Homologs in group_1900

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14175 FBDBKF_14175 100.0 Morganella morganii S1 aspB Aspartate/methionine/tyrosine aminotransferase
EHELCC_08105 EHELCC_08105 100.0 Morganella morganii S2 aspB Aspartate/methionine/tyrosine aminotransferase
LHKJJB_05835 LHKJJB_05835 100.0 Morganella morganii S3 aspB Aspartate/methionine/tyrosine aminotransferase
HKOGLL_05080 HKOGLL_05080 100.0 Morganella morganii S5 aspB Aspartate/methionine/tyrosine aminotransferase
F4V73_RS02760 F4V73_RS02760 96.8 Morganella psychrotolerans - pyridoxal phosphate-dependent aminotransferase
PMI_RS08655 PMI_RS08655 86.4 Proteus mirabilis HI4320 - pyridoxal phosphate-dependent aminotransferase

Distribution of the homologs in the orthogroup group_1900

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1900

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0A961 0.0 732 84 0 404 3 alaA Glutamate-pyruvate aminotransferase AlaA Shigella flexneri
P0A959 0.0 732 84 0 404 1 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli (strain K12)
P0A960 0.0 732 84 0 404 3 alaA Glutamate-pyruvate aminotransferase AlaA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P71348 0.0 666 77 0 404 3 alaA Glutamate-pyruvate aminotransferase AlaA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WQ91 0.0 546 61 1 400 1 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQ90 0.0 546 61 1 400 3 aspC Alanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P63499 0.0 546 61 1 400 3 aspC Alanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q58874 2.06e-49 176 31 13 404 3 MJ1479 Uncharacterized aminotransferase MJ1479 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q59228 1.34e-48 172 31 11 386 3 aspC Aspartate aminotransferase Geobacillus stearothermophilus
O67781 1.76e-48 172 30 10 389 3 aspC Probable aspartate/prephenate aminotransferase Aquifex aeolicus (strain VF5)
P23034 1.85e-47 169 28 9 387 1 None Aspartate aminotransferase Bacillus sp. (strain YM-2)
P53001 1.89e-47 169 30 10 392 3 aspB Aspartate aminotransferase Bacillus subtilis (strain 168)
Q54K95 2.85e-45 164 29 10 383 3 tat Tyrosine aminotransferase Dictyostelium discoideum
P52894 1.16e-43 161 28 16 469 1 None Alanine aminotransferase 2 Hordeum vulgare
O86459 1.45e-43 159 30 14 392 3 aspC Probable aspartate/prephenate aminotransferase Rhizobium leguminosarum bv. phaseoli
Q93703 4.37e-43 159 28 6 370 1 tatn-1 Tyrosine aminotransferase Caenorhabditis elegans
Q02635 7.39e-43 157 29 12 396 1 aatA Aspartate/prephenate aminotransferase Rhizobium meliloti (strain 1021)
Q795M6 1.4e-42 156 31 13 366 3 yugH Putative aminotransferase YugH Bacillus subtilis (strain 168)
Q82DR2 3.67e-42 155 28 10 382 1 aspC1 Aspartate aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q56232 6.87e-42 154 30 13 381 1 aspC Aspartate/prephenate aminotransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O33822 2.15e-41 153 30 15 381 3 aspC Probable aspartate/prephenate aminotransferase Thermus aquaticus
Q9X0Y2 2.96e-41 152 27 8 379 1 aspC Aspartate aminotransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
H3ZPU1 3.76e-41 152 28 10 375 1 OCC_04737 Aromatic-amino-acid aminotransferase 2 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
A3PMF8 6.61e-41 152 30 14 395 1 Rsph17029_2422 Aspartate/prephenate aminotransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q9V0L2 1.04e-40 151 27 11 379 3 aspC Aspartate aminotransferase Pyrococcus abyssi (strain GE5 / Orsay)
Q4UND3 1.1e-39 149 27 11 409 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q1RGV0 3.4e-39 147 27 11 410 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia bellii (strain RML369-C)
P34106 3.78e-39 149 30 14 385 1 None Alanine aminotransferase 2 Panicum miliaceum
Q9LDV4 4.5e-39 150 28 17 457 1 ALAAT2 Alanine aminotransferase 2, mitochondrial Arabidopsis thaliana
Q92JE7 4.76e-39 147 27 11 409 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9LR30 1.16e-38 148 27 15 449 1 GGAT1 Glutamate--glyoxylate aminotransferase 1 Arabidopsis thaliana
O58489 3.97e-38 144 28 9 374 3 aspC Aspartate aminotransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q8DTM1 4.67e-38 144 27 11 383 1 aspB Asparagine--oxo-acid transaminase Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q68XV9 2.22e-37 142 27 11 406 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
F4I7I0 3.06e-37 145 27 15 457 1 ALAAT1 Alanine aminotransferase 1, mitochondrial Arabidopsis thaliana
Q9SIE1 3.11e-37 144 29 13 393 1 PAT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Arabidopsis thaliana
Q60013 4.04e-37 142 27 12 383 3 aspC Aspartate aminotransferase Streptomyces virginiae
Q28DB5 4.87e-37 144 26 15 467 2 gpt2 Alanine aminotransferase 2 Xenopus tropicalis
Q9ZE56 6.71e-37 141 27 11 406 3 aatA Probable aspartate/prephenate aminotransferase Rickettsia prowazekii (strain Madrid E)
Q9S7E9 3.06e-36 141 26 16 454 1 GGAT2 Glutamate--glyoxylate aminotransferase 2 Arabidopsis thaliana
Q8KDS8 7.78e-36 138 27 12 388 1 CT0966 Aspartate/prephenate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
P04694 8.06e-36 139 26 10 405 1 Tat Tyrosine aminotransferase Rattus norvegicus
Q8QZR1 1.39e-35 139 25 10 409 1 Tat Tyrosine aminotransferase Mus musculus
Q60317 2.39e-35 137 27 10 381 3 MJ0001 Probable aspartate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6GM82 3.16e-35 139 26 15 461 2 gpt2 Alanine aminotransferase 2 Xenopus laevis
C6C2Z3 4.01e-35 136 26 11 391 1 Dd703_1457 Aspartate aminotransferase Musicola paradisiaca (strain Ech703)
P17735 5.94e-35 137 27 10 378 1 TAT Tyrosine aminotransferase Homo sapiens
Q58097 1.03e-34 135 27 11 389 1 mfnC (5-formylfuran-3-yl)methyl phosphate transaminase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
E9L7A5 1.61e-34 136 27 13 413 1 PPA-AT Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase Petunia hybrida
Q8BGT5 5.57e-34 135 26 18 470 1 Gpt2 Alanine aminotransferase 2 Mus musculus
P14909 7.43e-34 133 26 7 356 1 aspC Aspartate aminotransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q9LVY1 9.78e-34 133 27 9 374 1 TAT Tyrosine aminotransferase Arabidopsis thaliana
Q54MJ7 2.48e-33 134 25 16 480 3 gpt Probable alanine aminotransferase, mitochondrial Dictyostelium discoideum
Q55128 2.56e-33 131 26 9 401 1 aspC Aspartate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4IFH5 3.24e-33 133 24 16 465 2 GPT Alanine aminotransferase 1 Bos taurus
Q06191 4.69e-33 131 27 13 386 1 aatB Aspartate aminotransferase Rhizobium meliloti
Q9SIV0 8.17e-33 131 26 9 384 1 SUR1 S-alkyl-thiohydroximate lyase SUR1 Arabidopsis thaliana
P58350 8.41e-33 130 27 12 387 1 aatB Aspartate aminotransferase Rhizobium meliloti (strain 1021)
Q58CZ9 1.36e-32 130 25 10 405 2 TAT Tyrosine aminotransferase Bos taurus
Q8TD30 2.53e-32 131 24 16 462 1 GPT2 Alanine aminotransferase 2 Homo sapiens
B2A250 3.13e-32 128 24 10 406 3 dapL LL-diaminopimelate aminotransferase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q8QZR5 1.63e-31 128 25 19 464 1 Gpt Alanine aminotransferase 1 Mus musculus
Q6NYL5 2.13e-31 128 25 17 455 2 gpt2l Alanine aminotransferase 2-like Danio rerio
