Homologs in group_2618

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03165 FBDBKF_03165 100.0 Morganella morganii S1 tauB ABC-type taurine transport system, ATPase component
EHELCC_07370 EHELCC_07370 100.0 Morganella morganii S2 tauB ABC-type taurine transport system, ATPase component
LHKJJB_07230 LHKJJB_07230 100.0 Morganella morganii S3 tauB ABC-type taurine transport system, ATPase component
HKOGLL_03700 HKOGLL_03700 100.0 Morganella morganii S5 tauB ABC-type taurine transport system, ATPase component
F4V73_RS11755 F4V73_RS11755 79.0 Morganella psychrotolerans - ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_2618

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2618

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q98DW6 4.88e-82 249 46 0 252 3 tauB Taurine import ATP-binding protein TauB Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q87UH7 4.55e-81 247 48 0 257 3 tauB Taurine import ATP-binding protein TauB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q471U2 1.54e-79 243 47 2 256 3 tauB Taurine import ATP-binding protein TauB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q8KZR4 1.73e-79 243 47 0 256 3 tauB Taurine import ATP-binding protein TauB Pseudomonas putida
Q1IGM2 2.06e-79 243 46 0 256 3 tauB Taurine import ATP-binding protein TauB Pseudomonas entomophila (strain L48)
Q0K2U3 1.25e-78 241 46 1 256 3 tauB Taurine import ATP-binding protein TauB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q88RA1 2.67e-78 240 46 0 256 3 tauB Taurine import ATP-binding protein TauB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q02SA6 2.25e-77 238 46 1 254 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q48C94 3.49e-77 237 48 0 245 3 tauB Taurine import ATP-binding protein TauB Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q3KJQ7 5.49e-77 236 47 0 253 3 tauB Taurine import ATP-binding protein TauB Pseudomonas fluorescens (strain Pf0-1)
Q13IS7 1.43e-76 236 46 0 251 3 tauB3 Taurine import ATP-binding protein TauB 3 Paraburkholderia xenovorans (strain LB400)
Q7NU46 4.27e-76 234 46 0 256 3 tauB Taurine import ATP-binding protein TauB Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9HX79 4.7e-76 234 45 1 254 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2T751 1.32e-75 233 43 1 254 3 tauB Taurine import ATP-binding protein TauB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q146E7 1.66e-75 233 44 1 255 3 tauB1 Taurine import ATP-binding protein TauB 1 Paraburkholderia xenovorans (strain LB400)
Q3JKX3 2.31e-75 232 43 1 254 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain 1710b)
Q62AW4 2.31e-75 232 43 1 254 3 tauB Taurine import ATP-binding protein TauB Burkholderia mallei (strain ATCC 23344)
Q4KK16 2.38e-75 233 46 0 253 3 tauB Taurine import ATP-binding protein TauB Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q63JZ3 3e-75 232 43 1 254 3 tauB Taurine import ATP-binding protein TauB Burkholderia pseudomallei (strain K96243)
Q664P8 6.66e-75 231 45 1 240 3 tauB Taurine import ATP-binding protein TauB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CCR9 6.96e-75 231 45 1 240 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZJD0 6.96e-75 231 45 1 240 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis
Q1C2S1 6.96e-75 231 45 1 240 3 tauB Taurine import ATP-binding protein TauB Yersinia pestis bv. Antiqua (strain Antiqua)
Q1RFH8 1.92e-74 230 47 1 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain UTI89 / UPEC)
Q0TKS1 1.92e-74 230 47 1 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8X5I6 1.96e-74 230 47 1 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q39CJ6 5.22e-74 229 45 2 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BT84 8.89e-74 228 45 2 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia orbicola (strain AU 1054)
A0KAV6 8.89e-74 228 45 2 251 3 tauB Taurine import ATP-binding protein TauB Burkholderia cenocepacia (strain HI2424)
Q8FKF5 1.08e-73 228 47 1 240 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1M7R4 1.32e-73 228 46 0 234 3 tauB Taurine import ATP-binding protein TauB Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q3Z542 2.61e-73 227 47 1 240 3 tauB Taurine import ATP-binding protein TauB Shigella sonnei (strain Ss046)
Q47538 2.61e-73 227 47 1 240 2 tauB Taurine import ATP-binding protein TauB Escherichia coli (strain K12)
Q325N3 2.97e-73 227 47 1 240 3 tauB Taurine import ATP-binding protein TauB Shigella boydii serotype 4 (strain Sb227)
Q2K164 3.26e-73 227 46 0 233 3 tauB Taurine import ATP-binding protein TauB Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6W2B1 8.16e-73 226 44 1 258 3 tauB Taurine import ATP-binding protein TauB Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q83MA0 2e-72 224 46 1 240 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri
Q32IZ6 1.63e-71 222 46 1 240 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q0T7M2 2.31e-71 222 46 1 240 3 tauB Taurine import ATP-binding protein TauB Shigella flexneri serotype 5b (strain 8401)
Q13KX9 2.47e-71 223 45 1 249 3 tauB2 Taurine import ATP-binding protein TauB 2 Paraburkholderia xenovorans (strain LB400)
Q6RH47 1.66e-70 220 43 1 260 3 tauB Taurine import ATP-binding protein TauB Paracoccus pantotrophus
Q92UX0 2.67e-69 217 45 1 251 3 tauB Taurine import ATP-binding protein TauB Rhizobium meliloti (strain 1021)
Q4FMG5 2.5e-66 209 44 2 250 3 tauB Taurine import ATP-binding protein TauB Pelagibacter ubique (strain HTCC1062)
Q28K97 2.01e-63 202 43 2 250 3 tauB Taurine import ATP-binding protein TauB Jannaschia sp. (strain CCS1)
