Homologs in group_1881

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14065 FBDBKF_14065 100.0 Morganella morganii S1 menE o-succinylbenzoate--CoA ligase
EHELCC_08215 EHELCC_08215 100.0 Morganella morganii S2 menE o-succinylbenzoate--CoA ligase
LHKJJB_05725 LHKJJB_05725 100.0 Morganella morganii S3 menE o-succinylbenzoate--CoA ligase
HKOGLL_05190 HKOGLL_05190 100.0 Morganella morganii S5 menE o-succinylbenzoate--CoA ligase
F4V73_RS02870 F4V73_RS02870 76.2 Morganella psychrotolerans menE o-succinylbenzoate--CoA ligase
PMI_RS08545 PMI_RS08545 49.8 Proteus mirabilis HI4320 menE o-succinylbenzoate--CoA ligase

Distribution of the homologs in the orthogroup group_1881

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1881

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37418 6.14e-123 369 45 5 454 3 menE 2-succinylbenzoate--CoA ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P37353 1.15e-118 357 45 7 458 1 menE 2-succinylbenzoate--CoA ligase Escherichia coli (strain K12)
P44565 7.45e-94 294 39 8 454 3 menE 2-succinylbenzoate--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q632I5 1.82e-41 157 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ZK / E33L)
Q72YK9 1.59e-40 154 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q816I1 3.88e-40 153 29 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A7GU88 5.33e-40 153 30 13 452 3 menE 2-succinylbenzoate--CoA ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B9J2F2 7.21e-40 152 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain Q1)
A0RK73 1.78e-39 151 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis (strain Al Hakam)
B7JDD6 2.01e-39 151 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH820)
Q6HC29 2.26e-39 151 28 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q65FT5 2.28e-39 151 29 12 452 3 menE 2-succinylbenzoate--CoA ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B7HTW3 9.87e-39 149 27 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus cereus (strain AH187)
C3LB87 1.28e-38 149 27 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3PCK3 1.28e-38 149 27 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis (strain A0248)
Q81K97 1.29e-38 149 27 13 472 3 menE 2-succinylbenzoate--CoA ligase Bacillus anthracis
A9VM74 1.35e-38 149 28 12 468 3 menE 2-succinylbenzoate--CoA ligase Bacillus mycoides (strain KBAB4)
Q92AY8 3.42e-36 142 29 13 457 3 menE 2-succinylbenzoate--CoA ligase Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q71YZ5 4.61e-35 139 27 9 450 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serotype 4b (strain F2365)
P58730 5.25e-35 139 26 9 450 3 menE 2-succinylbenzoate--CoA ligase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5KVX9 1.77e-34 137 29 13 489 3 menE 2-succinylbenzoate--CoA ligase Geobacillus kaustophilus (strain HTA426)
C5D6U5 6.22e-34 136 28 14 478 3 menE 2-succinylbenzoate--CoA ligase Geobacillus sp. (strain WCH70)
Q838K1 3.45e-33 134 29 19 478 3 menE 2-succinylbenzoate--CoA ligase Enterococcus faecalis (strain ATCC 700802 / V583)
A8FGK6 1.35e-31 129 27 16 479 3 menE 2-succinylbenzoate--CoA ligase Bacillus pumilus (strain SAFR-032)
P23971 1.5e-30 126 26 13 465 1 menE 2-succinylbenzoate--CoA ligase Bacillus subtilis (strain 168)
A7Z809 1.69e-30 126 26 11 481 3 menE 2-succinylbenzoate--CoA ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q8ENZ7 2e-29 123 25 13 473 3 menE 2-succinylbenzoate--CoA ligase Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q5HNB2 4.21e-27 116 25 15 466 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CS21 2e-26 114 25 15 466 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5P603 1.22e-25 112 28 10 436 1 iaaB Indoleacetate--CoA ligase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
O07610 1.64e-23 106 25 14 501 2 lcfB Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
Q53634 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus
A8Z4L9 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300 / TCH1516)
A6QHX6 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Newman)
Q5HEY2 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain COL)
Q2G2V3 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FFU9 6.66e-23 104 26 14 379 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain USA300)
P63526 7.38e-23 104 26 14 386 1 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain N315)
P63525 7.38e-23 104 26 14 386 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5ITW2 7.38e-23 104 26 14 386 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH9)
A6U2Q7 7.38e-23 104 26 14 386 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain JH1)
A7X3P0 7.38e-23 104 26 14 386 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain Mu3 / ATCC 700698)
S5M744 1.54e-22 103 28 15 433 1 fcs Feruloyl-CoA synthase Streptomyces sp.
Q9EY88 1.54e-22 103 28 15 433 1 fcs Feruloyl-CoA synthase Amycolatopsis sp.
O68008 1.63e-22 105 27 17 464 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 3.31e-11 69 24 16 482 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 6.96e-10 65 23 19 490 3 bacC Bacitracin synthase 3 Bacillus licheniformis
O68008 4.92e-09 62 22 16 490 3 bacC Bacitracin synthase 3 Bacillus licheniformis
Q8NVZ4 1.77e-22 103 26 13 356 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MW2)
Q6G8D6 1.77e-22 103 26 13 356 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MSSA476)
Q2YTP0 2.27e-22 103 26 14 356 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9CHK3 2.39e-22 102 26 17 423 3 menE 2-succinylbenzoate--CoA ligase Lactococcus lactis subsp. lactis (strain IL1403)
Q6GFR0 8.47e-22 101 26 13 356 3 menE 2-succinylbenzoate--CoA ligase Staphylococcus aureus (strain MRSA252)
Q9S725 5.09e-21 99 26 18 458 1 4CL2 4-coumarate--CoA ligase 2 Arabidopsis thaliana
M4ISH0 7.9e-21 98 27 19 460 1 CCL1 4-coumarate--CoA ligase CCL1 Humulus lupulus
W3X8X8 7.5e-20 96 24 13 492 1 fnsA Naringenin synthase Pestalotiopsis fici (strain W106-1 / CGMCC3.15140)
M4IQQ7 1.44e-19 94 25 18 495 2 CCL9 Probable CoA ligase CCL9 Humulus lupulus
Q70LM7 2.22e-19 95 24 14 490 1 lgrA Linear gramicidin synthase subunit A Brevibacillus parabrevis
Q10S72 3.14e-19 94 24 16 475 2 4CLL4 4-coumarate--CoA ligase-like 4 Oryza sativa subsp. japonica
Q70LM6 3.17e-19 95 27 20 483 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 8.53e-16 84 23 11 469 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 3.53e-15 82 24 16 484 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q70LM6 3.35e-08 60 24 20 511 1 lgrB Linear gramicidin synthase subunit B Brevibacillus parabrevis
Q9M0X9 7.99e-19 92 25 21 516 1 4CLL7 4-coumarate--CoA ligase-like 7 Arabidopsis thaliana
M4IQR7 1.4e-18 92 23 17 502 2 CCL5 Probable CoA ligase CCL5 Humulus lupulus
P9WQ37 3.28e-18 90 22 12 457 1 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ36 3.28e-18 90 22 12 457 3 fadD13 Long-chain-fatty-acid--CoA ligase FadD13 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O80658 8.07e-18 89 27 16 359 2 AEE4 Probable acyl-activating enzyme 4 Arabidopsis thaliana
Q0S7V5 1.04e-17 89 26 17 447 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Rhodococcus jostii (strain RHA1)
P39846 2.66e-17 89 25 18 474 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
P39846 6.33e-10 65 23 20 491 1 ppsB Plipastatin synthase subunit B Bacillus subtilis (strain 168)
M4IRL6 3.75e-17 87 24 22 505 2 CCL7 Probable CoA ligase CCL7 Humulus lupulus
Q84P21 7.25e-17 86 23 16 498 1 4CLL5 Peroxisomal OPC-8:0-CoA ligase 1 Arabidopsis thaliana
Q67W82 7.34e-17 86 26 16 439 1 4CL4 4-coumarate--CoA ligase 4 Oryza sativa subsp. japonica
Q0K844 1.12e-16 85 28 17 468 2 sauT Sulfoacetate--CoA ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A0A6B9HER0 2.12e-16 85 24 19 500 1 None Piperic acid--CoA ligase Piper nigrum
P9WER8 2.76e-16 85 25 17 493 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.04e-15 84 25 18 491 1 malA Malpinin synthetase Mortierella alpina