Q9HUI9 2.64e-31 126 26 9 370 1 aruH Arginine--pyruvate transaminase AruH Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q5F4K8 9.08e-31 126 26 13 383 1 AAT Aspartate aminotransferase Pinus pinaster
Q82WA8 1.42e-30 124 27 13 398 1 aatA Aspartate/prephenate aminotransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P52892 1.62e-30 125 27 12 362 1 ALT2 Probable alanine aminotransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25409 2.9e-30 125 26 19 445 1 Gpt Alanine aminotransferase 1 Rattus norvegicus
Q4J8X2 6.93e-30 122 23 8 380 3 aspC Aspartate aminotransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9SK47 1.21e-29 122 26 7 316 2 TAT3 Probable aminotransferase TAT3 Arabidopsis thaliana
Q10334 1.8e-29 122 26 11 355 3 SPBC582.08 Putative alanine aminotransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P52893 3.32e-29 122 27 11 359 1 ALT1 Probable alanine aminotransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P24298 1.76e-28 119 24 16 447 1 GPT Alanine aminotransferase 1 Homo sapiens
Q3AC10 4.35e-28 117 26 13 391 3 dapL LL-diaminopimelate aminotransferase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
P33447 5.52e-28 117 23 8 386 1 None Tyrosine aminotransferase Trypanosoma cruzi
P16524 7.69e-28 116 26 14 391 1 dapX Probable N-acetyl-LL-diaminopimelate aminotransferase Bacillus subtilis (strain 168)
Q972A2 1.44e-27 115 24 11 369 3 aspC Aspartate aminotransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q67Y55 1.64e-27 116 25 6 352 2 At4g28420 Probable aminotransferase TAT1 Arabidopsis thaliana
Q3Z8H5 2.6e-27 115 25 11 404 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q2RK33 4.85e-27 114 26 10 383 1 dapL LL-diaminopimelate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q9ST02 5.69e-27 115 26 11 389 1 naat-A Nicotianamine aminotransferase A Hordeum vulgare
Q9FN30 6.2e-27 114 25 9 384 2 At5g53970 Probable aminotransferase TAT2 Arabidopsis thaliana
Q3ZXC8 1.48e-26 112 25 12 402 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
A5FRC5 1.65e-26 112 25 12 402 3 dapL LL-diaminopimelate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
B8CX89 2.28e-26 112 29 5 267 3 dapL LL-diaminopimelate aminotransferase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B8DJJ6 2.91e-26 112 25 10 379 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q9SUR6 4.34e-25 109 23 10 349 1 CORI3 Cystine lyase CORI3 Arabidopsis thaliana
O07587 5.46e-25 108 26 13 398 3 yhdR Putative aspartate aminotransferase YhdR Bacillus subtilis (strain 168)
O87320 6.5e-25 108 25 13 394 3 aatC Putative aminotransferase AatC Rhizobium meliloti (strain 1021)
C6BUK3 9.23e-25 107 25 12 390 3 dapL LL-diaminopimelate aminotransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A0A0P0VI36 1.12e-24 108 24 7 345 1 NAAT1 Nicotianamine aminotransferase 1 Oryza sativa subsp. japonica
A0LEA5 1.31e-24 107 25 12 388 1 dapL LL-diaminopimelate aminotransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A1VDD3 3.04e-24 106 25 9 404 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72BI1 3.59e-24 106 25 11 406 3 dapL LL-diaminopimelate aminotransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
O14209 7.21e-24 105 27 12 316 3 SPAC6B12.04c Uncharacterized aminotransferase C6B12.04c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O31665 8.39e-24 105 25 10 388 1 mtnE L-glutamine--4-(methylsulfanyl)-2-oxobutanoate aminotransferase Bacillus subtilis (strain 168)
Q30ZX9 7.83e-23 102 23 10 374 3 dapL LL-diaminopimelate aminotransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
P77434 9.35e-23 102 26 10 377 1 alaC Glutamate-pyruvate aminotransferase AlaC Escherichia coli (strain K12)
B1I544 1.34e-22 101 29 4 224 3 dapL LL-diaminopimelate aminotransferase Desulforudis audaxviator (strain MP104C)
P47039 1.93e-22 102 24 6 254 1 BNA3 Probable kynurenine--oxoglutarate transaminase BNA3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ST03 1.94e-22 102 25 12 403 1 naat-B Nicotianamine aminotransferase B Hordeum vulgare
P39643 2.34e-22 101 25 12 390 1 bacF Transaminase BacF Bacillus subtilis (strain 168)
Q8VYP2 7.88e-22 100 24 11 349 2 At4g23590 Probable aminotransferase TAT4 Arabidopsis thaliana
Q54KM6 3.45e-21 98 24 14 335 3 ccbl Kynurenine--oxoglutarate transaminase Dictyostelium discoideum
O66630 2.63e-20 95 25 11 371 3 dapL LL-diaminopimelate aminotransferase Aquifex aeolicus (strain VF5)
P96847 7.28e-20 94 26 13 384 1 aspB Valine--pyruvate aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q8BTY1 1.51e-19 93 27 4 199 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Mus musculus
Q84CG1 1.95e-19 92 27 9 283 1 vioD Capreomycidine synthase Streptomyces vinaceus
Q8YP73 2.52e-19 92 24 6 256 3 dapL2 LL-diaminopimelate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7NDX4 2.64e-19 92 25 6 260 1 dapL LL-diaminopimelate aminotransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0P5G4 4.84e-19 92 27 8 206 2 KYAT3 Kynurenine--oxoglutarate transaminase 3 Bos taurus
Q3MDN5 8.62e-19 90 24 6 256 3 dapL2 LL-diaminopimelate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q7T3E5 3.2e-18 89 26 9 231 2 kyat3 Kynurenine--oxoglutarate transaminase 3 Danio rerio
Q71RI9 7.19e-18 88 26 7 206 1 Kyat3 Kynurenine--oxoglutarate transaminase 3 Mus musculus
Q6YP21 1.01e-17 88 25 8 244 1 KYAT3 Kynurenine--oxoglutarate transaminase 3 Homo sapiens
Q16773 1.1e-17 87 26 4 199 1 KYAT1 Kynurenine--oxoglutarate transaminase 1 Homo sapiens
Q58786 2.43e-17 86 24 14 345 1 dapL LL-diaminopimelate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P36692 3.37e-17 83 30 6 185 3 aspC Probable aspartate aminotransferase (Fragment) Streptomyces griseus
Q08415 3.5e-17 86 27 3 171 1 Kyat1 Kynurenine--oxoglutarate transaminase 1 Rattus norvegicus
P9WPZ5 8.89e-17 84 28 5 198 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPZ4 8.89e-17 84 28 5 198 1 dapC Probable N-succinyldiaminopimelate aminotransferase DapC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P61003 1.09e-16 84 24 7 310 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
P18485 1.56e-16 84 22 13 375 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Solanum lycopersicum
Q58FK9 3.77e-16 83 25 7 206 2 Kyat3 Kynurenine--oxoglutarate transaminase 3 Rattus norvegicus
Q6LX26 5.09e-16 82 25 4 236 1 dapL LL-diaminopimelate aminotransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A6VGF6 7.48e-16 82 25 6 288 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q10MQ2 1.29e-15 81 25 8 256 2 AGD2 Probable LL-diaminopimelate aminotransferase, chloroplastic Oryza sativa subsp. japonica
P77806 1.35e-15 81 25 8 234 1 ybdL Methionine aminotransferase Escherichia coli (strain K12)
Q9SNN8 1.41e-15 82 22 11 356 2 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Oryza sativa subsp. japonica
O84395 1.86e-15 80 26 14 270 1 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q3KLW3 1.86e-15 80 26 14 270 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar A (strain ATCC VR-571B / DSM 19440 / HAR-13)
B0BC25 2.19e-15 80 26 13 270 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2b (strain UCH-1/proctitis)