Q16BJ3 6.63e-61 196 41 2 254 3 tauB Taurine import ATP-binding protein TauB Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q5LVM5 7.27e-60 193 40 2 250 3 tauB Taurine import ATP-binding protein TauB Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5MZ53 1.1e-59 193 39 5 252 3 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55108 1.1e-59 193 39 5 252 1 cmpD Bicarbonate transport ATP-binding protein CmpD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55463 5.21e-56 184 37 5 256 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P38046 5.97e-54 178 38 4 232 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q57855 9.34e-54 177 40 0 201 3 MJ0412 Uncharacterized ABC transporter ATP-binding protein MJ0412 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q55462 2.13e-51 180 37 4 261 2 cmpC Bicarbonate transport ATP-binding protein CmpC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P73265 2.04e-50 169 36 2 235 3 nrtD Nitrate import ATP-binding protein NrtD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5MZ54 1.22e-49 176 41 2 218 3 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55107 1.22e-49 176 41 2 218 1 cmpC Bicarbonate transport ATP-binding protein CmpC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P39459 6.83e-48 162 38 1 198 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
Q8FUN3 1.47e-46 159 40 1 210 3 BRA1187 Putative ATP-binding protein BRA1187/BS1330_II1178 Brucella suis biovar 1 (strain 1330)
Q2YJB5 1.47e-46 159 40 1 210 3 BAB2_1147 Putative ATP-binding protein BAB2_1147 Brucella abortus (strain 2308)
Q576E0 8.84e-46 157 40 1 210 3 BruAb2_1123 Putative ATP-binding protein BruAb2_1123 Brucella abortus biovar 1 (strain 9-941)
A3DDF6 1.76e-43 153 44 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q18AM3 5.11e-43 152 42 3 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
P73450 9.56e-43 157 37 2 215 3 nrtC Nitrate import ATP-binding protein NrtC Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94360 1.68e-42 151 41 2 209 1 msmX Oligosaccharides import ATP-binding protein MsmX Bacillus subtilis (strain 168)
P97027 2.74e-42 147 37 1 203 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus subtilis (strain 168)
Q65M64 3.78e-42 147 36 1 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P38045 1.33e-41 154 35 4 251 1 nrtC Nitrate import ATP-binding protein NrtC Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8ELR4 3.74e-41 147 42 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
O51587 5.56e-41 147 38 2 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q660M8 5.68e-41 147 38 2 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q0SML1 8.14e-41 146 38 2 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella afzelii (strain PKo)
Q1BG75 1.53e-40 143 37 2 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 1.53e-40 143 37 2 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q0BUR6 1.81e-40 142 41 3 188 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q4ZQE3 5.1e-40 142 39 4 211 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q1GIE5 5.52e-40 144 41 2 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria sp. (strain TM1040)
Q830W6 6.36e-40 144 40 4 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Enterococcus faecalis (strain ATCC 700802 / V583)
A0AGP9 9.78e-40 144 41 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q81C68 9.98e-40 140 37 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2SJY7 1.01e-39 144 40 1 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Hahella chejuensis (strain KCTC 2396)
Q8Y8T6 1.09e-39 144 41 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q64SQ6 1.15e-39 145 42 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q5LBT4 1.26e-39 145 42 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q0SRL2 1.43e-39 143 43 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q8DZJ0 1.45e-39 144 39 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.45e-39 144 39 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.45e-39 144 39 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q39LW7 1.7e-39 141 37 2 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q48FT0 1.78e-39 140 39 3 198 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q14Q07 1.81e-39 143 42 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q63A38 2.59e-39 140 36 1 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ZK / E33L)
Q92DL6 2.61e-39 143 41 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q736E0 2.82e-39 139 34 2 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RFA4 2.91e-39 139 37 1 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis (strain Al Hakam)
Q722B1 3.29e-39 142 41 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
P77481 3.99e-39 142 39 2 209 5 ycjV Putative uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain K12)
Q8X8K4 4.03e-39 142 39 2 209 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O157:H7
Q8XIZ5 4.13e-39 142 43 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 4.13e-39 142 43 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q81P94 6.43e-39 139 37 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus anthracis
Q6HHI7 7.15e-39 139 37 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q74K65 8.24e-39 141 42 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8FHR3 9.88e-39 141 38 2 209 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TI47 1.01e-38 141 38 2 209 3 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1RC47 1.52e-38 140 38 2 209 4 ycjV Uncharacterized ABC transporter ATP-binding protein YcjV Escherichia coli (strain UTI89 / UPEC)