P9WER8 3.18e-12 73 23 18 491 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.51e-10 67 23 18 496 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.66e-10 67 23 16 492 1 malA Malpinin synthetase Mortierella alpina
P9WER8 2.18e-10 67 25 22 488 1 malA Malpinin synthetase Mortierella alpina
P9WER8 1.62e-09 64 22 17 487 1 malA Malpinin synthetase Mortierella alpina
A4YDR9 3.12e-16 84 23 13 449 1 Msed_0394 4-hydroxybutyrate--CoA ligase 2 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
Q9LPK6 4.63e-16 84 26 13 361 2 AEE9 Probable acyl-activating enzyme 9 Arabidopsis thaliana
A0A2H5AIX5 5.12e-16 84 23 16 484 2 4CL1 4-coumarate-CoA ligase 1 Narcissus pseudonarcissus
Q6ETN3 5.95e-16 84 25 19 454 1 4CL3 4-coumarate--CoA ligase 3 Oryza sativa subsp. japonica
I3PB37 7.15e-16 83 25 18 448 1 4CL1 4-coumarate:CoA ligase 1 Petunia hybrida
O30408 1.06e-15 84 23 18 482 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 6.65e-15 81 24 17 469 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
O30408 3.65e-10 66 22 22 491 1 tycB Tyrocidine synthase 2 Brevibacillus parabrevis
M4ISH2 1.4e-15 82 27 12 330 2 CCL11 Probable CoA ligase CCL11 Humulus lupulus
Q9SMT7 1.78e-15 82 25 19 495 1 AAE3 Oxalate--CoA ligase Arabidopsis thaliana
I3PB36 2.54e-15 82 25 15 374 1 CNL Trans-cinnamate:CoA ligase, peroxisomal Petunia hybrida
Q70LM5 2.79e-15 82 23 18 492 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 9.9e-15 80 25 18 467 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.58e-14 80 25 21 491 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 6.26e-14 78 23 16 471 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 1.98e-10 67 24 16 433 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q70LM5 2.62e-07 57 25 24 494 3 lgrC Linear gramicidin synthase subunit C Brevibacillus parabrevis
Q4WMJ7 3.46e-15 82 29 7 287 1 gliP Nonribosomal peptide synthetase gliP Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P86832 4.16e-15 81 25 20 497 1 fcbA2 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P86831 4.16e-15 81 25 20 497 1 fcbA1 4-chlorobenzoate--CoA ligase Arthrobacter sp.
P0DX14 4.21e-15 80 26 19 451 1 scoC Fatty acid--[acyl-carrier-protein] ligase ScoC Streptomyces coeruleorubidus
M4IS88 6.74e-15 80 25 13 350 1 CCL3 Acetate--CoA ligase CCL3 Humulus lupulus
Q04747 6.83e-15 81 25 18 476 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q04747 3.69e-14 79 23 19 473 1 srfAB Surfactin synthase subunit 2 Bacillus subtilis (strain 168)
Q7TYX8 7.51e-15 80 31 4 175 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O30409 8.54e-15 81 24 16 478 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 3.79e-12 72 22 20 521 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 1.13e-10 68 24 21 507 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 2.42e-10 67 23 17 495 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 7.18e-07 55 24 10 288 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
O30409 8.24e-07 55 23 22 491 1 tycC Tyrocidine synthase 3 Brevibacillus parabrevis
P9WQ55 9.44e-15 80 25 15 455 1 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ54 9.44e-15 80 25 15 455 3 fadD10 Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase FadD10 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P94547 9.74e-15 80 24 23 535 3 lcfA Long-chain-fatty-acid--CoA ligase Bacillus subtilis (strain 168)
M4IQS1 1.16e-14 79 22 20 523 2 CCL10 Probable CoA ligase CCL10 Humulus lupulus
O24145 1.2e-14 79 24 15 440 2 4CL1 4-coumarate--CoA ligase 1 Nicotiana tabacum
P9WQ39 1.34e-14 78 28 8 274 1 menE Probable 2-succinylbenzoate--CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ38 1.34e-14 78 28 8 274 3 menE Probable 2-succinylbenzoate--CoA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O31782 1.51e-14 80 23 16 492 1 pksN Polyketide synthase PksN Bacillus subtilis (strain 168)
P41636 2.17e-14 79 23 14 450 2 4CL 4-coumarate--CoA ligase Pinus taeda
Q42524 2.31e-14 79 25 19 464 1 4CL1 4-coumarate--CoA ligase 1 Arabidopsis thaliana
P40871 3.39e-14 78 25 20 489 1 dhbE 2,3-dihydroxybenzoate-AMP ligase Bacillus subtilis (strain 168)
A0A0H2ZF83 3.54e-14 78 25 14 439 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain UCBPP-PA14)
B2HKM1 5.44e-14 77 25 16 451 1 mmaC Fatty acid--[acyl-carrier-protein] ligase MmaC Mycobacterium marinum (strain ATCC BAA-535 / M)
P31687 5.49e-14 77 26 17 458 2 None 4-coumarate--CoA ligase 2 Glycine max
O53521 6.49e-14 77 30 4 175 1 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9SS01 6.64e-14 77 24 11 370 1 AAE20 Benzoate--CoA ligase, peroxisomal Arabidopsis thaliana
M4IS90 7.97e-14 77 26 13 330 2 CCL8 Probable CoA ligase CCL8 Humulus lupulus
Q9S777 8.92e-14 77 24 16 451 1 4CL3 4-coumarate--CoA ligase 3 Arabidopsis thaliana
Q9LU36 9.31e-14 77 24 19 475 1 4CL4 4-coumarate--CoA ligase 4 Arabidopsis thaliana
Q9HWG3 1.07e-13 76 24 14 443 1 pchD Pyochelin synthase PchD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9LPK7 1.15e-13 76 25 14 363 2 AEE10 Probable acyl-activating enzyme 10 Arabidopsis thaliana
B2HGV4 1.32e-13 76 32 6 185 3 fadD15 Long-chain-fatty-acid--CoA ligase FadD15 Mycobacterium marinum (strain ATCC BAA-535 / M)
Q9C8D4 1.43e-13 76 24 11 366 1 AAE11 Butyrate--CoA ligase AAE11, peroxisomal Arabidopsis thaliana
Q4WD47 1.69e-13 77 23 12 424 2 fsqF Nonribosomal peptide synthetase-like enzyme fsqF Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
M4IQQ5 1.72e-13 76 26 14 332 1 CCL4 2-methylpropanoate--CoA ligase CCL4 Humulus lupulus
P17814 2.01e-13 75 26 15 419 1 4CL1 4-coumarate--CoA ligase 1 Oryza sativa subsp. japonica
O24146 2.52e-13 75 25 17 455 1 4CL2 4-coumarate--CoA ligase 2 Nicotiana tabacum
Q9SS00 2.68e-13 75 24 10 367 2 AAE12 Probable acyl-activating enzyme 12, peroxisomal Arabidopsis thaliana
P38135 3.53e-13 75 23 14 448 1 fadK Medium-chain fatty-acid--CoA ligase Escherichia coli (strain K12)
Q9I4X3 3.83e-13 75 24 16 474 1 pqsA Anthranilate--CoA ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q42982 4.08e-13 75 26 19 514 1 4CL2 4-coumarate--CoA ligase 2 Oryza sativa subsp. japonica
Q65DH1 4.75e-13 74 22 14 489 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
D4AU31 5.13e-13 75 23 14 455 3 swnK PKS-NRPS hybrid synthetase swnK Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q08787 5.28e-13 75 24 21 488 1 srfAC Surfactin synthase subunit 3 Bacillus subtilis (strain 168)
P0DUV3 6.01e-13 75 23 19 503 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.03e-10 68 24 20 486 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.2e-07 58 25 6 208 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 4.23e-06 53 28 4 171 1 mpcA Malpicyclin synthetase Mortierella alpina
P0DUV3 1.3e-05 52 22 21 505 1 mpcA Malpicyclin synthetase Mortierella alpina
Q9LQS1 9.24e-13 73 24 11 353 2 AAE8 Probable acyl-activating enzyme 8 Arabidopsis thaliana
P14912 1.03e-12 73 23 16 483 2 4CL1 4-coumarate--CoA ligase 1 Petroselinum crispum
P94459 1.32e-12 74 24 16 410 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 1.53e-12 73 23 17 429 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P94459 2.17e-07 57 23 14 470 1 ppsD Plipastatin synthase subunit D Bacillus subtilis (strain 168)
P14913 2.1e-12 72 23 16 480 2 4CL2 4-coumarate--CoA ligase 2 Petroselinum crispum
Q70LM4 2.53e-12 73 24 15 419 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 1.29e-11 71 23 17 498 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 2.04e-07 57 23 17 468 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q70LM4 1.09e-05 52 32 6 162 1 lgrD Linear gramicidin synthase subunit D Brevibacillus parabrevis
Q52400 2.69e-12 72 23 15 488 1 syrB1 Syringomycin synthase SyrB1 Pseudomonas syringae pv. syringae
Q7WSH3 2.98e-12 72 26 15 359 3 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Comamonas testosteroni
O06417 3.22e-12 72 28 10 274 1 fadD8 Medium/long-chain-fatty-acid--CoA ligase FadD8 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A017SQ41 3.39e-12 72 25 15 366 3 echPS Nonribosomal peptide synthetase echPS Aspergillus ruber (strain CBS 135680)