B0B7W0 2.19e-15 80 26 13 270 3 dapL LL-diaminopimelate aminotransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q93ZN9 3.52e-15 80 26 8 253 1 DAP LL-diaminopimelate aminotransferase, chloroplastic Arabidopsis thaliana
A4FWW1 1.08e-14 78 25 8 289 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A6UPL6 1.59e-14 77 24 9 287 3 hisC Histidinol-phosphate aminotransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q07262 1.61e-14 78 20 12 364 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Nicotiana tabacum
A2AIG8 1.68e-14 78 22 12 367 2 Accs 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Mus musculus
Q3UX83 2.47e-14 78 23 12 369 2 Accsl Probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2 Mus musculus
A9AA96 2.9e-14 77 24 7 310 3 hisC Histidinol-phosphate aminotransferase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q4AC99 2.91e-14 78 24 14 369 1 ACCSL Probable inactive 1-aminocyclopropane-1-carboxylate synthase-like protein 2 Homo sapiens
P95957 3.27e-14 77 23 16 393 3 SSO0104 Uncharacterized aminotransferase SSO0104 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q1AY33 4.59e-14 76 30 8 199 3 hisC Histidinol-phosphate aminotransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q00379 9.35e-14 76 21 12 363 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Cucurbita pepo
Q0W253 1.23e-13 75 29 4 162 3 hisC Histidinol-phosphate aminotransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q5E9H2 1.27e-13 75 23 14 373 2 ACCS 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Bos taurus
P23599 2.12e-13 75 21 15 384 2 ACS1 1-aminocyclopropane-1-carboxylate synthase CMW33 Cucurbita maxima
Q824A4 2.18e-13 74 24 10 271 3 dapL LL-diaminopimelate aminotransferase Chlamydia caviae (strain ATCC VR-813 / DSM 19441 / 03DC25 / GPIC)
A3DK17 2.58e-13 74 26 10 250 1 dapL LL-diaminopimelate aminotransferase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q9MB95 2.67e-13 74 21 13 362 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Prunus mume
P29535 2.78e-13 74 23 13 372 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Solanum lycopersicum
P27486 2.84e-13 74 21 11 356 2 ACS2 1-aminocyclopropane-1-carboxylate synthase Dianthus caryophyllus
B8IZX8 3.04e-13 74 23 15 400 3 dapL LL-diaminopimelate aminotransferase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q2RL44 4.13e-13 73 30 4 162 3 hisC Histidinol-phosphate aminotransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
P23279 4.59e-13 73 21 13 383 1 ACC1A 1-aminocyclopropane-1-carboxylate synthase 1 Cucurbita pepo
Q08432 4.63e-13 73 23 9 300 1 patB Cystathionine beta-lyase PatB Bacillus subtilis (strain 168)
Q7XQ85 5.37e-13 73 23 13 360 2 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Oryza sativa subsp. japonica
Q9ZQI7 8.44e-13 73 21 9 351 1 ALD1 Aminotransferase ALD1, chloroplastic Arabidopsis thaliana
P31531 1.14e-12 72 20 10 362 2 ACS1 1-aminocyclopropane-1-carboxylate synthase Glycine max
A8ZXV5 1.57e-12 72 25 11 281 3 dapL LL-diaminopimelate aminotransferase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
B2HLJ8 2.29e-12 71 29 3 186 3 pat Putative phenylalanine aminotransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q253K9 2.65e-12 71 23 12 297 3 dapL LL-diaminopimelate aminotransferase Chlamydia felis (strain Fe/C-56)
Q04UL5 2.71e-12 71 22 8 315 3 dapL LL-diaminopimelate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q74GT3 3.65e-12 70 28 8 238 3 dapL LL-diaminopimelate aminotransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
O93744 4.8e-12 70 23 14 348 3 aspC Aspartate aminotransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q04YV8 5.63e-12 70 22 8 315 3 dapL LL-diaminopimelate aminotransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q6ABU3 7.07e-12 69 27 16 309 3 pat Putative phenylalanine aminotransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A0PVN0 1.12e-11 69 28 3 186 3 pat Putative phenylalanine aminotransferase Mycobacterium ulcerans (strain Agy99)
Q5L6M0 1.2e-11 69 25 7 205 3 dapL LL-diaminopimelate aminotransferase Chlamydia abortus (strain DSM 27085 / S26/3)
Q6MDE0 1.46e-11 69 24 9 243 1 dapL LL-diaminopimelate aminotransferase Protochlamydia amoebophila (strain UWE25)
Q31GD4 1.58e-11 68 24 8 240 3 hisC2 Histidinol-phosphate aminotransferase 2 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q6ABX6 1.85e-11 68 28 3 160 3 pat Putative phenylalanine aminotransferase Leifsonia xyli subsp. xyli (strain CTCB07)
B9M384 2.2e-11 68 26 7 237 3 dapL LL-diaminopimelate aminotransferase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
B1WSG7 2.89e-11 68 26 11 240 3 dapL LL-diaminopimelate aminotransferase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B1VP97 3.19e-11 67 27 6 223 3 pat Putative phenylalanine aminotransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C0QFJ4 3.4e-11 68 23 15 390 3 dapL LL-diaminopimelate aminotransferase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q17CS8 3.45e-11 68 21 13 300 1 KAT Kynurenine aminotransferase Aedes aegypti
Q3AAT6 3.52e-11 67 26 3 161 3 hisC2 Histidinol-phosphate aminotransferase 2 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
O28255 3.67e-11 67 23 10 294 3 hisC2 Histidinol-phosphate aminotransferase 2 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q06402 3.85e-11 68 21 10 358 1 ACS2 1-aminocyclopropane-1-carboxylate synthase 2 Arabidopsis thaliana
Q7VA14 3.95e-11 67 25 10 248 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
B0K625 4.24e-11 67 24 9 218 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter sp. (strain X514)
Q96QU6 4.29e-11 68 22 12 373 1 ACCS 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Homo sapiens
Q1R089 4.68e-11 67 27 12 245 3 hisC Histidinol-phosphate aminotransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
P61005 4.7e-11 67 30 2 162 3 pat Putative phenylalanine aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0Q9F3 4.83e-11 67 30 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium avium (strain 104)
O26158 5.16e-11 67 23 8 256 1 dapL LL-diaminopimelate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q0S962 5.18e-11 67 29 3 163 3 pat Putative phenylalanine aminotransferase Rhodococcus jostii (strain RHA1)
Q9C969 5.24e-11 67 21 12 369 1 ISS1 Aromatic aminotransferase ISS1 Arabidopsis thaliana
A6L7E4 5.68e-11 67 25 8 239 3 dapL LL-diaminopimelate aminotransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q01912 5.76e-11 67 20 12 344 2 ACS5 1-aminocyclopropane-1-carboxylate synthase (Fragment) Vigna radiata var. radiata
Q8AAB8 6.47e-11 67 24 11 273 3 dapL LL-diaminopimelate aminotransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q6AL81 6.96e-11 67 23 12 294 3 dapL LL-diaminopimelate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B0K735 8.46e-11 66 24 9 218 3 hisC Histidinol-phosphate aminotransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A9BCJ1 8.8e-11 66 25 9 231 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9211)
Q47KH1 9.57e-11 66 29 4 161 3 pat Putative phenylalanine aminotransferase Thermobifida fusca (strain YX)