Q8A883 1.53e-38 142 42 2 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8YDR7 2.29e-38 137 38 3 210 3 BMEII0108 Putative ATP-binding protein BMEII0108 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5WBL0 2.45e-38 137 39 4 191 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q65UE1 2.62e-38 140 41 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q110U3 3.26e-38 140 40 4 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q6F0V4 3.34e-38 139 40 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q042G7 3.42e-38 140 42 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q88ZJ6 3.67e-38 140 40 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q1J6Q6 4.58e-38 140 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JGY7 4.58e-38 140 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JLT7 4.58e-38 140 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JBV6 4.58e-38 140 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q5WCI1 5.06e-38 136 32 3 238 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q21XJ9 5.09e-38 137 35 3 243 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q2SVN0 5.21e-38 139 37 4 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q5XCA4 5.31e-38 140 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ35 5.71e-38 139 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48TP4 5.71e-38 139 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q7CN92 5.71e-38 139 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0CZ34 5.71e-38 139 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q99ZS8 5.71e-38 139 38 2 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pyogenes serotype M1
Q1IGL4 5.75e-38 137 38 2 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q97KS6 6.69e-38 139 40 2 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9I6L0 7.13e-38 138 41 3 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q885N4 1.01e-37 136 38 3 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q24XJ2 1.14e-37 138 43 5 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Desulfitobacterium hafniense (strain Y51)
Q5LYN4 1.29e-37 139 38 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain CNRZ 1066)
Q5M397 1.31e-37 139 38 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q03JH1 1.38e-37 139 38 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q03AH0 1.62e-37 138 40 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8CPN0 1.8e-37 138 42 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5L222 1.84e-37 137 37 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q63TW1 1.97e-37 137 37 4 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q9CP06 2e-37 138 41 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Pasteurella multocida (strain Pm70)
Q62K56 2.62e-37 137 37 4 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q8DPC2 2.86e-37 138 39 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97Q42 2.86e-37 138 39 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04JW0 2.86e-37 138 39 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q3JSR6 3.04e-37 137 37 4 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
O32151 3.06e-37 137 35 2 209 3 yurJ Uncharacterized ABC transporter ATP-binding protein YurJ Bacillus subtilis (strain 168)
Q38VW6 3.21e-37 137 42 3 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Latilactobacillus sakei subsp. sakei (strain 23K)
A0PY57 3.26e-37 137 41 6 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q9JUX4 3.37e-37 137 40 3 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8DUF7 3.39e-37 137 39 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5HQ70 3.49e-37 137 42 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6CYU2 4.12e-37 134 37 2 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3K506 4.52e-37 134 38 2 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q5NN23 4.9e-37 134 37 3 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q2L0H5 4.9e-37 137 38 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella avium (strain 197N)
Q03PF2 5.43e-37 137 42 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q8KZQ6 5.93e-37 134 36 3 207 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q88CL2 6.36e-37 135 39 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P9WQM1 6.94e-37 136 41 3 196 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 6.94e-37 136 41 3 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 6.94e-37 136 41 3 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P31134 7.25e-37 136 40 3 204 1 potG Putrescine transport ATP-binding protein PotG Escherichia coli (strain K12)
Q8XZQ4 8.77e-37 134 39 1 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A3CMQ7 1.28e-36 136 38 1 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q49WM4 1.3e-36 135 41 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q88R93 1.38e-36 133 37 2 189 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1WVI7 1.41e-36 135 42 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Ligilactobacillus salivarius (strain UCC118)
Q65T42 1.58e-36 135 37 5 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q3M5J9 1.64e-36 132 36 2 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q82MV1 1.74e-36 132 38 4 191 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9JZW0 1.81e-36 135 40 3 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0BFQ0 1.86e-36 134 36 4 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1LNM0 2e-36 133 35 4 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0TJC1 2.35e-36 132 36 2 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q9KS33 2.6e-36 135 37 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1TXH7 2.74e-36 135 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q1LLP5 3.02e-36 135 37 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1QE80 3.04e-36 135 43 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q32EY4 3.04e-36 135 40 3 199 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella dysenteriae serotype 1 (strain Sd197)
Q1BWL4 3.12e-36 134 36 4 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 3.12e-36 134 36 4 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
Q5FL41 3.19e-36 134 42 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q2SSS4 3.22e-36 134 39 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
P45171 3.42e-36 135 37 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4K441 3.84e-36 132 38 2 189 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9HYG4 4.83e-36 132 37 2 189 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q13ZK7 4.91e-36 134 36 5 206 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