Q0S4D9 3.83e-12 72 26 17 436 1 casG Steroid-24-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
Q8H151 5.13e-12 71 25 10 313 1 AAE13 Malonate--CoA ligase Arabidopsis thaliana
Q09164 8.51e-12 71 23 17 434 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 6.62e-11 68 22 14 430 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 8.59e-11 68 24 20 473 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 4.46e-10 66 24 17 433 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 1.39e-09 64 25 19 439 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 2.24e-06 54 24 16 431 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 4.15e-06 53 22 17 491 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 6.01e-06 52 22 17 440 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
Q09164 5.68e-05 49 23 20 445 1 simA Cyclosporin synthetase simA Tolypocladium inflatum
P0DUV4 8.92e-12 71 24 20 505 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 7.88e-10 65 24 17 493 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 9.45e-10 65 24 18 506 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 1.79e-09 64 23 17 505 1 mpbA Malpibaldin synthetase Mortierella alpina
P0DUV4 2.17e-09 63 25 20 496 1 mpbA Malpibaldin synthetase Mortierella alpina
Q9FFE9 9.99e-12 70 25 13 357 2 AAE6 Probable acyl-activating enzyme 6 Arabidopsis thaliana
Q4WVN4 1.03e-11 71 24 15 416 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 1.17e-05 52 23 11 316 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 7.21e-05 49 24 10 300 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 0.00013 48 23 17 420 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WVN4 0.000239 47 26 12 262 3 NRPS8 Nonribosomal peptide synthetase 8 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
P31685 1.04e-11 70 24 15 460 3 4CL2 4-coumarate--CoA ligase 2 Solanum tuberosum
Q9FFE6 1.07e-11 70 25 13 357 1 AAE5 Probable acyl-activating enzyme 5, peroxisomal Arabidopsis thaliana
P80436 1.07e-11 70 25 14 437 1 trsA Triostin synthetase I Streptomyces triostinicus
C0LTL9 1.13e-11 70 26 15 396 1 sibE 3-hydroxy-4-methylanthranilate adenylyltransferase Streptosporangium sibiricum
O68007 1.17e-11 71 24 20 474 3 bacB Bacitracin synthase 2 Bacillus licheniformis
O68007 3.2e-08 60 22 18 473 3 bacB Bacitracin synthase 2 Bacillus licheniformis
Q00594 1.18e-11 70 25 12 310 1 alkK Medium-chain-fatty-acid--CoA ligase Pseudomonas oleovorans
A0A098D1P1 1.33e-11 71 25 8 293 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 2.68e-09 63 29 2 162 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 4.1e-09 63 25 11 294 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 1.58e-08 61 22 21 498 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A0A098D1P1 9.19e-06 52 26 10 284 2 GRA1 Nonribosomal peptide synthetase GRA1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6ZAC1 1.34e-11 70 25 17 447 1 4CL5 4-coumarate--CoA ligase 5 Oryza sativa subsp. japonica
A0A319A6V2 2.33e-11 70 28 16 309 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
A0A319A6V2 2.01e-05 51 23 11 313 1 mlfA Malformin synthetase mlfA Aspergillus lacticoffeatus (strain CBS 101883)
O24540 2.34e-11 69 24 17 467 2 4CL 4-coumarate--CoA ligase Vanilla planifolia
A2QYX4 2.68e-11 70 28 16 309 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2QYX4 2.27e-05 51 23 11 313 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P31684 2.69e-11 69 24 15 460 3 4CL1 4-coumarate--CoA ligase 1 Solanum tuberosum
P96843 2.74e-11 69 25 13 436 1 fadD3 3-[(3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl]propanoyl:CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
G3XUF0 2.75e-11 70 28 16 309 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
G3XUF0 2.17e-05 51 23 11 313 1 mlfA Malformin synthetase mlfA Aspergillus niger (strain ATCC 1015 / CBS 113.46 / FGSC A1144 / LSHB Ac4 / NCTC 3858a / NRRL 328 / USDA 3528.7)
P09095 2.78e-11 69 22 15 482 1 tycA Tyrocidine synthase 1 Brevibacillus parabrevis
Q8VZF1 3.47e-11 68 25 15 356 1 AAE7 Acetate/butyrate--CoA ligase AAE7, peroxisomal Arabidopsis thaliana
P08659 3.65e-11 68 25 22 445 1 None Luciferin 4-monooxygenase Photinus pyralis
P0C063 3.74e-11 69 24 20 483 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 6.97e-06 52 21 15 467 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
P0C063 3.53e-05 50 22 3 158 1 grsB Gramicidin S synthase 2 Aneurinibacillus migulanus
O31827 3.77e-11 69 24 18 434 1 ppsE Plipastatin synthase subunit E Bacillus subtilis (strain 168)
P0C064 4.04e-11 69 24 20 483 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 1.5e-06 54 22 15 467 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
P0C064 3.53e-05 50 22 3 158 1 grsB Gramicidin S synthase 2 Brevibacillus brevis
A0A2I2F2N6 4.59e-11 69 24 10 337 1 cfoA Chalcone synthase cfoA Aspergillus candidus
A1DA59 4.79e-11 69 23 8 297 3 ftmPS Nonribosomal peptide synthetase ftmPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
B2KWI3 4.9e-11 68 23 15 447 2 SID4 Acyl-CoA ligase SID4 Ajellomyces capsulatus
D9XF47 5.25e-11 68 27 20 439 1 phsC Phosphinothricin tripeptide synthase PhsC Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
Q9R9I9 5.92e-11 68 23 21 499 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q9R9I9 3.97e-07 56 28 2 151 3 mycC Mycosubtilin synthase subunit C Bacillus subtilis
Q5SKN9 7.29e-11 67 24 17 486 1 TTHA0604 Long-chain-fatty-acid--CoA ligase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A0A348AXX4 7.59e-11 68 23 18 483 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.26e-08 60 22 18 454 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 4.26e-08 59 22 19 505 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.53e-07 58 23 17 437 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 1.53e-07 58 23 17 437 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 2.37e-07 57 22 18 467 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 3.29e-06 53 22 19 477 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 6.82e-06 52 22 14 418 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
A0A348AXX4 7.78e-05 49 23 19 505 1 kk1B Nonribosomal peptide synthetase kk1B Curvularia clavata
P13129 8.05e-11 67 27 14 305 1 None Luciferin 4-monooxygenase Nipponoluciola cruciata
A7GMR0 8.15e-11 67 21 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
G3J456 8.27e-11 68 27 14 340 1 cm3A Nonribosomal peptide synthetase cm3A Cordyceps militaris (strain CM01)
Q84P25 8.7e-11 67 22 14 435 2 4CLL2 4-coumarate--CoA ligase-like 2 Arabidopsis thaliana
M4IRL4 9.44e-11 67 22 10 332 1 CCL2 Isovalerate--CoA ligase CCL2 Humulus lupulus
O31826 9.7e-11 67 25 11 283 3 yngI Putative acyl-CoA synthetase YngI Bacillus subtilis (strain 168)
Q26304 1.38e-10 67 29 14 304 1 None Luciferin 4-monooxygenase Luciola mingrelica
A0A1L9NGU5 1.4e-10 67 28 16 306 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 2.47e-07 57 24 11 313 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
A0A1L9NGU5 0.000738 46 23 18 425 1 mlfA Malformin synthetase mlfA Aspergillus tubingensis (strain CBS 134.48)
P45745 1.8e-10 67 24 21 489 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
P45745 2.01e-10 67 23 17 490 1 dhbF Dimodular nonribosomal peptide synthase Bacillus subtilis (strain 168)
A0A319BQC1 1.86e-10 67 27 15 304 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 4.97e-08 59 25 11 313 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
A0A319BQC1 0.00033 47 24 19 433 1 mlfA Malformin synthetase mlfA Aspergillus vadensis (strain CBS 113365 / IMI 142717 / IBT 24658)
Q7A1Q0 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain MW2)
Q6GBR2 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain MSSA476)
Q7A769 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain N315)
Q99W34 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HIA1 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain COL)
Q9KWK5 2e-10 66 22 13 415 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain Mu3 / ATCC 700698)