Q39Z65 1.01e-10 66 26 8 238 3 dapL LL-diaminopimelate aminotransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B0TA38 1.03e-10 66 26 7 214 3 dapL LL-diaminopimelate aminotransferase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q10ZC3 1.04e-10 66 26 8 231 3 dapL LL-diaminopimelate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q8FU28 1.04e-10 66 28 5 167 3 pat Putative phenylalanine aminotransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q8GYY0 1.06e-10 66 21 11 367 2 ACS12 Probable aminotransferase ACS12 Arabidopsis thaliana
Q72NJ3 1.25e-10 66 21 10 347 1 dapL LL-diaminopimelate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q7U4C3 1.37e-10 66 24 7 236 3 dapL LL-diaminopimelate aminotransferase Parasynechococcus marenigrum (strain WH8102)
B8I5V1 1.39e-10 65 27 4 159 3 hisC Histidinol-phosphate aminotransferase Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q65S79 1.41e-10 65 28 8 225 3 hisC1 Histidinol-phosphate aminotransferase 1 Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A6L8U2 1.47e-10 66 22 12 392 3 dapL LL-diaminopimelate aminotransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q8F814 1.51e-10 66 21 10 347 3 dapL LL-diaminopimelate aminotransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q1B1Z8 1.67e-10 65 28 2 177 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain MCS)
A1UN51 1.67e-10 65 28 2 177 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain KMS)
O28277 1.79e-10 65 29 5 158 3 hisC1 Histidinol-phosphate aminotransferase 1 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q81P62 1.88e-10 65 25 6 234 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus anthracis
A3Q7J9 1.91e-10 65 28 2 177 3 pat Putative phenylalanine aminotransferase Mycobacterium sp. (strain JLS)
Q82FJ1 1.99e-10 65 26 5 215 3 pat Putative phenylalanine aminotransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A8MEH2 2.15e-10 65 27 2 161 3 hisC Histidinol-phosphate aminotransferase Alkaliphilus oremlandii (strain OhILAs)
A5GIN1 2.28e-10 65 24 8 237 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain WH7803)
A0A0P0WIY3 2.42e-10 65 20 14 384 2 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Oryza sativa subsp. japonica
Q9LQ10 2.47e-10 65 21 12 370 1 ACS10 Probable aminotransferase ACS10 Arabidopsis thaliana
A4XMY1 2.65e-10 65 21 6 293 3 hisC Histidinol-phosphate aminotransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
A2BYM6 2.78e-10 65 24 9 268 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9515)
Q63A05 2.88e-10 65 25 6 234 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ZK / E33L)
Q9W698 2.91e-10 65 21 10 360 3 accs 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Takifugu rubripes
Q1MR87 2.95e-10 65 24 17 378 3 dapL LL-diaminopimelate aminotransferase Lawsonia intracellularis (strain PHE/MN1-00)
Q4FP52 3.3e-10 64 26 3 164 3 hisC Histidinol-phosphate aminotransferase Pelagibacter ubique (strain HTCC1062)
Q9S9U6 3.36e-10 65 21 14 380 1 ACS11 1-aminocyclopropane-1-carboxylate synthase 11 Arabidopsis thaliana
A1ATI6 3.5e-10 65 24 7 236 3 dapL LL-diaminopimelate aminotransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B8HJY4 4.35e-10 64 25 9 253 3 dapL LL-diaminopimelate aminotransferase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q5SHW0 4.56e-10 64 26 6 179 1 TTHA1620 Cystathionine beta-lyase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B1XKF6 4.7e-10 64 24 8 237 3 dapL LL-diaminopimelate aminotransferase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3A1U5 5.58e-10 64 25 6 212 3 dapL LL-diaminopimelate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3SV41 6.02e-10 63 25 7 224 3 hisC Histidinol-phosphate aminotransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q12U08 6.5e-10 63 25 4 154 3 hisC Histidinol-phosphate aminotransferase Methanococcoides burtonii (strain DSM 6242 / NBRC 107633 / OCM 468 / ACE-M)
C6E9Q7 6.51e-10 63 27 8 238 3 dapL LL-diaminopimelate aminotransferase Geobacter sp. (strain M21)
A6UTL8 8.24e-10 63 24 2 151 3 hisC Histidinol-phosphate aminotransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q9ZBY8 8.87e-10 63 26 5 215 3 pat Putative phenylalanine aminotransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q5N492 8.99e-10 63 25 10 240 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PY6 8.99e-10 63 25 10 240 3 dapL LL-diaminopimelate aminotransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q9STR4 9.44e-10 63 21 11 357 1 ACS7 1-aminocyclopropane-1-carboxylate synthase 7 Arabidopsis thaliana
Q6HHF6 9.84e-10 63 24 6 234 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q7V4Z3 9.92e-10 63 24 9 230 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9313)
B3E933 9.98e-10 63 26 8 238 3 dapL LL-diaminopimelate aminotransferase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
Q3AMU5 1.08e-09 63 25 9 231 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain CC9605)
Q81C43 1.35e-09 62 24 4 210 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q9SAR0 1.35e-09 63 21 11 363 1 ACS6 1-aminocyclopropane-1-carboxylate synthase 6 Arabidopsis thaliana
Q46IX2 1.38e-09 63 24 12 265 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain NATL2A)
B0UN04 1.38e-09 62 26 5 228 3 hisC Histidinol-phosphate aminotransferase Methylobacterium sp. (strain 4-46)
Q58365 1.43e-09 62 24 4 156 3 hisC Histidinol-phosphate aminotransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A0A0P0UZP7 1.5e-09 63 26 6 181 2 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Oryza sativa subsp. japonica
A1TGS6 1.51e-09 62 30 2 160 3 pat Putative phenylalanine aminotransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A9H311 1.52e-09 62 27 11 226 3 hisC Histidinol-phosphate aminotransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q3Z879 1.55e-09 62 23 8 258 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q64SY6 1.72e-09 62 21 14 392 3 dapL LL-diaminopimelate aminotransferase Bacteroides fragilis (strain YCH46)
Q8DH57 1.92e-09 62 25 9 233 3 dapL LL-diaminopimelate aminotransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q3MAL4 1.94e-09 62 25 7 231 3 dapL1 LL-diaminopimelate aminotransferase 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
A2CC97 1.94e-09 62 24 9 230 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9303)
Q8Y0Y8 1.94e-09 62 24 9 241 3 hisC2 Histidinol-phosphate aminotransferase 2 Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q3AW44 2.03e-09 62 23 8 230 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain CC9902)
A3PEY9 2.03e-09 62 24 9 252 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9301)
Q93QC6 2.06e-09 62 24 4 182 1 metC Cystathionine beta-lyase Corynebacterium glutamicum
Q2JS04 2.08e-09 62 24 8 231 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain JA-3-3Ab)
Q5LC03 2.15e-09 62 23 10 267 1 dapL LL-diaminopimelate aminotransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q7UZZ3 2.52e-09 62 26 10 265 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2C4T7 2.54e-09 62 24 12 265 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain NATL1A)
Q8YM38 2.61e-09 62 25 7 231 3 dapL1 LL-diaminopimelate aminotransferase 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
C4ZG66 2.65e-09 62 25 9 237 3 dapL LL-diaminopimelate aminotransferase Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