O34314 5.15e-36 131 34 1 211 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q6MU19 5.23e-36 134 39 3 204 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q02QT1 5.98e-36 132 36 1 189 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q89WG0 6.7e-36 134 37 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5LT05 7.68e-36 134 39 3 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q0I3Y9 8.33e-36 134 39 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Histophilus somni (strain 129Pt)
Q1RDS4 8.45e-36 130 36 2 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 8.45e-36 130 36 2 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q0T5R2 8.83e-36 134 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri serotype 5b (strain 8401)
Q6D4E2 1.01e-35 134 42 3 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q3KBH4 1.02e-35 133 35 4 243 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain Pf0-1)
P40790 1.07e-35 133 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57QC8 1.07e-35 133 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella choleraesuis (strain SC-B67)
Q5YRK2 1.07e-35 130 37 4 191 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Nocardia farcinica (strain IFM 10152)
Q5PMK1 1.09e-35 133 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q0SK28 1.11e-35 130 39 4 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q3Z2Z3 1.17e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella sonnei (strain Ss046)
Q31ZK0 1.17e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella boydii serotype 4 (strain Sb227)
P74548 1.22e-35 133 40 1 192 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q5E586 1.23e-35 133 39 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8Z7H7 1.23e-35 133 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Salmonella typhi
P56344 1.28e-35 130 40 7 215 3 cysA Probable sulfate/thiosulfate import ATP-binding protein CysA Chlorella vulgaris
P69877 1.52e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Shigella flexneri
P69874 1.52e-35 133 41 3 193 1 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain K12)
P69875 1.52e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIU8 1.52e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P69876 1.52e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O157:H7
Q1RD28 1.57e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli (strain UTI89 / UPEC)
A1AA20 1.57e-35 133 41 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Escherichia coli O1:K1 / APEC
Q04G50 1.75e-35 132 40 4 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q4QK57 1.88e-35 132 37 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q5X627 2.18e-35 132 40 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q46ZU5 2.2e-35 131 39 3 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1B9Q7 2.24e-35 132 39 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paracoccus denitrificans (strain Pd 1222)
Q1MQ44 2.25e-35 132 38 3 206 3 potA Spermidine/putrescine import ATP-binding protein PotA Lawsonia intracellularis (strain PHE/MN1-00)
Q5PFQ7 2.34e-35 132 40 4 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q04BG2 2.38e-35 132 40 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q8Z8W8 2.47e-35 132 40 4 207 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhi
Q8FJ95 2.73e-35 129 36 2 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q6LR20 2.75e-35 132 40 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q39GW5 2.81e-35 131 37 3 189 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q48CA0 2.88e-35 130 37 2 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7VNG4 2.9e-35 132 38 1 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
O85818 3.42e-35 132 37 4 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Aggregatibacter actinomycetemcomitans
Q81GU1 3.5e-35 132 39 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5ZWE4 3.52e-35 132 39 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q0K9I2 3.78e-35 130 35 3 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q4L5B3 4.98e-35 131 40 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q4ZLS1 5.51e-35 129 37 2 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q0AGF4 5.66e-35 131 38 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q87UI3 6.47e-35 129 38 2 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q13ER6 6.6e-35 131 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB5)
P14788 6.7e-35 130 40 2 186 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q6NDQ0 6.83e-35 131 37 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q609Q1 7.72e-35 130 40 3 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q82TL6 7.86e-35 131 39 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q88AS5 8.76e-35 130 38 4 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5WXF0 9.93e-35 130 39 2 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Lens)
Q9HY19 9.95e-35 130 40 1 191 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P96063 1.04e-34 130 38 6 226 2 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q02R79 1.16e-34 130 40 1 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1GB17 1.18e-34 130 40 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
Q6FFZ1 1.3e-34 128 37 5 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8D653 1.43e-34 130 36 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q7A169 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.46e-34 130 43 2 174 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.46e-34 130 43 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q7MKU3 1.47e-34 130 38 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain YJ016)
Q8D9J4 1.47e-34 130 38 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio vulnificus (strain CMCP6)