G7XQ31 2.05e-10 67 28 16 306 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 4.03e-07 56 25 9 280 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
G7XQ31 7.36e-05 49 24 19 433 1 mlfA Malformin synthetase mlfA Aspergillus kawachii (strain NBRC 4308)
P96575 2.54e-10 66 23 16 479 3 ydaB Putative acyl--CoA ligase YdaB Bacillus subtilis (strain 168)
Q0P4F7 2.68e-10 66 26 10 296 2 acsf2 Medium-chain acyl-CoA ligase ACSF2, mitochondrial Danio rerio
Q6GJ94 2.73e-10 65 23 13 411 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus aureus (strain MRSA252)
M4IS92 2.81e-10 66 22 10 332 2 CCL13 Probable CoA ligase CCL13 Humulus lupulus
F4HUK6 3.16e-10 65 21 8 324 1 AAE1 Butanoate--CoA ligase AAE1 Arabidopsis thaliana
Q4WF61 3.31e-10 66 26 8 308 2 NRPS3 Nonribosomal peptide synthase sidE Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q8Z406 3.85e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella typhi
Q8ZMA4 3.92e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TGR5 4.03e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella heidelberg (strain SL476)
B5RDY6 4.03e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QWU2 4.03e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella enteritidis PT4 (strain P125109)
B5F4V4 4.1e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella agona (strain SL483)
Q84HC5 4.35e-10 65 24 16 459 1 ncsB2 2-hydroxy-7-methoxy-5-methyl-1-naphthoate--CoA ligase Streptomyces carzinostaticus
A9N3H8 4.35e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TUM9 4.39e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella schwarzengrund (strain CVM19633)
B5FUB9 4.39e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella dublin (strain CT_02021853)
B4T503 4.43e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella newport (strain SL254)
B5BFH6 4.51e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain AKU_12601)
Q5PEN7 4.51e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q84P26 4.61e-10 65 23 18 472 2 4CLL8 4-coumarate--CoA ligase-like 8 Arabidopsis thaliana
Q4L4U5 5.06e-10 65 22 19 461 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus haemolyticus (strain JCSC1435)
C0PXJ8 5.42e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella paratyphi C (strain RKS4594)
Q57KA7 5.42e-10 65 27 13 316 3 aas Bifunctional protein Aas Salmonella choleraesuis (strain SC-B67)
A8AP56 5.51e-10 65 28 11 271 3 aas Bifunctional protein Aas Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
E9F8M3 7.12e-10 65 23 13 415 1 swnK PKS-NRPS hybrid synthetase swnK Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q54P77 7.24e-10 64 23 14 355 3 4cl1 Probable 4-coumarate--CoA ligase 1 Dictyostelium discoideum
P40806 8.55e-10 65 22 19 501 1 pksJ Polyketide synthase PksJ Bacillus subtilis (strain 168)
B1LR34 8.84e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain SMS-3-5 / SECEC)
Q8FEA6 8.92e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7UHQ4 8.92e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7N768 9e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P31119 9.57e-10 64 28 11 271 1 aas Bifunctional protein Aas Escherichia coli (strain K12)
B1XDP2 9.57e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / DH10B)
C4ZZY9 9.57e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain K12 / MC4100 / BW2952)
B2TYQ5 9.65e-10 64 28 11 271 3 aas Bifunctional protein Aas Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
O68006 9.85e-10 65 24 21 499 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 4.69e-08 59 27 3 161 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 9.5e-08 58 24 22 536 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 1.49e-06 54 22 16 420 3 bacA Bacitracin synthase 1 Bacillus licheniformis
O68006 3.49e-05 50 25 3 155 3 bacA Bacitracin synthase 1 Bacillus licheniformis
B1IU08 9.99e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A3X0 9.99e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O9:H4 (strain HS)
A7ZQU2 9.99e-10 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O139:H28 (strain E24377A / ETEC)
B5Z4F4 1.03e-09 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6J8 1.03e-09 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O157:H7
Q3YY21 1.04e-09 64 28 11 271 3 aas Bifunctional protein Aas Shigella sonnei (strain Ss046)
B6I6W1 1.04e-09 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain SE11)
B7LF13 1.04e-09 64 28 11 271 3 aas Bifunctional protein Aas Escherichia coli (strain 55989 / EAEC)
Q0VZ70 1.06e-09 65 24 15 454 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
Q0VZ70 8.87e-07 55 26 16 434 1 cmdD Chondramide synthase cmdD Chondromyces crocatus
D1FVF0 1.06e-09 65 23 18 455 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
P27206 1.11e-09 64 23 17 495 1 srfAA Surfactin synthase subunit 1 Bacillus subtilis (strain 168)
P38137 1.17e-09 63 23 17 345 1 PCS60 Oxalate--CoA ligase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0A395I3F8 1.23e-09 64 28 17 306 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
A0A395I3F8 6.37e-09 62 25 11 313 1 BO97DRAFT_465346 Malformin synthetase mlfA Aspergillus homomorphus (strain CBS 101889)
Q83MG9 1.35e-09 63 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella flexneri
O07899 1.38e-09 63 24 17 450 3 vibE Vibriobactin-specific 2,3-dihydroxybenzoate-AMP ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B7NVY2 1.42e-09 63 28 11 271 3 aas Bifunctional protein Aas Escherichia coli O7:K1 (strain IAI39 / ExPEC)
O74976 1.75e-09 63 24 15 347 1 pcs60 Oxalate--CoA ligase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A9VKV6 1.97e-09 63 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus mycoides (strain KBAB4)
A0A2H5AIY4 2e-09 63 24 19 486 2 4CL2 4-coumarate-CoA ligase 2 Narcissus pseudonarcissus
Q54P78 2.04e-09 63 24 13 319 3 4cl2 Probable 4-coumarate--CoA ligase 2 Dictyostelium discoideum
Q8CQ67 2.69e-09 62 20 8 402 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q83JV7 2.87e-09 63 27 11 271 3 aas Bifunctional protein Aas Shigella flexneri
Q0T128 2.87e-09 63 27 11 271 3 aas Bifunctional protein Aas Shigella flexneri serotype 5b (strain 8401)
A0A317VEE1 2.9e-09 63 26 11 303 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
A0A317VEE1 2.37e-08 60 27 15 314 1 mlfA Malformin synthetase mlfA Aspergillus eucalypticola (strain CBS 122712 / IBT 29274)
P39581 3.1e-09 62 22 17 491 1 dltA D-alanine--D-alanyl carrier protein ligase Bacillus subtilis (strain 168)
P0DX16 3.28e-09 63 26 16 425 1 scoA Isonitrile lipopeptide synthase Streptomyces coeruleorubidus
A0A0A2J5U8 3.46e-09 62 24 15 350 3 cnsG Acyl-CoA ligase cnsG Penicillium expansum
B7LNJ2 3.54e-09 62 27 11 271 3 aas Bifunctional protein Aas Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
J5JV76 3.68e-09 63 23 17 455 1 BSLS Bassianolide nonribosomal cyclodepsipeptide synthetase Beauveria bassiana (strain ARSEF 2860)
A4WE11 4.53e-09 62 27 12 281 3 aas Bifunctional protein Aas Enterobacter sp. (strain 638)
Q0DV32 4.83e-09 62 23 18 481 2 4CLL1 4-coumarate--CoA ligase-like 1 Oryza sativa subsp. japonica
A0A1L9U7P9 5.04e-09 62 23 15 422 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 8.13e-08 58 27 13 295 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A0A1L9U7P9 0.000271 47 23 14 403 1 mlfA Malformin synthetase mlfA Aspergillus brasiliensis (strain CBS 101740 / IMI 381727 / IBT 21946)
A7ZHC8 5.06e-09 62 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q69RG7 5.36e-09 62 25 13 400 2 4CLL7 4-coumarate--CoA ligase-like 7 Oryza sativa subsp. japonica
P9WQ61 5.98e-09 62 26 12 362 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ60 5.98e-09 62 26 12 362 3 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TXK7 5.98e-09 62 26 12 362 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q0TDZ6 6.53e-09 62 27 12 272 3 aas Bifunctional protein Aas Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8VYJ1 6.69e-09 61 24 10 312 1 AAE14 2-succinylbenzoate--CoA ligase, chloroplastic/peroxisomal Arabidopsis thaliana