P9WML5 2.77e-09 62 29 2 162 1 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WML4 2.77e-09 62 29 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U9A1 2.77e-09 62 29 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q9CMI7 2.97e-09 62 26 6 218 3 hisC2 Histidinol-phosphate aminotransferase 2 Pasteurella multocida (strain Pm70)
C1AIM6 2.97e-09 61 29 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KQA5 2.97e-09 61 29 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7TVQ0 2.97e-09 61 29 2 162 3 pat Putative phenylalanine aminotransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
B5EGX2 3.38e-09 62 26 6 212 3 dapL LL-diaminopimelate aminotransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A5UN82 3.41e-09 62 25 12 266 3 dapL LL-diaminopimelate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5GW23 3.44e-09 62 25 9 231 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain RCC307)
Q6VMN7 3.48e-09 62 26 8 205 2 ALD1 Aminotransferase ALD1 homolog Oryza sativa subsp. japonica
B8IRU5 3.53e-09 61 29 2 157 3 hisC Histidinol-phosphate aminotransferase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q8PX17 3.59e-09 61 24 6 205 3 hisC Histidinol-phosphate aminotransferase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A5GD93 3.72e-09 61 25 7 237 3 dapL LL-diaminopimelate aminotransferase Geotalea uraniireducens (strain Rf4)
P61004 3.74e-09 61 27 4 158 3 pat Putative phenylalanine aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q18T09 4.49e-09 61 25 10 235 1 dapL LL-diaminopimelate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
B7JVL5 4.62e-09 61 24 10 241 3 dapL LL-diaminopimelate aminotransferase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q9T065 4.73e-09 61 19 10 353 1 ACS8 1-aminocyclopropane-1-carboxylate synthase 8 Arabidopsis thaliana
Q8R5Q4 4.79e-09 61 24 10 266 1 hisC Histidinol-phosphate aminotransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q9PK04 5e-09 61 21 15 377 3 dapL LL-diaminopimelate aminotransferase Chlamydia muridarum (strain MoPn / Nigg)
Q9WVM8 5.33e-09 61 28 4 173 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Mus musculus
P37821 5.35e-09 61 21 11 359 1 ACS-1 1-aminocyclopropane-1-carboxylate synthase Malus domestica
Q8R5U4 5.51e-09 60 24 2 156 3 cobD Putative threonine-phosphate decarboxylase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A0R5X8 5.78e-09 60 28 2 160 1 pat Putative phenylalanine aminotransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q4JSJ5 5.9e-09 60 29 7 170 3 pat Putative phenylalanine aminotransferase Corynebacterium jeikeium (strain K411)
Q57004 6.01e-09 60 22 14 360 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B0JUM0 6.2e-09 61 24 9 233 3 dapL LL-diaminopimelate aminotransferase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
P96681 6.32e-09 61 27 6 194 3 ydfD Uncharacterized HTH-type transcriptional regulator YdfD Bacillus subtilis (strain 168)
A8LK96 6.44e-09 60 27 6 184 3 hisC Histidinol-phosphate aminotransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q5QZ49 7.76e-09 60 23 13 370 3 hisC1 Histidinol-phosphate aminotransferase 1 Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q3JEN8 7.77e-09 60 27 10 218 3 hisC1 Histidinol-phosphate aminotransferase 1 Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q736A5 7.79e-09 60 23 5 214 3 hisC2 Histidinol-phosphate aminotransferase 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q37001 8.08e-09 60 20 12 358 1 ACS5 1-aminocyclopropane-1-carboxylate synthase 5 Arabidopsis thaliana
B1MFC0 8.69e-09 60 31 4 163 3 pat Putative phenylalanine aminotransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q24S01 8.94e-09 60 25 9 232 3 dapL LL-diaminopimelate aminotransferase Desulfitobacterium hafniense (strain Y51)
A4QAL4 9e-09 60 26 2 165 3 pat Putative phenylalanine aminotransferase Corynebacterium glutamicum (strain R)
B7KL61 9.26e-09 60 26 7 232 3 dapL LL-diaminopimelate aminotransferase Gloeothece citriformis (strain PCC 7424)
Q43309 9.46e-09 60 22 13 358 1 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Arabidopsis thaliana
Q4QLD1 9.67e-09 60 22 12 354 3 hisC2 Histidinol-phosphate aminotransferase 2 Haemophilus influenzae (strain 86-028NP)
Q1QQD5 1.04e-08 60 25 7 226 3 hisC Histidinol-phosphate aminotransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q8NTT4 1.14e-08 60 26 2 165 3 pat Probable phenylalanine aminotransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q0ID68 1.28e-08 60 24 8 238 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain CC9311)
A5N7Q7 1.28e-08 59 22 11 309 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E168 1.28e-08 59 22 11 309 3 hisC Histidinol-phosphate aminotransferase Clostridium kluyveri (strain NBRC 12016)
C0R1Z0 1.39e-08 59 26 5 178 3 hisC Histidinol-phosphate aminotransferase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
O50434 1.4e-08 60 21 9 367 1 Rv1178 Probable aminotransferase Rv1178 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A2BT75 1.4e-08 60 23 9 252 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain AS9601)
C4Z4Y1 1.41e-08 60 25 10 240 3 dapL LL-diaminopimelate aminotransferase Lachnospira eligens (strain ATCC 27750 / DSM 3376 / VPI C15-48 / C15-B4)
Q8YMG7 1.41e-08 59 22 13 330 3 hisC2 Histidinol-phosphate aminotransferase 2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q6Q887 1.48e-08 60 22 12 346 2 sirI Probable aminotransferase sirI Leptosphaeria maculans
Q9M2Y8 1.52e-08 60 20 12 358 1 ACS9 1-aminocyclopropane-1-carboxylate synthase 9 Arabidopsis thaliana
B9LNJ8 1.56e-08 59 23 9 309 3 hisC Histidinol-phosphate aminotransferase Halorubrum lacusprofundi (strain ATCC 49239 / DSM 5036 / JCM 8891 / ACAM 34)
B8FP20 1.87e-08 59 25 6 163 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q67KI2 1.88e-08 59 27 3 156 3 hisC Histidinol-phosphate aminotransferase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
B9EAC1 1.96e-08 59 21 14 368 3 hisC Histidinol-phosphate aminotransferase Macrococcus caseolyticus (strain JCSC5402)
B2J2U3 2.05e-08 59 24 9 234 3 dapL LL-diaminopimelate aminotransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q00257 2.2e-08 59 20 12 362 2 ACS2 1-aminocyclopropane-1-carboxylate synthase CMA101 Cucurbita maxima
Q2Y6Y6 2.34e-08 59 23 18 379 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q55828 2.35e-08 59 25 8 232 1 dapL LL-diaminopimelate aminotransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0CDH5 2.39e-08 59 26 9 231 3 dapL LL-diaminopimelate aminotransferase Acaryochloris marina (strain MBIC 11017)
Q3ARM7 2.5e-08 58 25 18 325 3 hisC Histidinol-phosphate aminotransferase Chlorobium chlorochromatii (strain CaD3)
Q51687 2.75e-08 58 29 13 257 3 hisC Histidinol-phosphate aminotransferase Paracoccus denitrificans (strain Pd 1222)
H3ZPL1 3.3e-08 58 24 14 358 1 OCC_04335 Aromatic-amino-acid aminotransferase 1 Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q318P3 3.59e-08 58 24 11 253 3 dapL LL-diaminopimelate aminotransferase Prochlorococcus marinus (strain MIT 9312)