Q1CDR0 1.52e-34 128 36 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.52e-34 128 36 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.52e-34 128 36 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q4KGX6 1.91e-34 127 40 5 192 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q57SD6 2.08e-34 130 38 6 226 3 phnT Putative 2-aminoethylphosphonate import ATP-binding protein PhnT Salmonella choleraesuis (strain SC-B67)
Q89UD2 2.13e-34 129 37 4 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7VYN2 2.3e-34 129 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q93DX8 2.35e-34 127 37 4 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q7WID6 2.38e-34 129 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q07LQ4 2.49e-34 127 39 5 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q63E84 2.79e-34 129 37 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 2.79e-34 129 37 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 2.79e-34 129 37 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q6HLQ9 2.85e-34 129 37 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q665B6 2.9e-34 127 36 4 210 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
A0LUE6 2.93e-34 130 36 5 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q8PHQ3 2.94e-34 127 37 3 188 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q9KLQ5 3.9e-34 129 36 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3PRY1 4.49e-34 129 38 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
O31339 4.55e-34 129 38 5 203 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q7NQN5 4.7e-34 129 38 1 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q81TH8 4.76e-34 128 37 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q30V33 4.84e-34 129 40 3 193 3 potA Spermidine/putrescine import ATP-binding protein PotA Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q6D201 4.9e-34 128 38 4 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q46ZM0 5.32e-34 129 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P37009 6.15e-34 128 38 1 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli (strain K12)
Q87PH3 6.46e-34 129 38 3 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8U8D6 7.36e-34 126 34 4 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7AH43 7.43e-34 128 38 1 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Escherichia coli O157:H7
Q0T8D1 7.48e-34 125 38 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q0T6A8 7.7e-34 125 35 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri serotype 5b (strain 8401)
Q0RT43 8.2e-34 126 36 6 230 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q83MG3 8.23e-34 125 38 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
Q9I6T2 8.66e-34 128 37 4 204 3 potA1 Spermidine/putrescine import ATP-binding protein PotA 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3Z3I7 9.03e-34 125 35 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella sonnei (strain Ss046)
Q6NBT1 1.05e-33 127 38 5 199 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q81GC1 1.13e-33 127 36 1 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q03ZQ0 1.14e-33 128 40 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
P0AAI1 1.25e-33 125 35 1 193 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 1.25e-33 125 35 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
P77795 1.35e-33 127 40 2 187 3 ydcT Uncharacterized ABC transporter ATP-binding protein YdcT Escherichia coli (strain K12)
Q160M2 1.4e-33 127 40 2 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q8XA06 1.54e-33 124 38 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q0K998 1.78e-33 127 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q9CGD4 1.9e-33 128 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. lactis (strain IL1403)
Q98DT6 1.95e-33 125 34 3 211 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q881U6 1.95e-33 124 36 3 213 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q7W6G5 2.27e-33 127 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q32K28 2.31e-33 124 38 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q8XZP8 2.47e-33 127 38 4 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7NIW1 2.5e-33 126 40 2 190 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q02Z10 2.59e-33 128 36 3 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Lactococcus lactis subsp. cremoris (strain SK11)
Q8UBB7 2.64e-33 127 36 2 209 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q3IX40 2.71e-33 126 37 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q1B8U4 2.94e-33 124 37 2 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q9KL04 3.12e-33 127 36 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q82CD3 3.18e-33 124 36 6 192 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q2YKR8 3.19e-33 126 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus (strain 2308)
Q6D2F6 3.62e-33 126 40 4 197 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q72FW5 3.67e-33 126 39 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q83LN2 3.83e-33 124 35 1 193 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Shigella flexneri
Q8U648 3.95e-33 124 37 2 187 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8FW07 3.98e-33 126 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella suis biovar 1 (strain 1330)
Q578E9 3.98e-33 126 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella abortus biovar 1 (strain 9-941)
Q6F9A8 4.08e-33 126 39 5 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q98HF7 4.09e-33 126 39 3 202 3 potA Spermidine/putrescine import ATP-binding protein PotA Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2K8C8 4.13e-33 126 38 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8F6Z1 4.45e-33 126 35 5 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72PE5 4.45e-33 126 35 5 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q3MAR5 4.5e-33 126 37 3 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P44531 4.6e-33 125 35 2 206 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I2Z4 4.67e-33 126 35 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Histophilus somni (strain 129Pt)