Q1R7H5 6.7e-09 62 27 12 272 3 aas Bifunctional protein Aas Escherichia coli (strain UTI89 / UPEC)
A1AF47 6.7e-09 62 27 12 272 3 aas Bifunctional protein Aas Escherichia coli O1:K1 / APEC
B7MLI2 6.7e-09 62 27 12 272 3 aas Bifunctional protein Aas Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YYD1 7.38e-09 61 23 20 487 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XA34 7.38e-09 61 23 20 487 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O157:H7
Q81T97 7.75e-09 61 22 9 427 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis
C3LAH8 7.75e-09 61 22 9 427 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P4I7 7.75e-09 61 22 9 427 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus anthracis (strain A0248)
B6HYY8 7.99e-09 61 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain SE11)
Q9AJS8 8.35e-09 61 24 11 433 1 hcl 3-hydroxybenzoate--CoA/4-hydroxybenzoate--CoA ligase Thauera aromatica
B7L4G0 8.57e-09 61 23 20 487 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain 55989 / EAEC)
B7NHE1 8.65e-09 61 23 20 487 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q01886 8.86e-09 62 24 8 269 1 HTS1 HC-toxin synthetase Cochliobolus carbonum
Q0T8F7 8.94e-09 61 23 17 442 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella flexneri serotype 5b (strain 8401)
I1S2J4 9.12e-09 61 28 11 292 1 NRPS9 Nonribosomal peptide synthetase 9 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
P0DX84 9.16e-09 61 23 11 349 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria lacuscaerulensis (strain DSM 11314 / KCTC 2953 / ITI-1157)
Q4WYG2 1.06e-08 61 23 17 484 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WYG2 0.000599 46 21 16 387 3 NRPS5 Nonribosomal peptide synthetase 5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
D9XF49 1.06e-08 61 26 20 479 1 phsB Phosphinothricin tripeptide synthase PhsB Streptomyces viridochromogenes (strain DSM 40736 / JCM 4977 / BCRC 1201 / Tue 494)
B1LFX0 1.06e-08 60 23 20 487 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli (strain SMS-3-5 / SECEC)
A7ZVY7 1.18e-08 60 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O9:H4 (strain HS)
B7M0D4 1.21e-08 60 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Escherichia coli O8 (strain IAI1)
Q63E02 1.29e-08 60 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ZK / E33L)
Q8W471 1.33e-08 60 25 6 177 1 AAE15 Long-chain-fatty-acid--[acyl-carrier-protein] ligase AEE15, chloroplastic Arabidopsis thaliana
A0A1M3T4K3 1.45e-08 61 28 15 292 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 4.14e-07 56 25 9 280 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
A0A1M3T4K3 1.93e-05 51 24 19 433 1 mlfA Malformin synthetase mlfA Aspergillus luchuensis (strain CBS 106.47)
C9K7C1 1.46e-08 60 24 11 327 2 AMT10 Nonribosomal peptide synthetase AMT10 Alternaria alternata
Q73BD2 1.57e-08 60 21 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q6HLH7 1.73e-08 60 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EM80 1.73e-08 60 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain 03BB102)
B7JFV5 1.73e-08 60 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain AH820)
A0RBJ0 1.73e-08 60 22 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus thuringiensis (strain Al Hakam)
A0A318Z3U0 1.75e-08 61 27 16 305 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
A0A318Z3U0 1.26e-07 58 25 9 295 1 mlfA Malformin synthetase mlfA Aspergillus neoniger (strain CBS 115656)
C8V7P4 1.81e-08 60 27 12 302 1 ivoA Nonribosomal peptide synthetase ivoA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P31686 2.07e-08 58 27 6 236 2 None 4-coumarate--CoA ligase 1 (Fragment) Glycine max
A6TDH2 2.14e-08 60 26 10 271 3 aas Bifunctional protein Aas Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B9IUW2 2.15e-08 60 21 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain Q1)
Q4WZ44 2.59e-08 60 23 17 469 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q4WZ44 0.00021 47 22 16 413 3 NRPS7 Nonribosomal peptide synthetase 7 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5HRH4 2.6e-08 59 20 7 403 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O53551 2.62e-08 59 28 11 278 1 fadD17 Medium/long-chain-fatty-acid--CoA ligase FadD17 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q7TWC5 2.62e-08 59 28 11 278 3 fadD17 Medium/long-chain-fatty-acid--CoA ligase FadD17 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A0A0C1E5J8 2.63e-08 60 23 13 427 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
A0A0C1E5J8 2.6e-06 53 23 14 422 1 opaA Nonribosomal peptide synthetase opaA Aspergillus ustus
Q3Z5X2 2.64e-08 59 23 20 484 3 caiC Crotonobetaine/carnitine--CoA ligase Shigella sonnei (strain Ss046)
Q4WAW3 2.67e-08 60 22 5 293 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B9WZX0 2.69e-08 60 22 5 293 1 NRPS13 Nonribosomal peptide synthetase 13 Aspergillus fumigatus
Q81G39 3e-08 59 21 10 428 1 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7HHC6 3e-08 59 21 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain B4264)
I1SAJ7 3.34e-08 60 24 12 311 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 6.83e-08 59 26 9 290 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 8.57e-06 52 26 13 318 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.000215 47 22 5 251 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1SAJ7 0.000771 46 23 10 312 1 NRPS5 Nonribosomal peptide synthetase 5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A7MR36 3.45e-08 59 27 11 270 3 aas Bifunctional protein Aas Cronobacter sakazakii (strain ATCC BAA-894)
Q2UB01 3.86e-08 59 23 15 456 1 ppsA Acyl-CoA ligase ppsA Aspergillus oryzae (strain ATCC 42149 / RIB 40)
B7HK95 4.82e-08 58 22 12 431 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain AH187)
A0A7L8UVC9 4.83e-08 59 24 19 404 3 ffsA Polyketide synthase-nonribosomal peptide synthetase ffsA Aspergillus flavipes
Q2YWQ8 6.14e-08 58 21 16 459 3 dltA D-alanine--D-alanyl carrier protein ligase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A1DN09 6.32e-08 59 22 14 432 1 anaPS Nonribosomal peptide synthetase anaPS Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4WT66 6.44e-08 59 26 10 286 1 NRPS1 Nonribosomal peptide synthetase 1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A319DV72 6.5e-08 59 22 15 419 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 1.58e-06 54 23 13 410 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
A0A319DV72 0.000861 45 25 11 278 1 mlfA Malformin synthetase mlfA Aspergillus sclerotiicarbonarius (strain CBS 121057 / IBT 28362)
Q54P79 6.62e-08 58 23 13 353 3 4cl3 Probable 4-coumarate--CoA ligase 3 Dictyostelium discoideum
Q5LRT0 7.31e-08 58 23 11 349 1 dmdB 3-methylmercaptopropionyl-CoA ligase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9L9G0 7.47e-08 58 25 19 498 1 novH Novobiocin biosynthesis protein H Streptomyces niveus
B7IN64 7.54e-08 58 21 10 428 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus cereus (strain G9842)
Q9LK39 7.63e-08 58 25 5 177 2 AAE16 Probable acyl-activating enzyme 16, chloroplastic Arabidopsis thaliana
B2VFS7 7.82e-08 58 27 11 275 3 aas Bifunctional protein Aas Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5XUP2 8.24e-08 58 26 10 271 3 aas Bifunctional protein Aas Klebsiella pneumoniae (strain 342)
B6HJU6 8.85e-08 58 25 13 364 1 roqA Nonribosomal peptide synthase roqA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
Q336M7 8.91e-08 58 25 11 304 3 4CLL2 4-coumarate--CoA ligase-like 2 Oryza sativa subsp. japonica
C8VPS9 9.69e-08 58 26 11 301 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 3.35e-06 53 22 8 306 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C8VPS9 8.26e-06 52 23 17 439 3 easA Nonribosomal peptide synthetase easA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q7X279 1.07e-07 57 24 15 435 1 sdgA Salicylyl-CoA synthase / salicylate adenylyltransferase Streptomyces sp.