Q2NEQ0 3.69e-08 58 22 7 227 3 hisC Histidinol-phosphate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q2JLL9 3.7e-08 58 23 7 231 3 dapL LL-diaminopimelate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
O27624 4.76e-08 58 26 12 255 3 hisC Histidinol-phosphate aminotransferase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q89GX0 4.78e-08 58 26 6 178 3 hisC1 Histidinol-phosphate aminotransferase 1 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A7HCR6 5e-08 58 25 2 156 3 hisC Histidinol-phosphate aminotransferase Anaeromyxobacter sp. (strain Fw109-5)
Q64602 5.2e-08 58 21 10 301 1 Aadat Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Rattus norvegicus
Q9Z856 5.75e-08 58 22 6 192 3 dapL LL-diaminopimelate aminotransferase Chlamydia pneumoniae
Q4WMJ9 5.92e-08 58 21 11 317 2 gliI Probable aminotransferase gliI Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
C1FN41 6.59e-08 57 26 13 267 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Kyoto / Type A2)
Q5W6F9 7.25e-08 58 20 13 384 2 ACS4 1-aminocyclopropane-1-carboxylate synthase 4 Oryza sativa subsp. japonica
C3KVX5 7.68e-08 57 26 12 243 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain 657 / Type Ba4)
D5FKJ2 7.7e-08 57 20 5 256 3 mrsB L-aspartate:5-guanidino-3-methyl-2-oxopentanoate transaminase Pseudomonas syringae pv. syringae
A7GDQ6 8.4e-08 57 26 13 267 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
Q24QJ1 9.57e-08 57 25 6 163 3 hisC Histidinol-phosphate aminotransferase Desulfitobacterium hafniense (strain Y51)
A5I245 9.87e-08 57 26 13 267 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FU81 9.87e-08 57 26 13 267 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain ATCC 19397 / Type A)
Q46Y48 1.02e-07 57 28 6 158 3 hisC1 Histidinol-phosphate aminotransferase 1 Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P34037 1.14e-07 57 28 7 188 1 hisC Histidinol-phosphate aminotransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q1GET3 1.24e-07 57 28 6 170 3 hisC Histidinol-phosphate aminotransferase Ruegeria sp. (strain TM1040)
Q6D410 1.29e-07 56 29 6 164 3 hisC Histidinol-phosphate aminotransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5V4K3 1.48e-07 56 25 4 175 3 hisC Histidinol-phosphate aminotransferase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
O07131 1.48e-07 56 26 6 160 3 hisC Histidinol-phosphate aminotransferase Methylobacillus flagellatus
Q88P86 1.51e-07 56 25 8 224 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q82XE0 1.92e-07 56 26 7 200 3 hisC2 Histidinol-phosphate aminotransferase 2 Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B2UPR9 1.93e-07 56 25 3 158 3 hisC Histidinol-phosphate aminotransferase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q88UE6 1.97e-07 56 27 3 157 3 hisC Histidinol-phosphate aminotransferase Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q2N7G6 2.17e-07 56 26 8 231 3 hisC Histidinol-phosphate aminotransferase Erythrobacter litoralis (strain HTCC2594)
A5VZ57 2.34e-07 55 25 8 224 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P60999 2.37e-07 55 24 17 361 3 hisC Histidinol-phosphate aminotransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q63DL4 2.4e-07 55 23 7 239 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ZK / E33L)
Q10DK7 2.42e-07 56 23 7 204 2 ACS1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. japonica
A2XLL2 2.42e-07 56 23 7 204 2 ACC1 1-aminocyclopropane-1-carboxylate synthase 1 Oryza sativa subsp. indica
B3DXN2 2.52e-07 55 25 10 256 3 hisC Histidinol-phosphate aminotransferase Methylacidiphilum infernorum (isolate V4)
Q8KD01 2.54e-07 55 28 5 167 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A5UKY0 2.71e-07 55 26 5 152 3 hisC Histidinol-phosphate aminotransferase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q492K2 2.86e-07 55 25 7 162 3 hisC Histidinol-phosphate aminotransferase Blochmanniella pennsylvanica (strain BPEN)
Q92MG0 3.01e-07 55 25 2 156 3 hisC1 Histidinol-phosphate aminotransferase 1 Rhizobium meliloti (strain 1021)
Q46E46 3.18e-07 55 26 5 167 3 hisC Histidinol-phosphate aminotransferase Methanosarcina barkeri (strain Fusaro / DSM 804)
Q2NFU1 3.31e-07 55 24 7 213 3 dapL LL-diaminopimelate aminotransferase Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
A4SE60 3.53e-07 55 28 13 241 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
Q2W047 3.54e-07 55 24 7 219 3 hisC Histidinol-phosphate aminotransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q42881 3.83e-07 55 21 14 383 1 ACS3 1-aminocyclopropane-1-carboxylate synthase 3 Solanum lycopersicum
B1JBC0 3.84e-07 55 25 8 224 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain W619)
Q4ZNW0 3.97e-07 55 23 17 354 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. syringae (strain B728a)
C0ZM44 4.16e-07 55 28 3 159 3 pat Putative phenylalanine aminotransferase Rhodococcus erythropolis (strain PR4 / NBRC 100887)
B3QP11 4.38e-07 55 28 6 165 3 hisC Histidinol-phosphate aminotransferase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
Q92L21 5.03e-07 55 27 12 240 3 hisC2 Histidinol-phosphate aminotransferase 2 Rhizobium meliloti (strain 1021)
B1ILA9 5.41e-07 54 25 12 243 3 hisC Histidinol-phosphate aminotransferase Clostridium botulinum (strain Okra / Type B1)
Q64HC5 5.61e-07 54 22 4 189 1 metC Cysteine-S-conjugate beta-lyase Corynebacterium striatum
B3ECG2 5.63e-07 54 26 6 165 3 hisC Histidinol-phosphate aminotransferase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q8TUE9 6.51e-07 54 26 4 157 3 hisC Histidinol-phosphate aminotransferase Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8U9W3 6.77e-07 54 21 4 185 3 hisC Histidinol-phosphate aminotransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
A7ICA9 7.04e-07 54 27 9 227 3 hisC Histidinol-phosphate aminotransferase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q0BVW4 7.12e-07 54 23 6 221 3 hisC Histidinol-phosphate aminotransferase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q89UL9 7.81e-07 54 26 9 231 3 hisC2 Histidinol-phosphate aminotransferase 2 Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q87WV6 7.84e-07 54 23 16 350 3 hisC Histidinol-phosphate aminotransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q10VS0 7.99e-07 54 24 15 304 3 hisC Histidinol-phosphate aminotransferase Trichodesmium erythraeum (strain IMS101)
Q6AQK2 9.29e-07 54 26 8 214 3 hisC Histidinol-phosphate aminotransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
A1BGB4 1.06e-06 53 25 4 172 3 hisC Histidinol-phosphate aminotransferase Chlorobium phaeobacteroides (strain DSM 266 / SMG 266 / 2430)
Q81SV5 1.08e-06 53 23 7 239 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus anthracis
Q1GP30 1.11e-06 53 24 7 229 3 hisC Histidinol-phosphate aminotransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q987C8 1.19e-06 53 23 4 171 3 hisC1 Histidinol-phosphate aminotransferase 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6HL37 1.38e-06 53 22 6 239 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q48ED0 1.38e-06 53 23 17 354 3 hisC Histidinol-phosphate aminotransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