Q3Z5U5 4.88e-33 123 37 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
P44513 4.99e-33 126 39 5 210 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P31548 5.72e-33 122 37 6 215 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
Q47T99 6.19e-33 126 38 4 208 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q8U6M1 6.4e-33 125 36 3 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YM92 6.47e-33 126 37 3 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8E8K8 7.23e-33 125 41 6 201 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8YCB1 7.37e-33 125 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q0RKH4 8.01e-33 123 37 3 189 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8RI39 8.12e-33 125 38 3 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q8FFB3 8.36e-33 125 39 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBJ8 8.36e-33 125 39 4 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli O157:H7
Q578K3 8.48e-33 125 38 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus biovar 1 (strain 9-941)
Q2YKX3 8.48e-33 125 38 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella abortus (strain 2308)
P16676 8.54e-33 125 39 4 196 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Escherichia coli (strain K12)
Q326G9 8.95e-33 122 37 6 213 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q92WJ0 9.82e-33 125 37 2 191 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q28VL7 1.04e-32 122 36 8 232 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q2J2E9 1.05e-32 125 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain HaA2)
Q73XU8 1.1e-32 125 38 2 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q2K6L3 1.12e-32 125 36 3 205 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9K9G7 1.18e-32 122 31 2 207 3 thiZ Formylaminopyrimidine import ATP-binding protein ThiZ Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A1TAI4 1.21e-32 125 42 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q21CA3 1.22e-32 125 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisB18)
Q6CZ34 1.25e-32 125 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4QP85 1.31e-32 125 39 5 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q8XZX8 1.42e-32 125 36 2 210 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0S0X2 1.47e-32 122 37 5 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q4K681 1.49e-32 125 35 5 214 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8UB29 1.84e-32 124 35 2 209 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9TKX3 1.86e-32 124 36 3 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nephroselmis olivacea
Q8U4K3 2.44e-32 124 36 4 190 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P17328 2.6e-32 125 36 1 191 2 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YAD6 2.7e-32 124 36 3 209 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q1MFL8 2.89e-32 122 35 2 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A1SWH9 2.95e-32 124 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q8YCG3 2.97e-32 124 38 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FVV5 3.06e-32 124 38 2 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Brucella suis biovar 1 (strain 1330)
Q73YZ5 3.16e-32 121 34 2 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 3.16e-32 121 34 2 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
O34392 3.23e-32 120 36 1 194 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q2JGF5 3.3e-32 122 34 7 232 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q668K6 3.4e-32 124 37 4 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pseudotuberculosis serotype I (strain IP32953)
Q0TLS2 3.46e-32 120 37 7 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P55453 3.48e-32 123 36 3 211 3 NGR_a03670 Uncharacterized ABC transporter ATP-binding protein y4fO Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q85A69 3.51e-32 124 34 1 190 2 cysA Sulfate/thiosulfate import ATP-binding protein CysA Anthoceros angustus
Q07UI9 3.83e-32 124 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhodopseudomonas palustris (strain BisA53)
Q7UC29 3.94e-32 124 39 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Shigella flexneri
Q981Y8 4.22e-32 121 36 4 196 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q60AI1 4.24e-32 124 38 2 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q6LKD4 4.3e-32 123 36 1 191 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photobacterium profundum (strain SS9)
Q8PP41 4.31e-32 121 33 1 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q1M8R6 4.33e-32 123 36 3 205 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q89ER4 4.34e-32 122 37 4 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7N6Z2 5.06e-32 123 37 4 201 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NX01 5.93e-32 123 37 4 198 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9L0Q1 6.1e-32 123 34 2 209 1 msiK Diacetylchitobiose uptake system ATP-binding protein MsiK Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
E0SCY1 6.79e-32 124 37 5 202 1 ousV Glycine betaine/choline transport system ATP-binding protein OusV Dickeya dadantii (strain 3937)
P14175 6.86e-32 124 35 1 191 1 proV Glycine betaine/proline betaine transport system ATP-binding protein ProV Escherichia coli (strain K12)
Q664X5 7.95e-32 123 36 4 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CNR8 7.95e-32 123 36 4 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAS8 7.95e-32 123 36 4 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis
Q1CC21 7.95e-32 123 36 4 210 3 malK Maltose/maltodextrin import ATP-binding protein MalK Yersinia pestis bv. Antiqua (strain Antiqua)
Q9CM80 8.42e-32 122 33 3 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pasteurella multocida (strain Pm70)