Q7BQ71 1.08e-07 57 20 14 509 1 zmaJ Zwittermicin A synthase ZmaJ Bacillus cereus
F8J3D9 1.11e-07 58 26 13 322 1 tmlU Marinolic acid--CoA ligase Pseudoalteromonas sp. (strain SANK 73390)
Q4L3Q0 1.14e-07 57 23 9 301 3 vraA Putative long chain fatty acid-CoA ligase VraA Staphylococcus haemolyticus (strain JCSC1435)
P9WEU9 1.24e-07 58 25 8 287 3 benZ Nonribisomal peptide synthetase benZ Aspergillus terreus
B0CN26 1.38e-07 57 27 20 485 1 sfmB Nonribosomal peptide synthase SfmB Streptomyces lavendulae
B8NY88 1.41e-07 58 23 20 444 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 0.000112 48 23 20 490 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
B8NY88 0.000367 47 26 16 299 1 agiA Nonribosomal peptide synthase agiA Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
Q2T4N2 1.45e-07 58 25 17 489 3 thaH Polyketide synthase ThaH Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
M1WCQ3 1.46e-07 58 24 15 390 2 tcpP Nonribosomal peptide synthetase tcpP Claviceps purpurea (strain 20.1)
Q9C9G2 1.75e-07 57 23 7 238 3 AEE22 Probable acyl-activating enzyme 22 Arabidopsis thaliana
A0A2V5H0B0 1.9e-07 57 23 16 434 3 ungA Nonribosomal peptide synthetase ungA Aspergillus violaceofuscus (strain CBS 115571)
Q53005 2.05e-07 57 25 16 427 1 hbaA 4-hydroxybenzoate--CoA/benzoate--CoA ligase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A0A2I2F262 2.8e-07 57 23 17 480 1 acdB PKS-NRPS hybrid synthetase acdB Aspergillus candidus
Q9SFW5 2.86e-07 56 24 11 299 3 AEE21 Probable acyl-activating enzyme 21 Arabidopsis thaliana
Q4WR83 3.12e-07 56 25 12 302 2 sidI Acyl-CoA ligase sidI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
I1RN14 3.3e-07 57 23 20 481 2 NPS2 Nonribosomal peptide synthetase 2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q1BBA2 3.31e-07 56 24 16 453 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycobacterium sp. (strain MCS)
A0A144KPJ6 4e-07 56 23 15 404 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 1.48e-06 54 21 18 487 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 2.48e-06 54 26 7 211 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
A0A144KPJ6 0.000316 47 23 21 446 3 TES Nonribosomal peptide synthetase TES Alternaria alternata
Q9R9J0 4.64e-07 56 25 4 177 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 1.7e-06 54 21 21 497 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9R9J0 4.77e-06 53 22 2 181 3 mycB Mycosubtilin synthase subunit B Bacillus subtilis
Q9SEY5 4.76e-07 55 21 11 325 1 AAE2 Isovalerate--CoA ligase AAE2 Arabidopsis thaliana
L0E2Z1 4.84e-07 56 24 8 289 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
L0E2Z1 2.83e-05 50 26 12 295 1 malG Nonribisomal peptide synthase malG Malbranchea aurantiaca
I1RF49 4.9e-07 56 23 16 432 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 4.16e-05 50 22 13 445 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1RF49 0.000274 47 25 6 255 1 NRPS4 Nonribosomal peptide synthetase 4 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
I1S3K7 6.17e-07 55 28 4 167 2 chry1 Nonribosomal peptide synthetase chry1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
E9FCP4 6.19e-07 56 25 8 256 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 2.72e-06 53 24 17 444 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 4.06e-05 50 25 6 264 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 0.000521 46 24 6 255 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
E9FCP4 0.000703 46 26 4 156 1 dtxS1 Nonribosomal peptide synthetase dtxS1 Metarhizium robertsii (strain ARSEF 23 / ATCC MYA-3075)
Q73ZP7 6.6e-07 55 26 9 309 3 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8RU95 6.72e-07 55 24 15 369 2 4CLL6 4-coumarate--CoA ligase-like 6 Oryza sativa subsp. japonica
P39847 7.31e-07 55 24 6 285 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P39847 9.14e-07 55 22 17 447 1 ppsC Plipastatin synthase subunit C Bacillus subtilis (strain 168)
P46450 7.81e-07 55 22 20 522 3 fadD Long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A8F4S6Z6 8.75e-07 55 24 24 493 1 pydA Hybrid PKS-NRPS synthetase pydA Acremonium sp.