P39389 1.39e-06 53 24 4 198 3 yjiR Uncharacterized HTH-type transcriptional regulator YjiR Escherichia coli (strain K12)
A5CZ78 1.44e-06 53 24 13 232 3 hisC Histidinol-phosphate aminotransferase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A5FR29 1.47e-06 53 22 6 222 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
A1R558 1.47e-06 53 24 4 163 3 hisC Histidinol-phosphate aminotransferase Paenarthrobacter aurescens (strain TC1)
Q2GAI1 1.5e-06 53 27 4 157 3 hisC Histidinol-phosphate aminotransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
A7MJP4 1.51e-06 53 26 7 179 3 hisC Histidinol-phosphate aminotransferase Cronobacter sakazakii (strain ATCC BAA-894)
Q163G3 1.54e-06 53 24 13 306 3 hisC Histidinol-phosphate aminotransferase Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q3ZXL8 1.56e-06 53 22 6 222 3 hisC Histidinol-phosphate aminotransferase Dehalococcoides mccartyi (strain CBDB1)
Q06429 1.63e-06 53 20 11 351 1 ACS1 1-aminocyclopropane-1-carboxylate synthase-like protein 1 Arabidopsis thaliana
C6DF75 1.64e-06 53 28 6 161 3 hisC Histidinol-phosphate aminotransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P45358 1.68e-06 53 27 12 226 3 hisC Histidinol-phosphate aminotransferase Acetobacter pasteurianus
Q3A7R3 1.69e-06 53 22 9 224 3 hisC Histidinol-phosphate aminotransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
P60998 1.7e-06 53 28 4 159 3 hisC Histidinol-phosphate aminotransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q9HZ68 1.75e-06 53 27 10 240 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8YJK3 1.77e-06 53 22 4 185 3 hisC Histidinol-phosphate aminotransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A7GN55 1.86e-06 53 24 3 185 3 hisC Histidinol-phosphate aminotransferase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9HQS0 1.88e-06 53 21 10 319 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R4Q4 1.88e-06 53 21 10 319 3 hisC Histidinol-phosphate aminotransferase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q4KI72 2.06e-06 53 26 9 227 3 hisC1 Histidinol-phosphate aminotransferase 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2IS68 2.49e-06 52 25 8 230 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain HaA2)
Q3MAX6 2.52e-06 52 21 11 289 3 hisC2 Histidinol-phosphate aminotransferase 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
B6YRL2 2.8e-06 52 22 6 193 3 dapL LL-diaminopimelate aminotransferase Azobacteroides pseudotrichonymphae genomovar. CFP2
Q5E9N4 2.81e-06 52 26 4 173 2 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Bos taurus
Q8FY98 2.89e-06 52 22 4 185 3 hisC Histidinol-phosphate aminotransferase Brucella suis biovar 1 (strain 1330)
A5VSV7 2.89e-06 52 22 4 185 3 hisC Histidinol-phosphate aminotransferase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q57AR7 2.89e-06 52 22 4 185 3 hisC Histidinol-phosphate aminotransferase Brucella abortus biovar 1 (strain 9-941)
Q2YR81 2.89e-06 52 22 4 185 3 hisC Histidinol-phosphate aminotransferase Brucella abortus (strain 2308)
Q73AX7 3.01e-06 52 22 6 239 3 hisC1 Histidinol-phosphate aminotransferase 1 Bacillus cereus (strain ATCC 10987 / NRS 248)
P97084 3.02e-06 52 22 8 269 1 cobD Threonine-phosphate decarboxylase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q20YH9 3.52e-06 52 25 8 230 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB18)
A1A2H6 3.54e-06 52 22 6 224 3 hisC Histidinol-phosphate aminotransferase Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q3S8P9 3.55e-06 52 25 8 237 3 oxyQ 4-dedimethylamino-4-oxo-anhydrotetracycline transaminase OxyQ Streptomyces rimosus
A5FVN2 3.77e-06 52 27 6 159 3 hisC Histidinol-phosphate aminotransferase Acidiphilium cryptum (strain JF-5)
Q03VY3 4.07e-06 52 24 2 158 3 hisC Histidinol-phosphate aminotransferase Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B2IDA4 4.43e-06 52 24 2 154 3 hisC Histidinol-phosphate aminotransferase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q5WGR9 4.69e-06 52 23 2 154 3 hisC Histidinol-phosphate aminotransferase Shouchella clausii (strain KSM-K16)
Q608S3 4.89e-06 52 25 10 230 3 hisC2 Histidinol-phosphate aminotransferase 2 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
P55683 5.16e-06 52 26 8 210 3 hisC Histidinol-phosphate aminotransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A1JTV9 5.34e-06 52 25 12 268 3 hisC Histidinol-phosphate aminotransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B0KQJ6 5.46e-06 51 26 9 225 3 hisC Histidinol-phosphate aminotransferase Pseudomonas putida (strain GB-1)
A8FEJ6 5.95e-06 51 24 8 236 3 hisC Histidinol-phosphate aminotransferase Bacillus pumilus (strain SAFR-032)
A0A1U9YHZ6 6.2e-06 51 18 10 362 2 verI Aminotransferase verI Clonostachys rogersoniana
A8GC78 7.05e-06 51 25 12 271 3 hisC Histidinol-phosphate aminotransferase Serratia proteamaculans (strain 568)
Q5P791 7.38e-06 51 28 5 163 3 hisC Histidinol-phosphate aminotransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q3B3L3 7.6e-06 51 24 7 214 3 hisC Histidinol-phosphate aminotransferase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
C1B997 7.62e-06 51 25 3 159 3 pat Putative phenylalanine aminotransferase Rhodococcus opacus (strain B4)
Q8TVG3 7.72e-06 51 23 3 155 3 hisC Histidinol-phosphate aminotransferase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q609W4 7.8e-06 51 28 8 178 3 hisC1 Histidinol-phosphate aminotransferase 1 Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2UPB9 8.04e-06 51 24 6 198 3 aclI Probable aminotransferase aclI Aspergillus oryzae (strain ATCC 42149 / RIB 40)
P17736 8.71e-06 51 25 5 174 3 hisC Histidinol-phosphate aminotransferase Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
A0PXP5 8.74e-06 51 24 5 161 3 hisC Histidinol-phosphate aminotransferase Clostridium novyi (strain NT)
B2GBR8 8.86e-06 51 26 3 161 3 hisC Histidinol-phosphate aminotransferase Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
Q4JW58 1.16e-05 50 25 8 224 3 hisC Histidinol-phosphate aminotransferase Corynebacterium jeikeium (strain K411)
P77730 1.2e-05 50 22 7 268 3 ydcR Uncharacterized HTH-type transcriptional regulator YdcR Escherichia coli (strain K12)
Q0C348 1.23e-05 50 27 4 162 3 hisC Histidinol-phosphate aminotransferase Hyphomonas neptunium (strain ATCC 15444)
B1N009 1.25e-05 50 22 4 217 3 hisC Histidinol-phosphate aminotransferase Leuconostoc citreum (strain KM20)
Q07IG8 1.29e-05 50 23 10 276 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisA53)
B5XPE6 1.33e-05 50 22 12 283 3 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae (strain 342)
A9KJ19 1.47e-05 50 23 7 203 3 dapL LL-diaminopimelate aminotransferase Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q8N5Z0 1.55e-05 50 25 4 173 1 AADAT Kynurenine/alpha-aminoadipate aminotransferase, mitochondrial Homo sapiens
Q8EQB9 1.58e-05 50 22 5 217 3 hisC2 Histidinol-phosphate aminotransferase 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q2NTX2 1.8e-05 50 26 6 161 3 hisC Histidinol-phosphate aminotransferase Sodalis glossinidius (strain morsitans)