Q8ZPK4 9.35e-32 123 34 6 229 1 osmV Osmoprotectant import ATP-binding protein OsmV Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q00752 9.76e-32 123 33 1 210 3 msmK Multiple sugar-binding transport ATP-binding protein MsmK Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9K876 9.81e-32 122 37 6 210 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q92UV5 1.01e-31 123 40 2 186 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhizobium meliloti (strain 1021)
Q65S66 1.02e-31 122 33 3 214 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1RGD0 1.05e-31 119 36 7 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
Q9V2C0 1.12e-31 122 37 4 176 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus abyssi (strain GE5 / Orsay)
Q7NWX3 1.18e-31 122 39 2 191 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
O57896 1.27e-31 122 37 4 193 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q5FA19 1.27e-31 122 38 6 213 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q8D0W8 1.43e-31 122 36 4 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Yersinia pestis
Q62K82 1.44e-31 122 35 4 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q5LX21 1.53e-31 122 38 3 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q6N6K5 1.54e-31 120 36 2 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1B8V9 1.55e-31 122 41 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain MCS)
A1UG51 1.55e-31 122 41 2 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycobacterium sp. (strain KMS)
Q63TY1 1.61e-31 122 35 4 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
A1BC20 1.72e-31 119 35 7 235 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paracoccus denitrificans (strain Pd 1222)
P9WQI3 1.86e-31 122 35 2 209 1 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQI2 1.86e-31 122 35 2 209 3 sugC Trehalose import ATP-binding protein SugC Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8Z4V6 2e-31 122 38 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhi
P40860 2.04e-31 122 38 4 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z0H0 2.17e-31 121 36 3 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7W9U5 2.21e-31 121 38 5 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q9X196 2.23e-31 122 39 2 190 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7WGW1 2.25e-31 121 37 5 198 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q28QL7 2.41e-31 121 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Jannaschia sp. (strain CCS1)
Q8DIA0 2.58e-31 121 36 4 206 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P45247 2.64e-31 118 35 3 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 2.64e-31 118 35 3 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
P55604 2.83e-31 122 35 3 209 3 NGR_a02170 Uncharacterized ABC transporter ATP-binding protein y4oS Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q57293 2.83e-31 121 33 2 206 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Actinobacillus pleuropneumoniae
Q48IB9 3.13e-31 118 34 3 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5YYR7 3.16e-31 118 34 8 232 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Nocardia farcinica (strain IFM 10152)
Q5DZC6 3.19e-31 121 35 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Aliivibrio fischeri (strain ATCC 700601 / ES114)
A1B9H9 3.32e-31 118 34 3 189 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
O83658 3.39e-31 121 41 1 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Treponema pallidum (strain Nichols)
Q5JEB0 3.43e-31 120 37 4 190 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q7N8B9 3.99e-31 120 36 3 210 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7CS28 4.15e-31 121 33 2 209 1 smoE Sulfoquinovosyl glycerol transport ATP-binding protein SmoE Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UBY6 4.61e-31 118 33 4 203 3 thiQ Thiamine import ATP-binding protein ThiQ Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7MFC4 4.69e-31 121 35 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain YJ016)
Q8D3V0 4.69e-31 121 35 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio vulnificus (strain CMCP6)
Q2K4V4 5.09e-31 121 34 2 209 3 ugpC2 sn-glycerol-3-phosphate import ATP-binding protein UgpC 2 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q1AS06 5.33e-31 121 38 2 191 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q4W575 5.85e-31 120 38 6 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 5.85e-31 120 38 6 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q8FYU9 5.93e-31 117 37 3 208 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella suis biovar 1 (strain 1330)
Q8YJ04 5.93e-31 117 37 3 208 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FL82 5.96e-31 117 36 7 215 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O86751 6.24e-31 120 34 4 217 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7NRX5 6.85e-31 120 37 3 212 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q9MUN1 7.14e-31 120 37 2 197 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mesostigma viride
Q9G4F5 7.96e-31 120 37 5 194 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q7VZE5 9.56e-31 120 37 5 194 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q9YGA6 9.65e-31 120 35 1 197 1 malK Trehalose/maltose import ATP-binding protein MalK Thermococcus litoralis (strain ATCC 51850 / DSM 5473 / JCM 8560 / NS-C)
Q13GD4 1.07e-30 117 35 4 203 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Paraburkholderia xenovorans (strain LB400)
Q87GB5 1.07e-30 120 34 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q3KCC5 1.13e-30 119 36 6 224 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Pseudomonas fluorescens (strain Pf0-1)
Q57BC2 1.22e-30 117 37 3 208 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus biovar 1 (strain 9-941)
Q2YLW6 1.22e-30 117 37 3 208 3 thiQ Thiamine import ATP-binding protein ThiQ Brucella abortus (strain 2308)