A0A1W6BT46 1.03e-06 55 27 11 302 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
A0A1W6BT46 2.2e-06 54 21 5 266 1 apmB Nonribosomal peptide synthase apmB Penicillium brevicompactum
Q5AUZ6 1.15e-06 55 21 19 526 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5AUZ6 2.26e-06 54 23 16 428 2 atnA Nonribosomal peptide synthase atnA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P39845 1.17e-06 55 29 3 151 1 ppsA Plipastatin synthase subunit A Bacillus subtilis (strain 168)
A7ZA74 1.2e-06 54 22 14 421 3 dltA D-alanine--D-alanyl carrier protein ligase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8NHE4 1.54e-06 54 29 12 249 1 flvI Nonribosomal peptide synthetase flvI Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A1W6BT53 1.57e-06 54 26 3 174 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
A0A1W6BT53 1.08e-05 52 26 8 278 1 apmA N-benzoylphenylalaninol synthetase apmA Penicillium brevicompactum
A0A3G9H9I5 1.87e-06 53 23 13 315 3 ALT10 Acyl-CoA synthetase ALT10 Alternaria alternata
B2HIL6 1.93e-06 53 26 13 359 1 fadD22 p-hydroxybenzoic acid--AMP ligase FadD22 Mycobacterium marinum (strain ATCC BAA-535 / M)
C7ZBE4 2.03e-06 54 26 10 283 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
C7ZBE4 0.000334 47 21 22 523 3 NRPS30 Nonribosomal peptide synthetase 30 Fusarium vanettenii (strain ATCC MYA-4622 / CBS 123669 / FGSC 9596 / NRRL 45880 / 77-13-4)
P71716 2.1e-06 53 24 20 461 1 mbtA Salicyl-AMP ligase / salicyl-S-ArCP synthetase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q5B7I5 2.37e-06 53 22 17 450 2 inpA Nonribosomal peptide synthase inpA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A1JPF0 3.09e-06 53 26 11 270 3 aas Bifunctional protein Aas Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P80435 3.12e-06 53 26 22 439 1 acmA 3-hydroxy-4-methylanthranilate adenylyltransferase Streptomyces anulatus
A2R6H0 3.67e-06 53 26 10 293 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A2R6H0 0.000275 47 24 3 177 2 otaB Nonribosomal peptide synthetase otaB Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
B8N0E8 3.67e-06 53 24 24 486 2 asaC Nonribosomal peptide synthetase asaC Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
G3J9P0 4.42e-06 53 25 19 410 1 TAS1 Hybrid PKS-NRPS synthetase TAS1 Cordyceps militaris (strain CM01)
B6D9A8 4.57e-06 53 22 14 436 1 Beas Beauvericin nonribosomal cyclodepsipeptide synthetase Beauveria bassiana
Q84P23 5.09e-06 52 23 20 486 1 4CLL9 4-coumarate--CoA ligase-like 9 Arabidopsis thaliana
A0A1L9WUW3 6.09e-06 52 24 17 410 1 aneB Nonribosomal peptide synthase aneB Aspergillus aculeatus (strain ATCC 16872 / CBS 172.66 / WB 5094)
Q6YYZ2 6.49e-06 52 24 14 350 3 4CLL3 4-coumarate--CoA ligase-like 3 Oryza sativa subsp. japonica
S0DLP2 7.01e-06 52 24 11 290 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
S0DLP2 0.000408 47 21 13 408 1 apf1 Apicidin F synthase Gibberella fujikuroi (strain CBS 195.34 / IMI 58289 / NRRL A-6831)
Q0CG34 8.27e-06 52 24 10 291 1 tpzB Nonribosomal peptide synthetase tpzA Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A0A0U1LQE6 9.18e-06 52 23 8 263 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 2.42e-05 50 24 9 286 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 0.000135 48 23 4 178 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
A0A0U1LQE6 0.000813 45 24 11 303 3 cctN Cyclochlorotine synthetase Talaromyces islandicus
Q5BDY8 1.04e-05 52 24 9 289 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5BDY8 0.000448 47 25 10 289 3 nlsA Nonribosomal peptide synthase nlsA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10896 1.17e-05 52 27 15 327 1 nrp Isonitrile lipopeptide synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
O35488 1.45e-05 51 26 10 250 1 Slc27a2 Long-chain fatty acid transport protein 2 Mus musculus
Q7TYQ4 1.9e-05 51 31 8 211 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9L9F6 1.92e-05 50 27 8 285 1 novL 8-demethylnovobiocic acid synthase Streptomyces niveus
P9WQ63 1.95e-05 51 31 8 211 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H2ZGB9 1.95e-05 51 25 11 394 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain UCBPP-PA14)
P9WQ62 2e-05 51 31 8 211 1 mbtB Phenyloxazoline synthase MbtB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q1B6A7 2.02e-05 50 26 20 406 3 mbtB Phenyloxazoline synthase MbtB Mycobacterium sp. (strain MCS)
A0A179HJB8 2.08e-05 50 25 16 311 2 lcsD Acyl-CoA ligase lcsD Purpureocillium lilacinum
G3XCV2 2.16e-05 50 25 11 394 1 pchE Pyochelin synthase PchE Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O14975 2.26e-05 50 26 8 217 1 SLC27A2 Long-chain fatty acid transport protein 2 Homo sapiens
O05307 2.42e-05 50 29 6 199 1 fadD6 Medium/long-chain-fatty-acid--CoA ligase FadD6 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ51 2.43e-05 50 28 5 132 1 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ50 2.43e-05 50 28 5 132 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7TWB7 2.43e-05 50 28 5 132 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P0DUL8 2.56e-05 50 23 15 439 1 None Non-canonical nonribosomal peptide synthetase hkm10 Aspergillus hancockii
B2HI05 2.87e-05 50 31 2 94 3 fadD19 Medium/long-chain-fatty-acid--CoA/3-oxocholest-4-en-26-oate--CoA ligase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q0S4D7 2.91e-05 50 25 8 289 1 casI Steroid-22-oyl-CoA synthetase Rhodococcus jostii (strain RHA1)
F2RB81 2.98e-05 50 26 16 392 1 cmlP Non-ribosomal peptide synthetase CmlP Streptomyces venezuelae (strain ATCC 10712 / CBS 650.69 / DSM 40230 / JCM 4526 / NBRC 13096 / PD 04745)
P9WEV1 3.43e-05 50 22 19 491 3 valB Nonribisomal peptide synthetase valB Aspergillus terreus
P39062 3.51e-05 50 26 13 291 1 acsA Acetyl-coenzyme A synthetase Bacillus subtilis (strain 168)
A0A0C1E6T8 3.56e-05 50 26 7 205 1 pboA Nonribosomal peptide synthetase pboA Aspergillus ustus
B1JQC1 3.78e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q667F1 3.78e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype I (strain IP32953)
B2JZ75 3.78e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFD1 3.78e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B6HLP9 3.83e-05 50 28 4 155 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
B6HLP9 4.88e-05 50 25 10 313 3 chyA Nonribosomal peptide synthase chyA Penicillium rubens (strain ATCC 28089 / DSM 1075 / NRRL 1951 / Wisconsin 54-1255)
A4TLD3 3.85e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pestis (strain Pestoides F)
A9R2S1 3.85e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Angola)
Q74RZ6 3.95e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pestis
Q1CAS8 3.95e-05 50 25 10 266 3 aas Bifunctional protein Aas Yersinia pestis bv. Antiqua (strain Antiqua)
A0A2I1D2N0 4.55e-05 50 23 21 516 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
A0A2I1D2N0 0.001 45 24 17 420 3 ungA' Nonribosomal peptide synthetase ungA' Aspergillus campestris (strain IBT 28561)
Q5D6D7 4.97e-05 50 24 10 298 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
Q5D6D7 0.000591 46 24 13 290 2 NPS2 Nonribosomal peptide synthetase 2 Cochliobolus heterostrophus (strain C4 / ATCC 48331 / race T)
B8NI19 5.72e-05 49 24 10 272 2 imqB Nonribosomal peptide synthetase imqB Aspergillus flavus (strain ATCC 200026 / FGSC A1120 / IAM 13836 / NRRL 3357 / JCM 12722 / SRRC 167)
A0A345BJN3 6.52e-05 48 25 6 210 1 clz12 Acyl-CoA ligase clz12 Cochliobolus lunatus
Q5B7I4 6.8e-05 49 27 9 265 2 inpB Nonribosomal peptide synthase inpB Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A4YDT1 9.25e-05 48 22 17 433 1 Msed_0406 4-hydroxybutyrate--CoA ligase 1 Metallosphaera sedula (strain ATCC 51363 / DSM 5348 / JCM 9185 / NBRC 15509 / TH2)
A0QUA1 0.000105 48 25 16 423 1 mbtM Medium/long-chain-fatty-acid--[acyl-carrier-protein] ligase MbtM Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
D4AU56 0.000108 48 22 19 411 2 sidC Nonribosomal peptide synthase sidC Arthroderma benhamiae (strain ATCC MYA-4681 / CBS 112371)
Q5AR54 0.000109 48 22 19 454 1 asqK Nonribosomal peptide synthetase asqK Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
C9K7B5 0.000115 48 22 8 298 2 AMT1 AM-toxin synthetase AMT1 Alternaria alternata
Q9P7T1 0.000136 48 27 12 277 1 sib1 Hydroxamate-type ferrichrome siderophore peptide synthetase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P25464 0.000139 48 26 8 198 1 PCBAB N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Hapsidospora chrysogena
A0A179H164 0.000165 48 22 6 256 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A179H164 0.000409 47 23 10 296 2 lcsA Nonribosomal peptide synthetase lcsA Purpureocillium lilacinum
A0A1U9YHZ2 0.000165 48 21 18 430 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
A0A1U9YHZ2 0.000252 47 24 8 297 2 verP Nonribosomal peptide synthetase verP Clonostachys rogersoniana
Q6D107 0.000191 47 24 10 275 3 aas Bifunctional protein Aas Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C8VTR6 0.000197 47 28 5 155 3 AN10074 Putative acyl-coenzyme A synthetase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
B2HHZ8 0.000198 47 27 18 353 3 fadD17 Medium/long-chain-fatty-acid--CoA ligase FadD17 Mycobacterium marinum (strain ATCC BAA-535 / M)
L0E2U2 0.000212 47 24 11 307 1 phqB Nonribisomal peptide synthase phqB Penicillium fellutanum
P44446 0.000225 47 24 8 216 3 HI_0002 Putative long-chain-fatty-acid--CoA ligase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9I1H0 0.000234 47 25 16 476 1 ambB AMB antimetabolite synthase AmbB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q6TNA5 0.00025 47 22 18 477 1 CmaA L-allo-isoleucine:holo-[CmaA peptidyl-carrier protein] ligase Pseudomonas savastanoi pv. glycinea
Q4WLW5 0.000277 47 23 10 311 1 fmqA Nonribosomal peptide synthetase fmqA Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
A0A248AFK6 0.000337 47 22 13 394 1 NPS2 Nonribosomal peptide synthase NPS2 Ceriporiopsis subvermispora (strain B)
Q9R9J1 0.000347 47 26 6 179 1 mycA Mycosubtilin synthase subunit A Bacillus subtilis
P27742 0.000361 47 25 5 170 1 acvA N-(5-amino-5-carboxypentanoyl)-L-cysteinyl-D-valine synthase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A0A0A1EA36 0.000436 47 21 16 423 1 ESYN1 Enniatin synthetase Fusarium oxysporum
E1ACQ0 0.000452 46 22 10 315 1 notE Nonribisomal peptide synthase notE Aspergillus sp. (strain MF297-2)
Q00869 0.000487 46 21 17 425 1 ESYN1 Enniatin synthase Fusarium equiseti
A0A024F910 0.000518 46 24 17 418 3 vlmS Nonribosomal peptide synthetase vlms Lecanicillium sp.
