 (nucleotides) / 633 (amino acids)

Contig

Accession ZDB_525
Length 191527 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2801
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01797 Transposase IS200 like
PF13393 Histidyl-tRNA synthetase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0124 Translation, ribosomal structure and biogenesis (J) J Histidyl-tRNA synthetase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07491 REP-associated tyrosine transposase - -

Protein Sequence

MPRRERLYFPGLPQLIKLNGHNHEKLFQEENDYARFLTCVDRSLESYNCELHAYSLQADTVLLLLTPKSKEDLSRFIQHIGRQYVPYYNNKYQRTGALWDRRYNSCLIEANSYFLLVSQYVDTFTSDQSEYNDKHNLNYSSYGHNTGECTIPRMTEHQCYLQLGKTPEERGIHYQHFLYTTISQSVIERIQICLNQNCVLGTNQYCQKLEFEVNRTVRPHQSGRPRKHYSNDVADWIWLENRASKLLARYCYQEIRFPVLEYWDDHMKNAAAFADDNHNGPKLNCSHPALLRGEGTMGCLRVIAQHQRLQSKSKLWYIGAMFRNVAGQKQDFEQYHQIGVEAFGYDNIDIELEHILMQYDFFSSLHLTPYIELKINTAGSEEEFSRFRQALREYYQPFLPFFEEPWLVKLKEKPEQLLSTPHKLLDIVNKKAPRLSEFLSEASAARFRQLLESLNRLKIPYSVTPGLYPVNNYCHTLFEWRTTHPDSHDELLCRGGRYDASASHLLDKQVAVSGFAFMLDPIIFLIRKCHKQLLRQNATDVVLIPENTRAAGHALMVGRRLRILFPHFTIKNDCSGMRISTCRKNAERNGSRFIIVVPSEDDKALELTDKDNGMIQFVNENAMIGVLGHSVNC

Flanking regions ( +/- flanking 50bp)

TATTACTCATTAGATAAATTTATTATTTTTAGCGATTGGAGCGCTGACCTATGCCAAGAAGAGAGCGCCTTTATTTCCCGGGATTACCACAGCTGATTAAACTTAACGGGCACAATCATGAAAAACTCTTTCAGGAAGAGAATGATTACGCCCGCTTTCTGACCTGTGTGGACAGGTCTTTAGAATCATACAATTGCGAGCTTCATGCCTATTCACTTCAGGCAGATACGGTATTGTTGCTGCTGACACCAAAATCAAAAGAAGATTTAAGCCGCTTTATACAGCACATCGGACGCCAGTATGTTCCTTACTACAATAATAAATATCAGCGTACCGGGGCATTATGGGACCGGCGTTATAACAGCTGCCTTATTGAAGCAAACTCCTATTTTCTTTTGGTCTCTCAATATGTTGATACTTTCACATCCGACCAGTCGGAATATAATGACAAACATAACTTAAATTATTCCAGTTACGGTCATAACACCGGGGAATGCACTATTCCGAGAATGACTGAACATCAGTGTTATTTGCAATTAGGCAAAACACCGGAAGAGCGCGGGATCCATTATCAGCATTTTTTATATACCACTATCAGCCAGTCTGTTATTGAGCGTATTCAAATCTGTCTGAATCAGAATTGTGTGTTGGGCACCAATCAGTATTGCCAGAAACTGGAATTTGAAGTGAACCGGACAGTGCGCCCGCATCAGAGCGGACGGCCGCGCAAGCATTACAGTAATGATGTGGCGGACTGGATCTGGCTGGAAAACCGCGCCTCTAAGCTGCTGGCACGCTACTGCTATCAGGAGATCCGCTTTCCGGTACTGGAATACTGGGATGACCATATGAAGAATGCCGCGGCGTTTGCGGATGATAACCATAACGGCCCCAAACTCAACTGCAGCCATCCGGCACTGCTGCGCGGTGAGGGTACGATGGGCTGTCTGCGGGTGATCGCACAGCATCAGCGTTTACAGTCAAAAAGCAAATTATGGTATATCGGTGCGATGTTCCGGAATGTGGCCGGGCAGAAACAGGATTTTGAACAATATCACCAGATCGGTGTGGAAGCATTCGGCTACGATAATATTGATATCGAGCTGGAACATATTTTAATGCAGTATGATTTTTTCAGTTCATTACACCTTACGCCGTACATTGAATTAAAAATAAATACCGCCGGCAGCGAAGAAGAATTCAGCCGGTTTCGTCAGGCACTGAGAGAGTATTATCAGCCGTTTCTGCCATTCTTTGAGGAGCCGTGGCTGGTTAAACTGAAAGAGAAACCGGAGCAGTTATTATCCACACCGCACAAGCTGCTGGATATCGTTAATAAAAAAGCGCCCCGGCTCAGTGAGTTTCTCTCTGAGGCTTCCGCCGCCCGCTTCCGTCAGTTGCTCGAATCCCTCAACCGCCTGAAAATTCCGTACAGTGTGACGCCGGGACTGTATCCGGTGAATAATTACTGTCACACCCTGTTTGAATGGCGCACCACGCATCCTGACAGCCACGATGAGCTGTTATGCCGCGGCGGCCGTTATGATGCCAGTGCGTCGCATCTGCTGGATAAACAGGTGGCGGTCAGCGGTTTTGCGTTTATGCTCGACCCGATTATTTTCCTGATCCGCAAATGTCACAAGCAACTGCTGCGTCAGAATGCGACCGATGTGGTGCTGATCCCGGAAAACACCCGTGCCGCCGGGCATGCGCTGATGGTCGGCCGCCGTCTGCGGATACTGTTCCCGCATTTCACCATTAAAAATGACTGCTCGGGGATGCGGATCAGTACCTGCCGCAAGAATGCGGAGCGCAACGGCAGCCGTTTTATCATTGTGGTGCCGTCAGAGGATGACAAAGCGCTGGAGCTGACTGATAAAGACAACGGAATGATTCAGTTTGTGAATGAGAATGCCATGATCGGTGTGCTGGGACACAGCGTAAACTGCTGAGGGGAGAGGATCCGCAGATAATCAGCTTATCTGCGGATAACCTGTTACTG