Q45460 1.31e-30 120 33 4 209 2 opuBA Choline transport ATP-binding protein OpuBA Bacillus subtilis (strain 168)
Q66FU4 1.32e-30 119 34 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q6LK87 1.48e-30 119 35 4 211 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photobacterium profundum (strain SS9)
Q82WT5 1.84e-30 119 37 3 195 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q5YZY9 1.91e-30 119 38 1 189 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q1MCN6 1.96e-30 119 34 2 209 3 ugpC1 sn-glycerol-3-phosphate import ATP-binding protein UgpC 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q2SU77 2.01e-30 119 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q62GB4 2.19e-30 119 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia mallei (strain ATCC 23344)
Q63Q62 2.61e-30 119 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain K96243)
Q13RD3 2.71e-30 116 35 5 205 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paraburkholderia xenovorans (strain LB400)
Q9RR46 2.79e-30 119 36 2 196 1 gbuA Glycine betaine/carnitine transport ATP-binding protein GbuA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9HYF9 2.81e-30 116 36 3 200 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02QT6 2.81e-30 116 36 3 200 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q47YG8 2.85e-30 116 32 4 229 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q9KHT9 2.9e-30 119 32 5 220 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 2.9e-30 119 32 5 220 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q3JMW7 3.41e-30 118 36 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia pseudomallei (strain 1710b)
Q79EE4 3.98e-30 118 36 1 191 1 ggtA Osmoprotective compounds uptake ATP-binding protein GgtA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2K1C8 4.45e-30 118 34 2 209 3 ugpC3 sn-glycerol-3-phosphate import ATP-binding protein UgpC 3 Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P10091 4.45e-30 118 33 2 202 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Marchantia polymorpha
A1JIE0 5.18e-30 118 34 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q92WD6 5.18e-30 118 33 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Rhizobium meliloti (strain 1021)
Q1CNC6 5.57e-30 118 34 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Nepal516)
Q74R28 5.57e-30 118 34 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis
Q1CBH2 5.57e-30 118 34 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Yersinia pestis bv. Antiqua (strain Antiqua)
Q7VMV4 6.03e-30 115 35 2 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9HZL7 6.24e-30 115 35 3 200 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KIF7 7.16e-30 118 35 3 206 3 opuAA Glycine betaine transport ATP-binding protein OpuAA Lactococcus lactis subsp. lactis (strain IL1403)
Q6MCV4 7.98e-30 118 38 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Protochlamydia amoebophila (strain UWE25)
Q31GF5 8.94e-30 114 33 5 212 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
P54933 1.08e-29 117 35 4 209 3 smoK ATP-binding transport protein SmoK Cereibacter sphaeroides
Q0BIZ6 1.33e-29 117 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q65QT6 1.43e-29 117 34 3 209 3 malK Maltose/maltodextrin import ATP-binding protein MalK Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q21JQ9 1.61e-29 114 35 3 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8ZRV2 1.62e-29 114 35 4 211 1 thiQ Thiamine import ATP-binding protein ThiQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q98G42 1.65e-29 117 33 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6D734 1.74e-29 116 36 3 210 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4ZTG9 1.81e-29 114 36 2 195 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. syringae (strain B728a)
Q50966 1.83e-29 116 38 6 213 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q5PDF8 1.9e-29 114 35 4 211 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q13TV1 1.94e-29 116 35 2 209 3 ugpC sn-glycerol-3-phosphate import ATP-binding protein UgpC Paraburkholderia xenovorans (strain LB400)
Q6LV32 2.06e-29 114 39 4 174 3 thiQ Thiamine import ATP-binding protein ThiQ Photobacterium profundum (strain SS9)
Q7N986 2.15e-29 116 34 5 212 3 malK Maltose/maltodextrin import ATP-binding protein MalK Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07695
Feature type CDS
Gene tauB
Product ABC-type taurine transport system, ATPase component
Location 209004 - 209777 (strand: -1)
Length 774 (nucleotides) / 257 (amino acids)
In genomic island -

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2618
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4525 Inorganic ion transport and metabolism (P) P ABC-type taurine transport system, ATPase component

Protein Sequence

MADIVLENIDLVYHGQPQTTLSGINLTIPDNGITVILGASGCGKTSLLNIVAGFLTPSGGKITRNGNDIQHPASDRAVVFQNDALMPWLNVYENIALGLKIKKLGKQEEKAIVEENLQKVGLLHTITDNIWSLSGGMRQRVGIARALAVKSDFILMDEPFGALDAANREQMQSLILTLWQKQQSAFFIITHDIEEALLMATKLILMAPYPGRIISGEEPPFYKQWSQGRRIREIKSDPAFIHHRDTLSDKIMAYQRG

Flanking regions ( +/- flanking 50bp)

GCCGGAAATATCAATACGGAGGCCGTCACCACAGCGGCGGGGAAATAATAATGGCAGATATCGTACTGGAGAATATTGATCTGGTTTATCACGGTCAGCCGCAGACAACCTTATCCGGTATTAATTTAACCATTCCGGATAACGGTATTACCGTTATTCTCGGCGCTTCCGGCTGCGGAAAAACATCGCTGCTGAATATTGTTGCCGGGTTTTTAACGCCCTCCGGCGGAAAAATAACACGGAACGGAAACGACATTCAGCATCCCGCCTCTGACAGAGCCGTGGTATTTCAGAATGACGCACTGATGCCCTGGCTGAATGTCTATGAAAATATCGCACTGGGACTGAAAATTAAAAAGCTCGGTAAGCAGGAAGAAAAAGCGATTGTCGAAGAAAACCTGCAAAAAGTCGGATTACTGCATACTATTACCGACAATATCTGGTCACTCTCCGGCGGTATGCGTCAGCGGGTCGGTATTGCACGGGCACTGGCTGTAAAGTCTGATTTTATTCTGATGGATGAACCCTTCGGCGCACTCGATGCCGCCAACCGGGAACAGATGCAATCCTTAATTCTGACGCTGTGGCAAAAACAGCAGAGTGCCTTTTTTATTATTACTCATGATATTGAAGAGGCACTGTTAATGGCCACAAAGCTGATATTAATGGCGCCGTATCCCGGCCGGATAATATCCGGAGAAGAACCCCCGTTTTATAAACAATGGTCGCAGGGACGGCGTATCCGTGAGATTAAATCGGATCCGGCGTTTATTCATCACCGCGACACACTGTCAGACAAAATAATGGCGTATCAGCGTGGTTAATTAACGGACACGGAGTGACATCAATGGCAGATATAACCGGAAATAAACAA