L7WU80 0.000532 46 27 3 159 1 notE' Nonribisomal peptide synthase notE' Aspergillus versicolor
J4KMC1 0.000552 46 25 4 159 1 tenS Tenellin synthetase Beauveria bassiana (strain ARSEF 2860)
Q5W263 0.000608 45 23 21 497 1 pigI L-proline--[L-prolyl-carrier protein] ligase Serratia sp. (strain ATCC 39006)
Q5ATG8 0.000642 46 28 4 167 1 apdA Hybrid PKS-NRPS synthetase apdA Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q91VE0 0.000735 45 26 8 235 1 Slc27a4 Long-chain fatty acid transport protein 4 Mus musculus
W7MLD7 0.000789 46 26 5 158 1 FUS1 Fusarin C synthetase Gibberella moniliformis (strain M3125 / FGSC 7600)
A0A125SUR3 0.001 45 25 9 257 3 ACTTS4 Nonribosomal peptide synthetase ACTTS4 Alternaria alternata
A0A1W5T1U1 0.001 45 26 7 177 2 poxE Hybrid PKS-NRPS synthetase poxE Penicillium oxalicum

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08540
Feature type CDS
Gene menE
Product o-succinylbenzoate--CoA ligase
Location 110438 - 111829 (strand: 1)
Length 1392 (nucleotides) / 463 (amino acids)

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1881
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00501 AMP-binding enzyme

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0318 Lipid transport and metabolism (I) I O-succinylbenzoic acid-CoA ligase MenE or related acyl-CoA synthetase (AMP-forming)

Protein Sequence

MTAAQWPWVAHAQQTPDKTALRCADSSLTWTELAALADARAAGFYQQGLRESNCVVLRGKNSTELVIDFLALLRCGAVILTLNPALPRGLQTELVASLDADYVCDRSDGTIALPLKTLNPSVTGTAPPDVIPHPKRLATLILTSGSTGLPKAIAHRPVAHLAAAQGVVSLLNYQAGDSWLLSLPLCHVSGQGILWRWLLQGGEMVLRAEGETLAESLRGCTHASLVPTQLWRLLQSPDTLPPLRDVLLGGAAIPVALTEAAEVRGIRCWCGYGMTEFASTVCAKRADGKPGVGHPLHGKDIRLDEQQQILVKGDSFAAGVWLNGALHTLPSHDGWYPTRDKGHMQDGELVIDGRLDNLFCCGGENVQPEVTEKQLMYYPLITECLVVPVSSEEFGAVPVYLIRDYDDWTDEQRQHFSDWCLAELPAFMRPAACYALPEADAAGGIKRTRAPLIQMAQDRFHTN

Flanking regions ( +/- flanking 50bp)

ACACTGACACTGATAACCGCAGATCAATTAACTCAGACAGGACAATGGTAATGACGGCAGCACAATGGCCGTGGGTTGCGCATGCTCAGCAGACACCGGACAAAACCGCGCTGCGCTGTGCGGACTCATCGCTGACATGGACAGAACTGGCGGCTCTCGCGGATGCCCGCGCCGCCGGGTTTTATCAGCAGGGATTGCGGGAAAGTAACTGCGTGGTGCTGCGCGGCAAAAACAGCACAGAGCTGGTGATCGATTTTCTGGCGCTGCTGCGCTGCGGGGCCGTGATTCTGACACTCAATCCCGCACTGCCGCGCGGGTTACAGACAGAACTGGTCGCGTCTCTCGATGCGGATTATGTGTGTGACCGGAGCGACGGTACAATCGCGCTGCCGCTGAAGACACTGAATCCGTCTGTGACCGGCACAGCACCGCCGGATGTGATTCCGCATCCGAAACGGCTGGCAACACTGATCCTGACATCCGGATCCACCGGGTTACCGAAAGCCATTGCCCACCGTCCGGTCGCACATCTGGCTGCGGCACAGGGCGTGGTCTCACTGCTGAACTATCAGGCGGGTGACAGCTGGCTGTTATCGCTGCCGCTGTGTCATGTTTCCGGCCAGGGGATTCTCTGGCGCTGGCTGCTGCAGGGCGGGGAAATGGTTCTCAGGGCGGAAGGGGAAACGCTGGCGGAATCGCTGCGCGGATGTACTCATGCTTCGCTGGTGCCGACACAGCTCTGGCGTCTGCTGCAGTCACCGGACACACTGCCGCCGCTGCGGGATGTTCTGCTCGGCGGTGCGGCTATCCCTGTTGCGCTGACGGAAGCAGCGGAAGTCCGCGGGATCCGCTGCTGGTGCGGCTACGGTATGACCGAATTTGCCTCAACTGTCTGTGCCAAACGGGCGGACGGCAAACCGGGTGTCGGACATCCGCTGCACGGCAAAGATATCCGCCTGGATGAACAACAGCAAATCCTGGTTAAAGGTGACAGTTTTGCGGCCGGTGTCTGGCTGAATGGTGCACTGCATACACTGCCGTCCCATGACGGCTGGTATCCGACCCGCGACAAAGGCCATATGCAGGACGGTGAGCTGGTGATCGACGGCCGGCTGGATAATCTTTTCTGCTGCGGTGGTGAGAATGTGCAGCCGGAAGTGACAGAAAAGCAGCTTATGTACTATCCGCTGATCACGGAGTGTCTGGTGGTACCGGTCAGCAGCGAGGAGTTTGGTGCTGTACCGGTGTATCTGATCCGTGATTATGATGACTGGACAGACGAACAGCGTCAGCATTTCAGTGACTGGTGCCTGGCGGAACTGCCTGCATTTATGCGCCCGGCGGCCTGCTATGCATTACCGGAAGCGGATGCGGCCGGTGGTATCAAACGCACCCGCGCACCGCTGATTCAGATGGCGCAGGATCGTTTTCATACCAACTGAGTTCATATAAAAAAACCGCTGCGGTCAGTGAACGCAGCGGTTTTGTCATG