B4SGL8 1.81e-05 50 26 5 161 3 hisC Histidinol-phosphate aminotransferase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A7Z614 1.87e-05 50 23 6 230 3 hisC Histidinol-phosphate aminotransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q11DR9 1.89e-05 50 23 2 156 3 hisC Histidinol-phosphate aminotransferase Chelativorans sp. (strain BNC1)
A6GY79 1.99e-05 50 25 4 154 3 hisC Histidinol-phosphate aminotransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
B6IYQ0 2.09e-05 50 25 2 150 3 hisC Histidinol-phosphate aminotransferase Rhodospirillum centenum (strain ATCC 51521 / SW)
Q7UNC3 2.09e-05 50 25 4 162 3 hisC Histidinol-phosphate aminotransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B4S8L6 2.1e-05 50 23 16 298 3 hisC Histidinol-phosphate aminotransferase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
C0ZCE7 2.15e-05 50 20 2 154 3 hisC Histidinol-phosphate aminotransferase Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
Q8Z8H8 2.19e-05 49 21 8 269 3 cobD Threonine-phosphate decarboxylase Salmonella typhi
P61001 2.43e-05 49 23 8 221 3 hisC Histidinol-phosphate aminotransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHI1 2.48e-05 49 23 8 221 3 hisC Histidinol-phosphate aminotransferase Mycobacterium avium (strain 104)
B8D707 2.53e-05 49 22 11 253 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D8Q3 2.53e-05 49 22 11 253 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57202 2.55e-05 49 22 11 253 3 hisC Histidinol-phosphate aminotransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P23256 2.64e-05 49 19 9 302 1 malY Protein MalY Escherichia coli (strain K12)
Q4K8N0 2.66e-05 49 26 10 238 3 hisC2 Histidinol-phosphate aminotransferase 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q7N6I1 2.84e-05 50 28 6 159 3 hisCD Putative histidine biosynthesis bifunctional protein HisCD Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7VQW9 3.01e-05 49 24 8 165 3 hisC Histidinol-phosphate aminotransferase Blochmanniella floridana
Q9KCA8 3.17e-05 49 23 2 160 3 hisC Histidinol-phosphate aminotransferase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8KZ92 3.26e-05 49 24 9 233 3 hisC Histidinol-phosphate aminotransferase Bacillus subtilis subsp. natto
Q31I36 3.38e-05 49 25 13 248 3 hisC1 Histidinol-phosphate aminotransferase 1 Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q7DBF3 3.57e-05 49 25 3 139 1 perA GDP-perosamine synthase Escherichia coli O157:H7
B0SMK7 3.69e-05 49 25 9 241 3 dapL LL-diaminopimelate aminotransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SEH8 3.69e-05 49 25 9 241 3 dapL LL-diaminopimelate aminotransferase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
Q9CLM3 4.27e-05 48 24 11 285 3 hisC1 Histidinol-phosphate aminotransferase 1 Pasteurella multocida (strain Pm70)
Q98B00 4.64e-05 48 26 9 217 3 hisC3 Histidinol-phosphate aminotransferase 3 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
B4T9N5 4.73e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella heidelberg (strain SL476)
A4IQ80 4.84e-05 48 23 3 153 3 hisC Histidinol-phosphate aminotransferase Geobacillus thermodenitrificans (strain NG80-2)
B5FM42 4.9e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella dublin (strain CT_02021853)
P10369 4.94e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5WX92 5.28e-05 48 24 3 143 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Lens)
B4TMR6 5.31e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella schwarzengrund (strain CVM19633)
B5RBR3 5.31e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QZL3 5.31e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella enteritidis PT4 (strain P125109)
B5EX40 5.31e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella agona (strain SL483)
C0Q1K1 5.35e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella paratyphi C (strain RKS4594)
Q57MS2 5.5e-05 48 27 8 179 3 hisC Histidinol-phosphate aminotransferase Salmonella choleraesuis (strain SC-B67)
Q5X5X0 5.62e-05 48 24 3 143 3 hisC1 Histidinol-phosphate aminotransferase 1 Legionella pneumophila (strain Paris)
Q930J0 5.65e-05 48 24 3 165 3 hisC3 Histidinol-phosphate aminotransferase 3 Rhizobium meliloti (strain 1021)
Q131B9 5.94e-05 48 24 8 230 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain BisB5)
A2RKS5 6.02e-05 48 27 9 190 3 hisC Histidinol-phosphate aminotransferase Lactococcus lactis subsp. cremoris (strain MG1363)
B9DK21 6.78e-05 48 22 2 163 3 hisC Histidinol-phosphate aminotransferase Staphylococcus carnosus (strain TM300)
A6TBC4 7.26e-05 48 24 8 181 1 hisC Histidinol-phosphate aminotransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B3Q8Z5 7.75e-05 48 23 8 230 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain TIE-1)
P61002 7.75e-05 48 23 8 230 3 hisC Histidinol-phosphate aminotransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q2JPM4 8.07e-05 48 21 9 244 3 hisC Histidinol-phosphate aminotransferase Synechococcus sp. (strain JA-2-3B'a(2-13))

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_08430
Feature type CDS
Gene aspB
Product Aspartate/methionine/tyrosine aminotransferase
Location 83806 - 85020 (strand: -1)
Length 1215 (nucleotides) / 404 (amino acids)

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1900
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00155 Aminotransferase class I and II

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0436 Amino acid transport and metabolism (E) E Aspartate/methionine/tyrosine aminotransferase

Kegg Ortholog Annotation(s)

Protein Sequence

MNIIKKSSKLDNVCYDIRGPVLKEAKRLEEEGQKVLKLNIGNPAPFGFDAPDEILVDVIRNLPSSQGYSDSKGLYSARKAIVQFYQERGMRDMTVEDVYIGNGVSELIVQSMQALLNNGDEMLVPAPDYPLWTGAVSLSGGTAVHYMCDEEQGWMPDIEDIKKKITPRTRGIVVINPNNPTGAVYSKDLLQEIVELARQNDLIIFADEIYDKILYDDAVHHSIAAMAPDLLTVTFNGLSKTYRIAGFRQGWMVLNGPKKHAKGYIEGLEMLASMRLCANVPMQHAIQTAIGGYQSINEFIHPGGRLYEQRNKAWELINQIPGCSCVKPMGALYMFPKFDAKRFNIHDDQKMILDLLLQEKVLLVQGTAFNWPEPNHFRIVTLPREDDLEMAINRFGRFLSHYRQ

Flanking regions ( +/- flanking 50bp)

CGGGTTTTACCTGATAAAATATAAGATTAACGCGCTAAGGTCCTGAACAGATGAATATAATAAAGAAATCCAGCAAACTCGATAATGTCTGTTACGACATTCGCGGGCCGGTGCTCAAAGAGGCTAAACGTCTCGAAGAGGAAGGCCAGAAAGTTCTCAAACTGAATATCGGTAACCCGGCGCCGTTTGGTTTTGATGCCCCGGACGAAATTCTGGTTGATGTTATCCGTAATTTACCAAGCTCCCAGGGTTACAGCGATTCAAAAGGCCTCTATTCCGCCCGTAAAGCCATTGTCCAGTTCTACCAGGAACGCGGCATGCGCGATATGACGGTGGAAGATGTCTATATCGGTAACGGGGTTTCTGAACTGATTGTGCAGTCCATGCAGGCGCTGCTGAATAACGGTGATGAAATGCTGGTACCGGCACCGGATTACCCGTTATGGACCGGTGCGGTCTCCCTCTCCGGCGGTACTGCCGTCCACTATATGTGCGACGAAGAACAGGGCTGGATGCCGGACATTGAGGACATCAAAAAGAAAATCACCCCGCGCACCCGCGGTATTGTGGTGATTAACCCGAACAACCCGACCGGGGCTGTTTACAGCAAAGATTTGTTACAGGAGATTGTCGAACTCGCCCGTCAGAATGACCTGATCATTTTTGCTGACGAAATCTACGACAAAATTCTGTATGACGATGCTGTCCACCACTCTATCGCCGCGATGGCGCCGGATCTGCTGACCGTCACCTTCAACGGCCTGTCAAAAACCTACCGTATCGCCGGTTTCCGCCAGGGCTGGATGGTCCTGAACGGGCCGAAGAAACACGCCAAAGGGTATATTGAAGGGCTGGAAATGCTCGCGTCCATGCGTCTGTGTGCCAACGTGCCGATGCAGCATGCTATCCAGACCGCAATCGGCGGGTACCAGAGCATCAATGAGTTTATTCATCCGGGCGGCCGCCTGTATGAACAGCGCAACAAAGCCTGGGAACTGATTAACCAGATACCGGGCTGCTCCTGTGTCAAACCGATGGGCGCACTCTATATGTTCCCGAAATTTGATGCCAAGCGCTTTAATATTCACGATGATCAGAAGATGATCCTCGACCTGCTGTTACAGGAAAAAGTGCTGCTGGTACAGGGTACTGCCTTTAACTGGCCGGAACCGAACCACTTCCGTATCGTGACACTGCCGCGTGAGGATGACCTGGAGATGGCGATTAACCGCTTCGGGCGTTTCCTCTCCCACTACCGTCAGTAATCGTTTCTGCTGTCAGCGGCTTCCCCCGGGAAGCCGTTTTTATTTACATC